Application of poplar PtrSWEET2b gene in regulation of tree secondary wall thickness and plant height

Abstract

The application discloses a Populus trichocarpa PtrSWEET2b gene in the regulation of tree secondary wall thickness and plant height, aims to solve the technical problem that there is currently a lack of means for regulating tree secondary wall thickness and plant height. The present application found that interfering with the expression of the PtrSWEET2b gene affects the transport of part of the soluble sugar of the plant, and further affects the thickening of the xylem secondary wall and the formation of wood, mainly reflected in the knockout PtrSWEET2b causes the transgenic plants to be dwarf, and the xylem cell secondary cell wall to be thin. The present application has important theoretical guiding significance for cultivating high-quality wood trees or landscape new varieties.

Description

Technical Field

[0001] This invention application relates to the field of genetic engineering technology, specifically to a type of hairy poplar. PtrSWEET2b Application of genes in the regulation of secondary wall thickness and plant height in trees. Background Technology

[0002] Forests are the largest carbon reservoir in Earth's terrestrial ecosystems, capable of persistently and stably absorbing and fixing carbon dioxide from the atmosphere. Most of the carbon fixed by forest biomass is stored in the cell walls of wood, whose structure is primarily composed of cellulose microfibrils as the framework, with hemicellulose and lignin serving as binding and filling components. As a core property of wood, the thickness of wood fiber cell walls varies considerably among different broadleaf tree species, indicating species-specific differences in the regulation of wood fiber cell wall thickening.

[0003] Over the past few decades, extensive research has been conducted on the genetic basis of wood cell wall thickening, preliminarily identifying many important regulatory factors and clarifying that wood cell wall thickening is a complex process controlled by a transcriptional regulatory network. Current research mainly focuses on downstream wood component synthesis and the elucidation of transcriptional regulatory networks, while understanding of upstream carbon transport and its regulatory role remains relatively weak. The transport of photosynthetic products from source leaves to sink tissues is a fundamental characteristic of plant source-sink balance. To date, only a few members have been found to participate in the allocation and transport of upstream photosynthetic products, such as the plasma membrane protein PtSWEET7 expressed in the phloem of poplar and SUT3, which is localized in the xylem plasma membrane.

[0004] Nevertheless, how sugars are expelled from wood cells to the apoplast remains unclear. Furthermore, current research still reveals very little about key sugar efflux transporters involved in the thickening of the secondary wood cell wall. Understanding new sugar efflux transporters that regulate secondary wood cell wall thickening is crucial for studying the molecular mechanisms of wood formation and for cultivating new varieties of high-quality timber.

[0005] The information disclosed in this background section is intended only to enhance the understanding of the background technology of this disclosure and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0006] The inventors used Agrobacterium-mediated transformation of Populus tomentosa (… Populus trichocarpa A new species of hairy poplar was obtained through a genetic transformation system. PtrSWEET2b Gene mutant plants. Analysis using a series of techniques revealed that knockout... PtrSWEET2b Genes influence the transport of soluble sugars in parts of the plant, thereby affecting the thickening of the secondary xylem wall and wood formation, mainly manifested in the knockout process. PtrSWEET2b This results in shorter transgenic plants and thinner secondary cell walls in the xylem cells; these findings indicate that... PtrSWEET2bGenes play a regulatory role in the thickness of the secondary wall of trees. The research content of this invention application has important practical and theoretical guiding significance for cultivating new varieties of high-quality timber trees and landscape trees.

[0007] According to one aspect of this disclosure, the nucleotide sequence of *Populus pilosa* as shown in SEQ ID NO.1 is... PtrSWEET2b Genes, recombinant vectors containing the gene or its fragments, or engineered bacteria containing the gene or its fragments are used in the regulation of secondary wall thickness and / or plant height in trees.

[0008] According to another aspect of this disclosure, the nucleotide sequence of *Populus tomentosa* as shown in SEQ ID NO.1 is... PtrSWEET2b Genes, recombinant vectors containing the gene or its fragments, or engineered bacteria containing the gene or its fragments are used in the preparation of formulations that regulate the thickness of the secondary wall and / or the height of trees.

[0009] According to another aspect of this disclosure, the nucleotide sequence of *Populus tomentosa* as shown in SEQ ID NO.1 is... PtrSWEET2b Genes, recombinant vectors containing the gene or its fragments, or engineered bacteria containing the gene or its fragments are used in the breeding of varieties / strains that vary in the thickness of the secondary cell wall and / or the height of the tree.

[0010] In some embodiments of this disclosure, the hairy poplar is made PtrSWEET2b Genes are downregulated in trees to reduce secondary wall thickness and / or height, in order to obtain potted seedlings or landscape trees.

[0011] In some embodiments of this disclosure, the recombinant vector is *Populus pilosa*. PtrSWEET2b Gene downregulation expression vectors are used to reduce the thickness of the secondary epithelial wall and / or the height of trees, thereby obtaining seedlings suitable for potted plants or ornamental purposes.

[0012] In some embodiments of this disclosure, the trees are Populus tomentosa, Populus alba, or Populus spp.

[0013] In some embodiments of this disclosure, the hairy poplar PtrSWEET2b The promoter sequence of the gene is shown in SEQ ID NO.3.

[0014] In some embodiments of this disclosure, the hairy poplar PtrSWEET2b The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.2.

[0015] One or more technical solutions provided in the embodiments of this application have at least one of the following technical effects or advantages:

[0016] 1. Knockout confirmed PtrSWEET2bGenes influence the transport of some soluble sugars in plants, thereby affecting the thickening of the secondary xylem wall and wood formation, mainly manifested in the knockout stage. PtrSWEET2b This results in shorter transgenic plants and thinner secondary cell walls in the xylem cells.

[0017] 2. This application has important theoretical guiding significance for the cultivation of high-quality timber or new landscape varieties. Attached Figure Description

[0018] Figure 1 As shown in one embodiment of this application PtrSWEET2b The growth status of mutant *Populus hairy-fruited* plants and wild-type *Populus hairy-fruited* plants after 4 months of growth in a greenhouse; among them, the figures show... sweet2b-2 / 4 The two lines represent two different lines of the mutant. WT represents wild-type Populus tomentosa. The scale bar is 10 cm.

[0019] Figure 2 As shown in one embodiment of this application PtrSWEET2b The mutant preparation process includes gene editing site selection and protein length estimation after sequencing, as shown in the figure. sweet2b-2 and sweet2b-4 These represent two different lines of homozygous mutant plants used in subsequent analyses.

[0020] Figure 3 As shown in one embodiment of this application PtrSWEET2b Figure 1 shows the height growth changes of mutant and wild-type Populus hairy-fruited plants after 4 months of greenhouse growth; (Figure 2 shows the height growth changes of mutant and wild-type Populus hairy-fruited plants after 4 months of greenhouse growth). sweet2b-2 The symbols indicate different strains of mutant plants, with WT representing wild-type Populus tomentosa.

[0021] Figure 4 As shown in one embodiment of this application PtrSWEET2b The results of growth phenotypic analysis of mutant and wild-type Populus hairy-fruited plants after 4 months of growth in a greenhouse are shown in the figure. sweet2b-2 The bar represents the mutant plant, WT represents wild-type Populus tomentosa, the error bar represents the standard error calculated from at least 6 biological replicates, the asterisk represents the ANOVE test result, *P<0.05, **P<0.01.

[0022] Figure 5 As shown in one embodiment of this application PtrSWEET2b A comparison of the basal diameter of mutant and wild-type Populus hairy-fruited plants after 4 months of growth in a greenhouse; in the figure... sweet2b-2 The text indicates mutant plants, with WT representing wild-type Populus tomentosa. Each lineage has at least 3 trees, and 3 cross sections are randomly selected from each tree. The scale bar is 1 mm.

[0023] Figure 6 As shown in one embodiment of this application PtrSWEET2bObservational images of mature xylem fiber cell walls in mutant and wild-type Populus tomentosa plants; among which, the figures are shown in the figure. sweet2b-2 The figures represent mutants, WT represents wild type, scale bar = 2 μm; each line has at least 3 trees, and 3 cross sections are randomly selected from each tree. At least 30 cell wall thicknesses are statistically analyzed using ImageJ. Error bars represent the standard error calculated by at least three biological replicates, asterisks represent ANOVE test results, and **P < 0.01.

[0024] Figure 7 As shown in one embodiment of this application PtrSWEET2b A graph showing the content of soluble sugars in the leaves of mutant and wild-type Populus tomentosa plants; in the graph... sweet2b-2 / 4 The two lines represent two different lines of the mutant. WT represents wild-type Populus tomentosa. The error bar represents the standard error calculated by at least three biological replicates. The asterisk represents the ANOVE test result. **P<0.01.

[0025] Figure 8 This is a subcellular localization analysis diagram of PtrSWEET2b in Arabidopsis root tip in one embodiment of this application; wherein, GFP protein is used as a control, and the scale bar is 50 µm. Detailed Implementation

[0026] To make the objectives, technical solutions, and advantages of the embodiments of this application clearer, the spirit of the inventive concept embodied in this application will be described in detail below with reference to specific embodiments. Any person skilled in the art who understands the embodiments of this application can make changes and modifications based on the technology taught in this application without departing from the spirit and scope of this application.

[0027] Unless otherwise specified, the experimental and detection methods used in the following examples are conventional methods, and the materials, reagents, enzymes, competent cells, plasmids, etc. used are all obtained commercially unless otherwise specified.

[0028] Example 1: Populus tomentosa PtrSWEET2b Construction of gene editing vectors

[0029] Predictions using the CRISPR-P 2.0 website PtrSWEET2b Based on the specific editing target and the sequence information of the pHSE401-2gRNA vector, suitable primers were designed and synthesized by a biotechnology company for use in editing. PtrSWEET2b The primer sequences for the gene editing vector are shown in Table 1.

[0030] Table 1 PtrSWEET2b Primers and sequences used in gene editing

[0031] .

[0032] Four-primer amplification was performed using pCBC-DT1T2 diluted 100-fold as a template. -BsF / -BsR were the normal primer concentrations; -F0 / -R0 were diluted 20-fold. Cloning was performed by polymerase chain reaction (PCR) to obtain the primers containing... PtrSWEET2b Fragments of specific target sequences. The reaction system is shown in Table 2.

[0033] Table 2 PCR reaction system

[0034] .

[0035] The target bands were separated by agarose gel electrophoresis of the obtained PCR products, and the target fragments were recovered by gel extraction using Thermo's SilicaBead DNA Gel Extraction Kit. Finally, the enzyme digestion reaction system shown in Table 3 was established.

[0036] Table 3 Enzyme digestion reaction system

[0037] .

[0038] Thaw DH5α competent cells on ice. Add all the ligation products to the competent cells and mix thoroughly. Heat shock at 42°C for 1 min, place on ice for 3 min, add antibiotic-free LB medium, and activate at 37°C and 200 rpm for 1 h. Collect the cells at low speed and spread them on solid LB medium (containing 50 mg / L kanamycin), and incubate overnight at 37°C. The next day, perform PCR identification on the obtained single-point clones using vector primers to identify positive clones. Pick a positive single clone and place it in 5 mL of LB medium (kanamycin, 50 mg / L), and incubate overnight at 37°C and 200 rpm. The next day, preserve the bacterial strain and collect the cells by centrifugation. Extract plasmids and sequence the extracted plasmids using primers U626-IDF and U629-IDR, following the instructions of the OMEGA plasmid extraction kit. Sequencing primers are shown in Table 4.

[0039] Table 4. Sequencing primer sequences for gene editing vectors

[0040] .

[0041] Based on the target sequence information, the sequencing results are compared to obtain the correct editing vector.

[0042] Example 2: Populus tomentosa PtrSWEET2b Obtaining transgenic plants

[0043] 1. Freeze-thaw transformation of Agrobacterium

[0044] ① Melt Agrobacterium GV3101 competent cells in an ice bath;

[0045] ② Add 3 μL of expression vector plasmid, incubate on ice for 30 min, freeze in liquid nitrogen for 1 min, and then incubate in water at 37℃ for 5 min;

[0046] ③ Add 950 μL of antibiotic-free YEP medium and incubate at 28℃ and 200 rpm for 4 h with shaking.

[0047] ④ Centrifuge at 3000 rpm for 5 min to concentrate the bacterial culture, and then rehydrate the bacterial cells with 100 μL YEP;

[0048] ⑤ Spread the reconstituted bacterial cells onto solid YEP medium supplemented with 50 mg / L kanamycin, 50 mg / L gentamicin, and 50 mg / L rifampin, and incubate at 28°C for 36–48 h. Detect positive clones by bacterial culture PCR using vector primers.

[0049] 2. Agrobacterium-mediated genetic transformation of Populus tomentosa

[0050] ① Select Agrobacterium strain containing plant expression vector and add it to 20 mL of LB medium containing resistance (50 mg / L kanamycin + 50 mg / L gentamicin + 50 mg / L rifampin). Incubate overnight at 28℃ and 220 rpm.

[0051] ② The next day, 1000 μL of bacterial culture was added to 50 mL of resistant LB liquid medium (kanamycin 50 mg / L + gentamicin 50 mg / L + rifampin 50 mg / L), and cultured at 28℃ and 220 rpm until OD500 was reached. 600 It is 0.6.

[0052] ③ Take a stem segment from a 1-month-old aseptic tissue culture seedling of Populus tomentosa and place it in the cultured bacterial solution for 20 minutes.

[0053] ④ Remove the stem segments and place them on a co-culture medium. Incubate in the dark for 2 days.

[0054] ⑤ Two days later, thoroughly wash the explant stem segments with sterile water and place them on a proliferation medium for normal culture.

[0055] ⑥ After the resistant buds have grown, insert them into the rooting medium to induce rooting.

[0056] 3. Identification of transgenic mutant plants

[0057] DNA was extracted from the leaves of resistant buds. Utilizing... PtrSWEET2b Specific DNA identification primers were used to obtain DNA containing [specific DNA] via PCR cloning. PtrSWEET2b Genomic sequences of specific target sites.

[0058] DNA cloning primers are shown in Table 5.

[0059] Table 5. Sequence primer sequences for gene editing sites

[0060] Primer name Sequence (5'-3') Identify ST2b-F TAGGTATTCCTTGACCACGGAG Identify ST2b-R ATGCATGTACATTAAGCCTACTG

[0061] The obtained PCR products were subjected to agarose gel electrophoresis to separate the target band, and the target fragment was recovered from the gel using the Thermo SilicaBead DNA Gel Extraction Kit. The current fragment was then ligated into the pMD18-T vector. The specific reaction system and conditions are as follows:

[0062] pMD18-T vector 1 μL

[0063] Target fragment 1 μL

[0064] Solution I 2 μL

[0065] Connection conditions: Reaction at 16℃ for 1 h.

[0066] Thaw DH5α competent cells on ice. Add all the ligation products to the competent cells and mix thoroughly. Heat shock at 42°C for 1 min, place on ice for 3 min, add antibiotic-free LB medium, and activate at 37°C and 200 rpm for 1 h. Collect bacterial cells at low speed and spread them on solid LB medium (containing 50 mg / L ampicillin), and incubate overnight at 37°C. The next day, perform PCR identification on the obtained single-point clones using cloning primers to identify positive clones. Pick a positive single clone and incubate in 5 mL of LB medium (kanamycin, 50 mg / L) at 37°C and 200 rpm overnight. The next day, send the bacterial culture for plasmid extraction and sequencing.

[0067] Nine independent resistant lines were obtained through Agrobacterium-mediated genetic transformation, and were named as follows: sweet2b-1~9 , sweet2b The growth status of mutant and wild-type plants after 4 months of greenhouse growth is shown in the figure below. Figure 1 As shown. After sequencing and comparison, compared with the DNA sequence of wild-type Populus tomentosa, sweet2b-2 / 4 A gene mutation causes the predicted protein translation to terminate prematurely. Figure 2 This indicates that the hairy poplar was successfully obtained. sweet2b Mutant plant.

[0068] Example 3: Populus tomentosa PtrSWEET2b The role of genes in regulating secondary growth in trees

[0069] 1. Phenotypic analysis of the growth of the mutant obtained in Example 3 and wild-type Populus tomentosa plants.

[0070] Growth phenotypic analysis includes the following indicators:

[0071] Plant height and basal stem measurement: Mutant and wild-type plants were simultaneously transplanted into sterilized black soil and placed in a greenhouse. After 30 days, a mark was made at a position 20 cm above the ground. This point served as the reference point for plant height and basal stem measurement. At least 6 trees were used for each line.

[0072] Wild-type and wild-type plants grown in a greenhouse for 4 months were selected respectively. sweet2b Mutant plants were compared with wild-type Populus tomentosa plants grown in a greenhouse and... sweet2b Mutant plants were found to have been knocked out. PtrSWEET2b The mutant plants exhibited significant changes in growth phenotype, such as Figure 1 , Figure 3 , Figure 4 and Figure 5 .

[0073] Compared to wild-type plants, sweet2b The plant's height and stem growth (histochemical staining of the 12th stem node using phloroglucinol, which stains lignin in plant cells red, aiding in the assessment of tree growth and development) showed a significant downward trend. Statistical analysis data (see...) Figure 3 and Figure 4 The mutant plants showed significantly reduced growth, with a marked decrease in the number of stem nodes and average stem node length. These data indicate that... PtrSWEET2b Genes play a regulatory role in the height and diameter growth of trees; knockout PtrSWEET2b Genes caused changes in the growth and development of the hairy poplar plant.

[0074] 2. Histological observation of the mutant lines obtained in Example 3 and wild-type Populus tomentosa plants.

[0075] The 12th stem node (IN12) of a 3-month-old Populus tomentosa was rapidly cut into rectangular strips 1 mm wide (based on the cross-sectional width of the xylem radiating from the phloem) and 0.5 mm square at the bottom. These strips were then fixed in PBS buffer containing 2.5% glutaraldehyde and 4% paraformaldehyde. The soaked strips were placed in a vacuum desiccator and evacuated for 5 min, followed by negative pressure for 30 min; this step was repeated 3–6 times. The fixed strips were then incubated overnight at 4°C. The next day, the strips were washed three times with PBS buffer (5 min each time), soaked in 0.5% osmium tetroxide for 2 h, washed three times with PBS buffer (5 min each time), and then dehydrated with a gradient concentration of ethanol (30%→50%→70%→90%→100% twice; 5 min each time). The sample was then transferred to a mixture of acetone and a gradient concentration of resin (0→50%→70%→100%; 3 h each time) for embedding, and finally soaked in pure resin overnight. On the third day, the embedded samples were polymerized in a 72°C oven. After 48 hours, the resin-embedded samples were cut into 70 nm thick sections using an EMUC7 microtome. The sections were stained with uranyl acetate and lead citrate, and finally photographed using an HT-7700 electron transmission microscope. At least four trees were used for each line, and three sections (at least 15 cells) were randomly selected from each tree for cell wall structure and thickness analysis. Cell wall thickness was measured using ImageJ.

[0076] The results showed that ( Figure 6 Compared to wild-type plants, transgenic plants all contain S1 and S2 layers in their secondary cell wall structure; however, knockout PtrSWEET2b This results in a significant thinning of the secondary cell wall in the plant, and these data indicate... PtrSWEET2b It can regulate the thickening of the secondary wall of wood fibers.

[0077] Example 4: Populus tomentosa PtrSWEET2b The role of genes in regulating the accumulation of photosynthetic products in leaves

[0078] ① Before turning on the greenhouse lights in the morning, cut the second fully unfolded leaf from two-month-old wild-type and transgenic poplar trees (three biological replicates for each line) and grind them under liquid nitrogen. Weigh an equal weight of the sample (about 0.1 g) into a 1.5 mL centrifuge tube, add 1.0 mL of extraction solution (80% ethanol), and homogenize.

[0079] ②The samples were sonicated three times for 30 seconds each, and then centrifuged at 8000 g for 10 min.

[0080] ③ Take 850 μL of supernatant and transfer it to a new 2.0 mL EP tube. Add 20 mg of activated charcoal and incubate in a water bath at 80°C for 30 min. Gently shake the tube 3 to 5 times during this period, and then place it on ice to cool.

[0081] ④ Centrifuge at 8000 g for 10 min, take 700 μL of supernatant and transfer it to a new EP tube, then repeat the centrifugation once.

[0082] ⑤ Take 500 μL of supernatant and transfer it to a new EP tube. Add extraction solution to make up to 2 mL. Mix well and centrifuge at 8000 g for 10 min. Label the supernatant to be tested as 2 mL.

[0083] ⑥ Take 200 μL of supernatant + 100 μL of 2 mol / L NaOH, boil in a water bath for 5 min, cool on ice, and then immediately ionize.

[0084] ⑦ Add 1400 μL of 30% HCl and 400 μL of 0.1% resorcinol, mix by inversion, incubate at 80°C for 15 min, then incubate on ice for 2 min, and measure the OD. 480 Value. Construct a standard curve for sucrose.

[0085] ⑧ For fructose content determination, directly take 200 μL of supernatant + 1400 μL of 30% HCl + 500 μL of 0.1% resorcinol, mix by inversion, incubate at 80℃ for 15 min, then incubate on ice for 2 min, and measure OD. 480 Value. Construct a fructose standard curve.

[0086] The results show that ( Figure 7 Compared with wild-type plants, the sucrose content in the leaves of mutant plants increased by 128.4-147.5%, and the fructose content increased by 46.6-66.9%. These data indicate that the transport of soluble sugars such as sucrose and fructose in the leaves of transgenic plants is hindered.

[0087] Example 5: Subcellular localization of PtrSWEET2b in Populus tomentosa

[0088] 1. Construction of a PtrSWEET2b protein subcellular localization vector

[0089] Referring to the genome sequence information of *Populus hairy fruit* provided on the phytozome website, TOPO-compatible primers were designed at both ends of the coding region of the target gene, and a biotechnology company was commissioned to synthesize the primers to obtain primers for use with the target gene. PtrSWEET2b The upstream and downstream primer sequences for gene cloning are shown in Table 6.

[0090] Table 6 Primers and sequences used for PtrSWEET2b protein localization analysis

[0091] Primer name Sequence (5'-3') ST2B-topo-F <![CDATA[ CACC ATGAGTGATTCTATTCCTAATCCTG]]> ST2B-topo-R TGCATGCGAAGCTATCAAGGG

[0092] Note: The underlined part represents the TOPO vector adaptation site.

[0093] Using preserved xylem cDNA as a template, the coding region fragment of SWEET2b was cloned by PCR. The target band was separated by agarose gel electrophoresis of the obtained PCR product. The target fragment was recovered from the gel using the Thermo Silica Bead DNA Gel Extraction Kit, and the recovered product was ligated into the blunt-ended pENTR / D-TOPO vector. The specific reaction system and conditions are shown in Table 7.

[0094] Table 7 pENTR / D-TOPO Connectivity System

[0095] .

[0096] Thaw DH5α competent cells on ice, add all the ligation products to the competent cells, and mix thoroughly. Heat shock at 42°C for 1 min, place on ice for 3 min, add antibiotic-free LB medium, and activate at 37°C and 200 rpm for 1 h. Collect the cells at low speed and spread them on solid LB medium (containing 50 mg / L kanamycin), and incubate overnight at 37°C. The next day, perform PCR identification of the obtained single-point clones using primers for the target gene.

[0097] PCR products were analyzed by electrophoresis to identify positive clones. Positive single clones were picked and cultured overnight in 5 mL LB medium (kanamycin, 50 mg / L) at 37°C and 200 rpm. The next day, the bacterial strain was preserved and collected by centrifugation for plasmid extraction and sequencing, following the instructions of the OMEGA plasmid extraction kit.

[0098] Referring to the LR Clonase II enzyme mix instructions, the previously obtained target fragments were exchanged into the pGWB5 vector (Table 8). The products were transformed into E. coli DH5α competent cells, and after 1 h of incubation, appropriate amounts of cells were plated onto solid LB medium containing 50 mg / L kanamycin and 50 mg / L hyg, respectively, and incubated upside down at 37°C for 16 h. Single colonies were then identified by PCR and electrophoresis. Positive clones were picked and cultured, and the next day the cells were preserved, plasmids were extracted, and sequenced, retaining the correct expression vector pGWB5-SWEET2b-GFP.

[0099] Table 8 LR Switching System

[0100] Reagent Volume Procedure SWEET2b-topo 1 μL 25℃ / Overnight pGWB5 vector 1 μL LR Clonase II enzyme mix 0.5 μL

[0101] These expression vectors were transformed into Agrobacterium GV3101 competent cells. After 3 hours of incubation, appropriate amounts of cells were plated onto solid LB medium containing 50 mg / L RIF, 50 mg / L gen, 50 mg / L kana, and 50 mg / L hyg, respectively, and then incubated upside down at 28°C for 48 hours. Single colonies were identified again by PCR and electrophoresis. Positive clones were picked and cultured overnight, and the next day, pGWB5-SWEET2b-GFP-GV3101 was preserved.

[0102] 2. PtrSWEET2b Heteromorphic transformation of genes

[0103] ①On the evening of the first day. Streaked the Agrobacterium tumefaciens culture, preserved in glycerol at -70℃, onto LB medium (containing 50 mg / L rif, 50 mg / L gen, 50 mg / L kana and 50 mg / L hyg) with a sterilized toothpick and incubated at 28℃.

[0104] ②On the evening of the third day, select monoclonal Agrobacterium colonies and culture them in LB broth (containing 4 antibiotics) at 28°C with shaking for 14–20 hours. Use this as the original bacterial culture (take a small amount for PCR to identify the presence of the target gene fragment) for the next large-scale culture.

[0105] ③ On the afternoon of the 4th day, take 0.5–1.5 ml of the original bacterial culture and inoculate it into 250 ml of LB liquid medium (containing 4 antibiotics). Incubate at 28°C with shaking until the OD (digestive tract) is reached. 600 Between 1.0 and 1.1.

[0106] ④ On the morning of the 5th day, centrifuge at 2200 g for 8 min and collect the bacterial cells.

[0107] ⑤ The bacterial precipitate was suspended in 250 mL of freshly prepared conversion solution.

[0108] ⑥During transformation, soak the flowers of Arabidopsis thaliana in the bacterial solution for 5 minutes (ensuring that all flower buds are submerged).

[0109] ⑦ Use waste newspaper to absorb excess bacterial liquid from the stems and flowers, wrap the stems and flowers with plastic wrap and seal the top.

[0110] ⑧Then place the Arabidopsis thaliana in a dark or very low light environment for 24 hours.

[0111] ⑨ Then remove the plastic wrap, insert small bamboo sticks into each pot to prevent the Arabidopsis from falling over, and allow the Arabidopsis to return to its normal growth conditions before transformation.

[0112] ⑩ After the harvested seeds have matured, they germinate again. Transformants with high fluorescence intensity are selected for propagation.

[0113] 3. Plasmolysis in Arabidopsis root tips

[0114] Root tips from 5-day-old T3 generation transgenic Arabidopsis thaliana seedlings were placed on a glass slide, covered with a coverslip, and the prepared slide was inverted and examined under a laser confocal scanning microscope. The results showed that the SWEET2b-GFP fluorescence signal was uniformly distributed within the cell outline (see...). Figure 8 Subsequently, a suitable amount of mannitol (1M) was added to one side of the seedling root, and the seedling was allowed to stand at room temperature for 5 min. Finally, the distribution of the fluorescence signal was recorded again under a laser confocal scanning microscope. The final results showed that the SWEET2b-GFP fluorescence signal was distributed in the cytoplasm as the cell membrane contracted, indicating that SWEET2b is a cytoplasmic localized protein.

[0115] Although some preferred embodiments of this invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this application.

[0116] Obviously, those skilled in the art can make various modifications and variations to this application without departing from the spirit and scope of its inventive concept. Therefore, if such modifications and variations fall within the scope of the claims of this application and their equivalents, this application also intends to include such modifications and variations.

Claims

1. Knockout nucleotide sequence of *Populus tomentosa* as shown in SEQ ID NO.1 PtrSWEET2b Application of genes in reducing the thickness of the secondary parenchyma wall and / or the height of the plant in Populus tomentosa.

2. Knockout nucleotide sequence of *Populus tomentosa* as shown in SEQ ID NO.1 PtrSWEET2b Application of genes in the preparation of formulations that reduce the thickness of the secondary metamorphic wall and / or the height of Populus tomentosa.

3. Knockout nucleotide sequences of *Populus tomentosa* as shown in SEQ ID NO.1 PtrSWEET2b Application of genes in the breeding of poplar varieties with thin secondary walls and / or short stature.

4. The application according to claim 1, 2, or 3, characterized in that, The hairy poplar PtrSWEET2b The promoter sequence of the gene is shown in SEQ ID NO.

3.

5. The application according to claim 1, 2, or 3, characterized in that, The hairy poplar PtrSWEET2b The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.2.

Images