Use of rasa2 gene / protein as a target in screening drugs for preventing or treating senecavirus infection

Abstract

The application discloses a use of RASA2 gene / protein as a target point in screening of a drug for preventing or treating Senecavirus infection, and belongs to the technical field of genetic engineering. Specifically disclosed is a use of a RASA2 gene / protein expression inhibitor or a knock-out reagent in prevention or treatment of SVA infection, which can inhibit SVA growth, proliferation and invasion. The application can significantly improve the anti-infection ability to SVA by silencing or knocking out the RASA2 gene.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the use of the RASA2 gene / protein as a target in screening drugs for the prevention or treatment of Seneca virus infection. Background Technology

[0002] Seneca virus (formerly known as Seneca Valley virus) was discovered in 2002 by American researchers culturing adenovirus using embryonic retinal cells. When it was first isolated, purified, and analyzed, it was very similar to members of the cardivirus genus and was considered a recombinant virus of cardivirus. However, after in-depth research, it was found that its complete nucleotide sequence and microstructure differed, ultimately classifying it as belonging to the Picornaviridae family, Senecavirus genus. In 2015, the International Committee on Taxonomy of Viruses named it Senecavirus A (SVA). Initially, most research focused on its oncolytic properties; it wasn't until 2007 that Seneca virus was linked to porcine primary vesicular disease, attracting widespread attention in the veterinary field.

[0003] Seneca virus (SVA) infection can cause vesicular disease characterized by diarrhea, lameness, anorexia, and vesicles and erosions around the mouth and nose, and its clinical features are difficult to distinguish from those caused by foot-and-mouth disease virus (FMDV). Since 2014, SVA-induced swine vesicular disease has been reported in the United States, Brazil, China, Thailand, and other countries. SVA infection was first reported in my country in 2015. Studies have shown that pigs are the main host of SVA, and SVA nucleic acid has also been detected in houseflies and mice. Overall, current research on SVA is insufficient, and there are no effective treatments or commercially available vaccines for SVA infection.

[0004] RASA2 (Ras P21 protein activator 2), encoding RAS P21 protein activator 2 and a member of the RASGAP family, enhances the intrinsic GTPase activity of RAS, causing RAS proteins to exist in a RAS-GDP state. Mutations in RASA2 reduce the inhibition of the RAS signaling pathway, thereby promoting cancer development. For example, RASA2 is mutated in 5% of melanomas, and RASA2 expression is also associated with patient survival. Further experiments found that interfering with RASA2 in NIH3T3 cells promoted RAS activation and increased RAS-GTP expression. Arafeh also demonstrated that RASA2 and NF1 are negative regulators of RAS function in melanoma (Arafeh et al., 2019). Recent studies by Carnevale et al. have found that RASA2 can act as a signaling checkpoint for human T cells, and its expression is downregulated under acute T cell receptor stimulation and chronic antigen exposure. Knockout of RASA2 can increase the cytolytic activity of CAR T cells and has a significant advantage in clearing cancer cells.

[0005] In mouse models, RASA2 knockout CAR T cells also showed better therapeutic effects (Carnevale et al., 2022). Jinag et al., through database analysis, found that miR-31-3P expression was significantly reduced in medullary thyroid carcinoma, and low miR-31-3P expression was associated with poor prognosis. Further studies revealed that miR-31-3P can bind to the 3'UTR of RASA2, and transfection of miR-31-3P mimics into cells downregulated the expression of RASA2 mRNA and protein. Lin et al., through genome-wide association analysis, identified genes related to human height. In addition to some previously reported genes, they also found that NABP2, RASA2, RNF41, and SLC39A5 genes were associated with height (Lin et al., 2021). Zhu et al., through GWAS analysis, identified RASA2, CADM1, and HIF1AN genes as being associated with obesity. However, there are currently no reports on the relationship between RASA2 and SVA prevention and treatment. Summary of the Invention

[0006] In view of the above-mentioned shortcomings in the prior art, the present invention provides the use of RASA2 gene / protein as a target in screening drugs for the prevention or treatment of SVA infection. By silencing or knocking out the RASA2 gene, SVA infection can be effectively inhibited.

[0007] To achieve the above objectives, the technical solution adopted by the present invention to solve its technical problem is as follows:

[0008] The use of the RASA2 gene / protein as a target in screening drugs for the prevention or treatment of SVA infection, wherein the RASA2 gene ID is ENSSSCG00000011672.

[0009] Use of RASA2 gene / protein expression inhibitors or knockout agents in the preparation of drugs for the prevention or treatment of SVA infection.

[0010] Furthermore, drugs for the prevention or treatment of SVA infection have at least one of the following functions:

[0011] A1) Inhibits SVA growth or proliferation;

[0012] A2) Inhibits SVA invasion.

[0013] Furthermore, the RASA2 gene / protein expression inhibitor or knockout agent is at least one of nucleic acid molecules, small molecule compounds, peptides, proteins, gene editing vectors, lentiviruses, or adeno-associated viruses.

[0014] Furthermore, the suppression, silencing, or knockout of the RASA2 gene can be achieved through gene mutation, gene silencing, gene knockout, gene editing, or gene knockdown techniques well known to those skilled in the art. For example, RNA interference (RNAi) technology can be used to specifically eliminate or shut down the expression of a particular gene; gene editing tools can include, but are not limited to, CRISPR / Cas9 technology, zinc finger nucleases (ZFNs), or transcription activator-like effector nucleases (TALENs).

[0015] Furthermore, RASA2 gene / protein expression inhibitors or knockout agents include sgRNAs that target and knock out the RASA2 gene / protein, or siRNAs that silence the RASA2 gene.

[0016] Furthermore, the sgRNA is GTCCCAGTTCCAGGTAGAAG.

[0017] Furthermore, the siRNA is RASA2-si499-F / R, RASA2-si810-F / R, or RASA2-si1150-F / R.

[0018] A combination of drugs for the prevention or treatment of SVA infection, comprising the aforementioned RASA2 gene / protein expression inhibitors or knockout agents.

[0019] The use of the RASA2 gene in the preparation of formulations for breeding SVA-resistant pig breeds.

[0020] Use of the RASA2 gene in the preparation of formulations for the improvement of germplasm resources in SVA-related disease-resistant pig breeds.

[0021] The beneficial effects of this invention are:

[0022] This invention significantly enhances the resistance of cell lines to SVA infection by silencing or knocking out the RASA2 gene. Attached Figure Description

[0023] Figure 1 To knock down the changes in RAS42 expression at both the transcriptional and protein levels;

[0024] Figure 2 The results of the detection of SVA viral RNA copy number after RASA2 knockdown;

[0025] Figure 3 This is a structural diagram of a three-plasmid system;

[0026] Figure 4 This is a graph showing the sequencing results of the RASA2 knockout cell line.

[0027] Figure 5 Results of viral RNA copy number detection after SVA infection of RASA2 knockout cells;

[0028] Figure 6 The results show the detection levels of RASA2 mRNA and protein in RAS42-KO2 cells;

[0029] Figure 7 This is a cell morphology diagram of R4S42-KO2 cells after viral infection.

[0030] Figure 8 The results show the viral RNA copy number after RAS42-KO2 cells were infected with the virus.

[0031] Figure 9 The infection status of SVA-GFP in RASA2-KO2 cells;

[0032] Figure 10 To supplement the results of viral RNA copy number detection after RASA2;

[0033] Figure 11 The results show the viral RNA copy number after RASA2 overexpression. Detailed Implementation

[0034] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0035] Example 1: The effect of silencing the RASA2 gene on SVA infection

[0036] 1. Design siRNA

[0037] Based on the RASA2 gene with gene number ENSSCG00000011672, RASA2-si499-F / R, RASA2-si810-F / R, and RASA2-si1150-F / R were designed to interfere with its expression. The results are shown in Table 1.

[0038] Table 1 siRNA sequences

[0039]

[0040] 2. PK-15 cells were seeded in 12-well plates. When the cell density reached 60%-70%, R4SA2-siRNA or R4SA2-siNC was transfected. Cell samples were collected after 36 hours, and total RNA and total protein were extracted. The expression of RASA2 mRNA and protein was detected. The results are shown in the table below. Figure 1 Where A represents the relative content of RASA2 mRNA after R4SA2 knockdown, and B represents the expression of RASA2 protein after R4SA2 knockdown.

[0041] like Figure 1 As shown, compared with RASA2-siNC transfection, RASA2-si499, R4SA2-si810, and RASA2-sil150 transfection significantly reduced RASA2 expression at both the transcriptional and protein levels.

[0042] 3. RASA2-siRNA or R4SA2-siNC was transfected into wild-type IBRS-2 cells and wild-type PK-15 cells. 36 h after transfection, cells in each group were infected with SVA (MOI=1). Cell samples were collected 12 h after viral infection, total RNA was extracted, and viral RNA copy number was detected. Results are shown below. Figure 2 In this context, A represents the effect of knocking down RAS42 in IBRS-2 cells on viral RNA copy number; and B represents the effect of knocking down RAS42 in PK-15 cells on viral RNA copy number.

[0043] like Figure 2 As shown, knocking down R4SA2 in both IBRS-2 and PK-15 cells significantly reduced the intracellular viral RNA copy number, indicating that R4SA2 plays an important role in viral infection.

[0044] Example 2: Construction of RASA2 gene knockout cell line

[0045] 1. This invention uses the CRISPR-PB vector system (see...). Figure 3 This system contains three plasmids: the piggyBac transposon backbone vector pSg4 (containing the puro resistance gene) with sgRNA, the plasmid pPBase that transiently expresses the PB transposase, and the plasmid pS10 (containing the neo resistance gene) that expresses the Cas9-flag protein induced by doxorubicin.

[0046] 2. A RASA2-sgRNA, GTCCCAGTTCCAGGTAGAAG, was designed based on the RASA2 gene with gene number ENSSSCG00000011672. During synthesis, the corresponding sticky ends of the BbsI endonuclease were added. After obtaining the sequence, the two single strands of the sgRNA were annealed to form a double strand. The annealing reaction system is shown in Table 2, and the reaction procedure is shown in Table 3.

[0047] Then, it was ligated with the BbsI-digested vector backbone pSg4. The ligation reaction system is shown in Table 4. The digestion conditions were: overnight in a metal bath at 16°C. When the ligated PCR fragment is small, the ligation time can be shortened. During the ligation reaction, the molar ratio of vector backbone DNA to insert fragment DNA is generally 1:2-10. Finally, the ligated vector was sequenced for verification.

[0048] Table 2 sgRNA annealing reaction system

[0049]

[0050] Table 3. sgRNA annealing reaction procedure

[0051]

[0052] Table 4 Connection Reaction System

[0053]

[0054] Solution I 5μL

[0055] 3. 1.5 μg of Psg4 plasmid, 1.5 μg of pS10 plasmid, and 1 μg of pPBase plasmid were transfected into two wild-type PK15 cells using liposome transfection. To remove untransfected cells, 24 h after transfection, the cells were treated with a medium containing 2 μg / mL puromycin and 4 μg / mL doxorubicin. Puromycin was used to select for positively transfected cells, and doxorubicin induced Cas9 protein expression, thus targeting the target gene.

[0056] 4. Resuscitate RASA2 target cells in 10cm dishes, then treat the mixed RASA2 target cell line with 4μg / mL puromycin for 36 hours, then replace with puromycin-free growth medium. After about one week of culture, obvious monoclonal cell spots appeared in the 10cm dishes. We picked monoclonal cells with a cloning loop and seeded them in 48-well plates. After the cells reached confluence, we passaged them, seeding some in 24-well plates and extracting the genome from the rest. We then amplified and sequenced the genome using validation primers. The specific primer sequences are as follows:

[0057] F:5'-CGCTGTTGAACCTTTTAGGACT-3';

[0058] R:5'-TTAGATGCATGTTCCTCTAAGTTTG-3'.

[0059] The results are as follows Figure 4 As shown in the figure (green represents the sgRNA target sequence, and blue represents the PAM sequence), we obtained two RASA2 knockout monoclonal PK15 cell lines. Among them, RASA2-KO1 has a deletion of 13 bases in both strands, and RASA2-KO2 has a deletion of 33 bases in both strands.

[0060] Example 3: Effect of RASA2 gene knockout on SVA infection

[0061] 1. The obtained RASA2 knockout PK15 cells, RASA2-KO1 and RASA2-KO2, were seeded in 12-well plates. When the cell density reached 70%-80%, the cells were infected with a virus with an MOI of 1. Twelve hours after infection, RNA was extracted from the cell samples, and the viral copy number was determined. The results are shown below. Figure 5 Meanwhile, the expression of RASA2 mRNA and protein in RASA2-KO2 cells was verified, and the results are shown in [Figure number missing]. Figure 6 , Figure 6 In the diagram, A represents mRNA expression and B represents protein expression.

[0062] like Figure 5 As shown, compared with wild-type cells, the viral copy number of RASA2 knockout cells RASA2-KO1 and RASA2-KO2 was significantly reduced, and the disease resistance phenotype of RASA2-KO2 was more obvious.

[0063] like Figure 6 As shown, the expression levels of RASA2 mRNA and protein were significantly reduced in the RASA2-KO2 monoclonal cell line.

[0064] 2. The obtained RASA2 knockout PK-15 cells (RASA2-KO2) were seeded in 12-well plates. When the cell density reached 70%-80%, they were infected with a virus with an MOI of 1. After infection, we observed the cell morphology of wild-type cells and RASA2 knockout PK-15 cells after RASA2-KO2 infection. Cell samples were collected at 3h, 6h, 9h, and 12h after infection. RNA was extracted, and the viral copy number was detected by qRT-PCR. The results are shown in […]. Figure 7 and Figure 8 .

[0065] like Figure 7 and 8 As shown, compared with wild-type cells, the lesion severity of RASA2-KO2 cells was significantly reduced, and the viral copy number at 6h, 9h, and 12h after infection was also significantly lower than that of wild-type cells, indicating that the RASA2 gene plays an important role in viral infection.

[0066] 3. The obtained RASA2 knockout PK-15 cells (RASA2-KO2) were seeded in 12-well plates. When the cell density reached 70%-80%, they were infected with SVA-GFP. After infection, we observed the green fluorescence in wild-type cells and RASA2 knockout PK-15 cells (RASA2-KO2). The results are shown in the table below. Figure 9 .

[0067] like Figure 9 As shown, the fluorescence intensity in the RASA2 knockout cell line was significantly reduced, indicating that viral replication in RASA2-KO2 cells was significantly reduced, further demonstrating that RASA2 plays a key role in SVA infection.

[0068] Example 4: Effect of RASA2 gene overexpression on SVA infection

[0069] The RASA2 overexpression vector RASA2-pcDNA3.1 was constructed using the pcDNA3.1 vector as a backbone. RASA2 knockout cells were transfected with 2 μg of RASA2-pcDNA3.1 and 2 μg of the empty pcDNA3.1 vector. After 36 h of transfection, cells were infected with SVA virus at MOI=1. Cells were collected 12 h after virus treatment, RNA was extracted, and viral copy number was determined. Results are shown below. Figure 10 Then, wild-type PK-15 cells and wild-type IBRS-2 cells were transfected with 2 μg RASA2-pcDNA3.1 and 2 μg pcDNA3.1 empty vector. 36 h after transfection, the cells were infected with SVA virus at MOI=1. Viral infection was assessed 12 h after virus treatment. Results are shown below. Figure 11In the figure, A represents the result of viral RNA copy number detection after overexpression of RASA2 in wild-type PK-15 cells; B represents the result of viral RNA copy number detection after overexpression of RASA2 in wild-type IBRS-2 cells.

[0070] like Figure 10 As shown, reintroducing RASA2 into RASA2 knockout cells restores the viral infection phenotype, and RASA2 reintroduction significantly increases the viral RNA copy number, indicating that RASA2 reintroduction is beneficial for viral infection.

[0071] like Figure 11 As shown, overexpression of RASA2 in wild-type PK-15 cells and wild-type IBRS-2 cells significantly increased the viral copy number, further demonstrating that RASA2 is beneficial for SVA infection of cells.

[0072] Finally, it should be noted that the above specific embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to examples, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention.

Claims

1. RASA2 The use of gene / protein expression inhibitors or knockout agents in the preparation of drugs for the prevention or treatment of SVA infection, wherein... RASA2 Gene / protein expression inhibitors or knockout agents, including targeted knockouts RASA2 sgRNA of genes / proteins, or silencing and repression RASA2 siRNAs for gene expression; The sgRNA is GTCCCAGTTCCAGGTAGAAG; the siRNA is RASA2 -si499-F / R、 RASA2 -si810-F / R or RASA2 -si1150-F / R, its specific sequence is as follows: RASA2 - si499-F: 5'-GGGUAAAGUUCACCUUGAATT-3'; RASA2 -si499-R: 5'-UUCAAGGUGAACUUUACCCTT-3'; RASA2 - si810-F: 5'-GGAUCGACUUGUGGAACAATT-3'; RASA2 -si810-R:5’-UUGUUCCACAAGUCGAUCCTT-3’; RASA2 -si1150-F:5’-GCUGCUCCACCAUGAUAAATT-3’; RASA2 -si1150-R: 5'-UUUAUCAUGGUGGAGCAGCTT-3'.

2. Use according to claim 1, characterized in that, The drug for preventing or treating SVA infection has at least one of the following functions: A1) Inhibits SVA growth or proliferation; A2) Inhibit SVA invasion.

3. A pharmaceutical composition for the prevention or treatment of SVA infection, characterized in that, comprising the compound of claim 1 or 2 RASA2 gene / protein expression inhibitors or knockdown agents.

4. The one in claim 1 RASA2 Use of gene / protein expression inhibitors or knockout agents in the preparation of formulations for breeding SVA-resistant pig breeds.

5. The one in claim 1 RASA2 Use of gene / protein expression inhibitors or knockout agents in the preparation of formulations for the improvement of germplasm resources of SVA-associated disease-resistant pig breeds.

Images