SNP molecular markers associated with horn type traits on chromosome 1 of Huaxi cattle and their application

Abstract

The present invention relates to the field of biology and genetic breeding technology, and specifically to a SNP molecular marker related to the hornless trait on chromosome 1 of West China cattle and an application thereof. The site of the SNP molecular marker is the 3303269th nucleotide site on chromosome 1 of the international cattle reference genome ARS-UCD1.2 version, and the base of the site is A or G. The present invention has the beneficial effects of: by optimizing the dominant allele of the SNP, the dominant allele frequency can be increased generation by generation, the number of hornless traits in the West China cattle population can be increased, the progress of cattle genetic improvement can be accelerated, and the economic benefits of beef cattle breeding can be effectively improved.

Description

Technical Field

[0001] The present invention relates to the technical field of Huaxi cattle breeding, and in particular to SNP molecular markers related to horn traits on chromosome 1 of Huaxi cattle and applications thereof. Background Art

[0002] The Huaxi cattle is a new breed of specialized beef cattle that has undergone 43 years of hybridization improvement and continuous breeding, forming the current new breed of specialized beef cattle with consistent body shape and appearance, outstanding production performance and stable genetic performance. It has a wide adaptability and excellent meat production traits, and is one of the main breeds of beef cattle in China.

[0003] Hornless selection of cattle is an important direction of beef cattle breeding; in the case of small-scale farming in rural areas, beef cattle are used for both meat and work, and the presence of horns provides convenience for farmers to use cattle to plow the land, pull carts and other activities. With the advent of the era of agricultural mechanization, cattle use for work has gradually been replaced by machinery. In modern intensive farming, the presence of horns has brought many inconveniences. The presence of horns often causes casualties of some practitioners in actual production, and also brings great inconvenience to the transportation of beef cattle. It is an unsafe factor in the cattle breeding industry. At the same time, for large-scale captive breeding, horned cattle are prone to injuries in the process of fighting with each other, and affect the weight gain of cattle. Although the molecular mechanism affecting the development of cattle horns has not been clearly studied, the presence or absence of cattle horns has relatively obvious characteristics of quality traits. It is feasible to improve the frequency of hornless traits in resource populations of West China cattle by genetic means. At present, many QTLs and a large number of single nucleotide polymorphisms (SNPs) related to the hornless trait have been identified in the cattle genome using the genome-wide association study (GWAS) method. Adding SNPs with significant effects to molecular marker assisted selection (MAS) and genomic selection (GS) can significantly improve the genetic improvement progress of the hornless trait frequency, thereby increasing the hornless trait frequency of future beef cattle, facilitating cattle production management, increasing meat production, and enhancing the market competitiveness of commercial beef production of breeding enterprises. However, the hornless breeding of Huaxi cattle started relatively late and still needs to be gradually improved. Summary of the invention

[0004] In view of the shortcomings of the prior art mentioned above, the purpose of the present invention is to provide SNP molecular markers related to horn traits on chromosome 1 of West China cattle and their applications. The SNP molecular markers and sites can be used to increase the frequency of dominant alleles, increase the number of hornless traits in the West China cattle population, accelerate the progress of cattle genetic improvement, and thus effectively improve the economic benefits of beef cattle breeding.

[0005] To achieve the above purposes and other related purposes:

[0006] On the one hand, the present disclosure provides a SNP molecular marker related to horn type traits on chromosome 1 of Huaxi cattle, wherein the SNP molecular marker is located on a nucleotide sequence on chromosome 1 of Huaxi cattle, and the SNP site of the SNP molecular marker corresponds to the nucleotide mutation A270-G270 at position 270 of the sequence annotation of SEQ IDNO:1; the SNP site of the SNP molecular marker corresponds to the A>G mutation at position 3303269 on chromosome 1 of the reference sequence of the international cattle reference genome ARS-UCD1.2 version.

[0007] The second aspect of the present disclosure provides a primer pair for detecting the above-mentioned SNP molecular marker, the primer pair comprising a forward primer and a reverse primer;

[0008] The forward primer sequence is shown in SEQ ID NO: 2;

[0009] The forward primer sequence is shown in SEQ ID NO:3.

[0010] The third aspect of the present disclosure provides a kit for detecting the above-mentioned SNP molecular marker, comprising the above-mentioned primer pair.

[0011] The present disclosure also provides the use of the above-mentioned SNP molecular marker, the above-mentioned primer pair or the above-mentioned kit in identifying the horn type-related traits of Huaxi cattle.

[0012] The present disclosure also provides a method for increasing the frequency of the hornless trait of West China cattle, the method comprising the following steps: detecting the genotype of the 3303269th nucleotide site on chromosome 1 of the international cattle reference genome ARS1.2 version of the tested cattle population, and selecting individuals as breeding cattle according to the genotype of the nucleotide site.

[0013] Furthermore, the selection of individual cattle according to the genotype of the nucleotide site is specifically as follows: individuals with AA and AG genotypes at the 3303269th nucleotide site are selected as breeding cattle. Cattle individuals with CC genotypes at the 3303269th site are eliminated to increase the frequency of allele A at the site generation by generation, thereby increasing the frequency of the hornless trait of offspring cattle. That is, the SNP molecular marker as mentioned above on chromosome 1 of the tested cattle is detected, and whether the 270th single nucleotide at the 5' end of the SNP molecular marker is A or G type, and individuals with G type are eliminated and individuals with A type are retained.

[0014] In a preferred embodiment of this scheme, the method for detecting the genotype of the 3303269th nucleotide site on chromosome 1 of the international cattle reference genome ARS1.2 version of the tested cattle population comprises the following steps:

[0015] S1. Extracting genomic DNA from the cattle to be tested;

[0016] S2, using the primer pair as described above, performing PCR amplification on the genomic DNA extracted in step S1 to obtain a PCR amplification product;

[0017] S3, sequencing the PCR amplification product to obtain sequencing results;

[0018] S4. Based on the sequencing results, determine the SNP molecular marker genotype of the cattle to be tested as described above.

[0019] In a preferred embodiment of the present scheme, the cattle population to be tested is at least one of Huaxi cattle and its synthetic lines.

[0020] The present disclosure also provides the use of the above-mentioned SNP molecular marker, the above-mentioned primer pair, the above-mentioned kit or the above-mentioned method in increasing the frequency of the hornless trait in cattle.

[0021] The present disclosure also provides the use of the above-mentioned SNP molecular marker, the above-mentioned primer pair, the above-mentioned kit or the above-mentioned method in screening high-meat-yielding West China cattle varieties or improving the high-meat-yielding West China cattle.

[0022] Genome-wide association analysis is an analysis method based on linkage disequilibrium between SNPs. It uses statistical analysis strategies to identify the relationship between phenotype and genotype, and plays an important role in identifying molecular markers that affect important economic traits of cattle. The present invention identifies significant SNPs that affect the frequency of the hornless trait of Huaxi cattle through GWAS analysis strategies, and uses them in molecular marker-assisted selection and genomic selection to select genotypes that are beneficial to increasing the frequency of the hornless trait in cattle herds for seed retention, thereby increasing the gene frequency of the dominant allele from generation to generation, accelerating the process of breeding and improvement of breeding cattle, and bringing huge economic benefits to beef cattle breeding.

[0023] Compared with the prior art, the present invention has the following advantages and effects:

[0024] The present invention studies and determines the molecular markers related to the frequency of the hornless trait of Huaxi cattle, verifies their effects on the frequency of the hornless trait, and ultimately establishes an efficient and accurate genomic selection breeding technology, which is applied to the genetic improvement of breeding cattle to increase the frequency of the hornless trait, thereby increasing the frequency of the hornless trait in offspring cattle and increasing meat production. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the Manhattan plot of the genome-wide association analysis (GWAS) of the hornless trait on chromosome 1 of Huaxi cattle; the horizontal axis represents the chromosome number of cattle; the vertical axis represents the -logP value;

[0026] Figure 2The frequency of hornless trait in different genotypes of Huaxi cattle. DETAILED DESCRIPTION

[0027] The following is a description of the implementation of the present invention by means of specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. Example

[0028] 1. Experimental Animals

[0029] In this embodiment, the inventor established a Huaxi cattle resource population using a Huaxi cattle population from the ranch of the Ulagai Management District, Xilin Gol League, Inner Mongolia.

[0030] In this experiment, a total of 688 Huaxi cattle from the resource group were selected as the experimental cattle group. The Huaxi cattle resource group is expanded every year, and the new individuals generally go through three stages: birth, fattening and slaughter. After a period of free-range management, the calves born from March to May each year are uniformly measured for horn type, coat color and growth data by the cattle genetic breeding technology innovation team in July of the same year. At the same time, the basic cows are measured and the genotype data are obtained using Illumina BovineHD chip genotyping.

[0031] 2. Sample collection

[0032] 50 ml of venous blood from all individuals in the experimental herd was collected using blood collection tubes and stored in a -80°C refrigerator for later use.

[0033] 3. Cattle whole genome 110K high-density chip SNP typing

[0034] 50 ml of venous blood was collected from each of the 688 Huaxi cattle selected from the above resource population, and the whole genome DNA was extracted using the standard phenol-chloroform method. The DNA concentration and OD ratio (OD260 / 280, OD260 / 230) of each sample were accurately determined by the Nanodrop2000 / 2000C nucleic acid protein detector. The qualified DNA samples were tested by the NanoDrop2000 / 2000C nucleic acid protein detector, and the DNA samples were diluted to about 50 ng / μL according to the tested concentration. Then 4 μl of the extracted DNA sample to be tested was mixed with 1 μl Loading Buffer, loaded into a 1% agarose gel, electrophoresed at 150 V for 25 minutes, and observed and photographed under a UV spectrophotometer and gel imaging equipment to observe the integrity of the DNA.

[0035] DNA samples were sent to Neogen Biotech (Shanghai) Co., Ltd., and the bovine whole genome Illumina BovineHD chip 10K SNP chip (Illumina, USA) genotype determination was performed according to the company's standard process. PLINK v1.90 software was used to perform quality control on the 110K chip scanning typing data of all samples, and the detection rate of individuals was less than 90%, the family Mendelian error rate was higher than 0.1, the minimum allele frequency was less than 0.05, and the Hardy-Weinberg equilibrium significance level was higher than 10 -6 Finally, valid genotype data of 105248 SNPs were obtained.

[0036] 4. Genome-wide association study (GWAS)

[0037] In order to eliminate the population stratification effect, the present invention adopts linear mixed model single point regression analysis and combines with R language GenABEL software package to perform GWAS analysis. The similarity of genomes between individuals is used to correct the stratification effect in the analysis model. The Bonferrini method is used to determine the significance threshold of the association between SNP and the frequency of the hornless trait. The genomic level significance threshold is 0.05 divided by the number of effective SNP sites, that is, the genomic level significance threshold is 7.45e -8 , that is, 0.05 / 105248 (the number of effective SNPs); the chromosome level significant threshold is 1 divided by the number of effective SNP sites, that is, the chromosome level significant threshold is 1.49e -6 , that is, 1 / 105248 (the number of effective SNPs).

[0038] GWAS analysis results Figure 1 As shown. Figure 1 It can be seen that there is a locus in chromosome 1 of Huaxi cattle that significantly affects the frequency of the hornless trait, and the strongest associated SNP is g.270A>G (P=2.07e -27 ).

[0039] 5. Association analysis between different genotypes and hornless trait frequency phenotype

[0040] According to Table 1, the SNP site g.270A>G of the molecular marker is extremely significantly correlated with the frequency of the hornless trait (P<0.001), indicating that this molecular marker significantly affects the frequency of the hornless trait in cattle. Through auxiliary selection of this SNP site in cattle, the frequency of the hornless trait in the population can be increased, thereby accelerating the breeding process of the target trait.

[0041] In addition, according to Table 1, the AA and AG types have a higher frequency of hornless traits than the GG type, indicating that the GG type Huaxi cattle individuals are not conducive to the screening of high frequency of hornless traits, so AA and AG type breeders are preferred. The frequency of hornless traits is an important indicator for measuring beef quality. Increasing the frequency of hornless traits in cattle is conducive to increasing cattle meat production and thus increasing market competitiveness. Therefore, in the breeding process, it is necessary to gradually eliminate GG type breeders and give priority to retaining AA and AG type breeders to increase the frequency of allele A at this locus from generation to generation.

[0042] Table 1 Correlation between the molecular marker SNP site g.270A>G and the frequency of the pollenless trait

[0043]

[0044] 6. Amplification and sequencing of target DNA sequences

[0045] (1) Primer design

[0046] The DNA sequence of SEQ ID NO: 1 on chromosome 1 of cattle was downloaded from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), and primers were designed using the primer design software SnapGene_5.2.0.

[0047] The DNA sequences of the designed primers are as follows:

[0048] P001 forward: 5′-TGTGTGTGTGGATGAAAGG-3′ (SEQ ID NO: 2);

[0049] P002 reverse: 5′-CTTAAATTATCCAGTAGTGCCG-3′ (SEQ ID NO: 3);

[0050] (2) PCR amplification

[0051] Add 0.5uL of DNA template, 10uL of double distilled water, 12.5uL of KOD ONE PCR Mix, and 1ul each of primers P001 and P002 to the 12.5uL reaction system.

[0052] The PCR reaction conditions were as follows: pre-denaturation at 98°C for 5 min, followed by denaturation at 98°C for 10 s, annealing at 55°C for 5 s, and extension at 68°C for 1 s, for 35 cycles, and finally extension at 68°C for 5 min.

[0053] (3) DNA sequence determination

[0054] DNA sequence identification: It was conducted at Beijing HuaDa Technology Co., Ltd., and the gene fragments were tested for both positive and negative reactions. The measured sequence was compared with the NCBI genome sequence to obtain the mutation of the corresponding SNP site. The sequencing results are shown below:

[0055] TGTGTGTGTGGATGAAAGGAGGAAGGAGGAGTTTTGAAGAAGGACTGATGCTGAAGCTCAAACTCCACTACTTTGGCCACCTGATGTGAACAACTGACTCCTTTGAAAAGACCCTGGAAAGGTCTGCTGGGAAATATTGAAGGCAGGAGGAGAAGGGGACGACAGAGGTGGACTGGGTGGACTCCAAGAGTTGGTAATGGACAGGGGGCCTGGCATGTCACGGTTTTAC R (A>G)GGGTCGCAAAGAGTAGGACATGACTGAGCGACTGAACTGAACTGAACTGAGCAGGGGACGGAGGGGAGATGGGAGCATGAAGGTGAAGGCCTACCACGCCCCCCACTCGGCACTACTGGATAATTTAAG

[0056] Note: The R marked in the sequence table is the mutation site, which is displayed with an underline (the mutated base in brackets is the allele mutation).

[0057] 7. Analysis of the effect of molecular marker SNP site g.270A>G

[0058] Through molecular marker-assisted selection, cattle with the GG genotype in the group are eliminated, which can significantly increase the frequency of the hornless trait in the group, thereby increasing meat production and bringing more economic benefits to the company.

[0059] The present invention detects the 270th base mutation site in the SEQ ID NO: 1 sequence and preliminarily performs an association analysis between its genotype and the frequency of the hornless trait in cattle, thereby providing a new molecular marker for molecular marker-assisted selection and genomic selection in cattle.

[0060] The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Anyone familiar with the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by a person of ordinary skill in the art without departing from the spirit and technical concept disclosed by the present invention shall still be covered by the claims of the present invention.

Claims

1. The SNP molecular markers on chromosome 1 of Huaxi cattle related to horn type traits are characterized by: The sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and the 270th base from the 5' end of the sequence shown in SEQ ID NO: 1 is A or G; The site of the SNP molecular marker is the 3303269th nucleotide site on chromosome 1 of the international cattle reference genome ARS-UCD1.2 version, and the base of the site is A or G; The angular trait can be angular or angular-free.

2. A primer pair for detecting the SNP molecular marker according to claim 1, characterized in that: The nucleic acid sequences of the primer pair are shown in SEQ ID NO: 2 and SEQ ID NO:

3.

3. A kit for detecting the SNP molecular marker according to claim 1, characterized in that: Comprising the primer pair described in claim 2.

4. Use of the SNP molecular marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in identifying horn type-related traits of Huaxi cattle; The angular trait can be angular or angular-free.

5. A method for increasing the frequency of the hornless trait of Huaxi cattle, characterized in that: The method comprises the following steps: Detecting the genotype of the 3303269th nucleotide site on chromosome 1 of the international cattle reference genome ARS1.2 version of the tested cattle population, and selecting individuals as breeding cattle according to the genotype of the nucleotide site; The method of screening individual cattle according to the genotype of the nucleotide site is specifically as follows: selecting individuals with AA and AG genotypes at the 3303269th nucleotide site as cattle.

6. The method according to claim 5, characterized in that The method for detecting the genotype of the 3303269th nucleotide site on chromosome 1 of the international cattle reference genome ARS1.2 version of the tested cattle population comprises the following steps: S1. Extracting genomic DNA from the cattle to be tested; S2. Using the primer pair as described in claim 2, PCR amplification is performed on the genomic DNA extracted in step S1 to obtain a PCR amplification product; S3, sequencing the PCR amplification product to obtain sequencing results; S4. Based on the sequencing results, determine the SNP molecular marker genotype of the cattle to be tested as described in claim 1.

7. The method according to claim 5, characterized in that The cattle population to be tested is at least one of Huaxi cattle and its synthetic strains.

8. Use of the SNP molecular marker according to claim 1, the primer pair according to claim 2, the kit according to claim 3, or the method according to any one of claims 5 to 7 in increasing the frequency of the hornless trait of West China cattle.

Images