Recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 and PEDV S1 protein and its construction method and application

Abstract

The invention discloses a recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 and PEDV S1 protein and a construction method and application thereof, belonging to the field of biotechnology. The invention uses a porcine auxotrophic Lactobacillus paracasei expressing PEDV S1 gene constructed in the early stage as an oral mucosal delivery vector, and increases the exogenous expression amount of pBD2 protein by tandem, to construct a recombinant lactobacillus n×pBD2 / S1‑ΔHLJ‑27 . For the intestinal mucosal infection of PEDV, the constitutive expression of S1 protein by the recombinant lactobacillus stimulates the mucosal specific immune response, thereby establishing the first line of defense to block PEDV infection; at the same time, in order to enhance the mucosal immune effect induced by oral vaccines, the recombinant lactobacillus is used to secrete and express the tandem pBD2 protein, and the intestinal immune response is enhanced by exogenously increasing the expression of pBD2, thereby improving the body's acquired immunity level, thereby giving better play to the advantages of oral mucosal vaccines.

Description

Technical Field

[0001] The present invention relates to a recombinant porcine Lactobacillus casei strain and a construction method and application thereof. In particular, it relates to a recombinant porcine Lactobacillus casei strain co-expressing porcine beta-defensin 2 (pBD2) and (porcine epidemic diarrhea virus, PEDV) S1 protein ( L. paracasei The present invention relates to a biotechnology field. Background Art

[0002] Defensins are widely distributed in plants, insects and mammals, and are an important component of the body's innate immune system. As an antimicrobial peptide, they have inhibitory activity against a variety of microorganisms such as bacteria, viruses and fungi. Defensins can also enhance the body's immune capacity and have the potential to be used as immune adjuvants.

[0003] Lactic acid bacteria are often used as oral vaccine delivery carriers. As intestinal probiotics, they can maintain and improve intestinal microbial balance, inhibit pathogen growth, and competitively exclude pathogenic microorganisms from infection and adhesion. Lactic acid bacteria are tolerant to a variety of digestive juices and proteases, and can resist the acidic environment of the stomach and high concentrations of bile salts. As a live mucosal vaccine targeting the mucosal surface, this flora can induce a strong local immune response and is a viable option for preventing intestinal infections. At the same time, it is transformed using its inherent ability to bind to the mucosal surface to express exogenous therapeutic molecules or specific antigenic proteins, thereby promoting effective contact between antigens and the immune system. In addition, the ability of lactic acid bacteria to colonize the intestine will enable the continuous production of immunogenic molecules, thereby effectively stimulating the body's specific immune response level.

[0004] The host bacteria used in the present invention is Lactobacillus paracasei isolated from the intestinal tract of piglets. L. paracaseiHLJ-27 As an animal's own intestinal dominant probiotic isolate, it has inherent advantages in intestinal adhesion and colonization [Li Fengsai. Construction of a nutrient-deficient lactobacillus expressing porcine rotavirus VP4 and its study on induced immune response [D]; Northeast Agricultural University, 2022.]. The simultaneous expression of the recombinant porcine Lactobacillus paracasei expressing PEDV S1 and the porcine defensin pBD2 in tandem can not only improve the acquired immunity level of piglets, but also exert antibacterial advantages to prevent PEDV infection intestinal damage leading to subsequent secondary mixed infection with pathogens, laying the foundation for the application and further optimization of the recombinant porcine Lactobacillus casei as an oral vaccine, and providing a reference for the preparation of vaccines for other diarrheal diseases. Summary of the invention

[0005] The invention aims to provide a recombinant porcine Lactobacillus casei that co-expresses porcine beta-defensin 2 and PEDV S1, and a construction method and application thereof.

[0006] In order to achieve the above object, the present invention adopts the following technical means:

[0007] The present invention uses porcine Lactobacillus casei as a live bacterial carrier, and co-expresses porcine epidemic diarrhea virus protective antigen S1 and porcine β-defensin 2 (pBD2) on its surface. Based on homologous recombination technology, the exogenous expression of pBD2 protein is increased by genetic engineering tandem technology, and multiple copies of tandem are designed. pBD2 Gene expression cassettes, in tandem pBD2 Enterokinase recognition sites were added between genes, and the lactic acid bacteria expression vector pPG-T7g10-PPT was used as the plasmid backbone. The Alr-nutritional swine-derived Lactobacillus paracasei that constitutively expressed PEDV S1 protein was used as the host bacteria. pBD2 The expression level, biological activity, and antiviral effect of the pBD2 protein expressed by the recombinant porcine Lactobacillus casei with a gene expression cassette were studied. S1-ΔHLJ-27 The expression levels of 4×pBD2 protein in the culture supernatant and bacteria after 18 h of culture were the highest, which were 1.77 μg / mL and 2.52 μg / mL, respectively, and had good antibacterial and antiviral activities.

[0008] Mice were given oral administration of recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 Newborn piglets were given a single oral administration of recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 The feeding program was used to test the effects of oral administration of recombinant porcine Lactobacillus casei on the growth and development of animals and the immune function of the body. The results of intestinal colonization of recombinant porcine Lactobacillus casei showed that after oral administration of recombinant porcine Lactobacillus casei for 28 days and 21 days, there were still a large number of 4×pBD2 / S1-ΔHLJ-27 Survival, with the largest number in the ileum and jejunum ( P < 0.05); After oral administration of recombinant porcine Lactobacillus casei for one week, the body weight of mice and piglets increased significantly compared with the control group ( P < 0.05), H&E staining was performed to observe the morphology of the small intestine epithelium of mice and piglets, showing that oral administration of 4×pBD2 / S1-ΔHLJ-27 The villi in the jejunum and ileum of the animals in the group were more neat and well developed, and the height of the villi and the villus / ileum ratio were significantly higher than those in the control group ( P <0.05), indicating that oral administration of recombinant porcine Lactobacillus casei can improve animal growth performance and promote intestinal epithelial development; oral administration of 4×pBD2 / S1-ΔHLJ-27 The organ indexes of immune organs, including liver, spleen, thymus and mesenteric lymph nodes, of mice and piglets in the control group increased significantly ( P< 0.05), and CD4 + The number of T lymphocytes increased significantly ( P < 0.05); immunoglobulin test results showed that the levels of serum total IgG and intestinal mucosal total SIgA antibodies in mice orally administered with recombinant porcine Lactobacillus casei were significantly higher than those in the control group ( P < 0.05), indicating that oral administration of recombinant porcine Lactobacillus casei can regulate the body's immune status and improve the body's active immune ability; further analysis of the PEDV-specific immune response induced in piglets after oral administration of recombinant porcine Lactobacillus casei showed that piglets were able to produce PEDV-specific IgG and mucosal-specific SIgA antibodies ( P < 0.01), and oral administration of 4×pBD2 / S1-ΔHLJ-27 The antibody level of piglets in the pPG / S1-ΔHLJ-27 Group( P < 0.05), the serum neutralizing antibody titer was 1:65, and the cytokine response showed that oral administration of recombinant porcine Lactobacillus casei could induce Th1, Th2 and Th17 cell-mediated immunity in piglets. The detection of IgG1 and IgG2a antibody levels showed that IgG1 / IgG2a <1, indicating that recombinant porcine Lactobacillus casei induced piglets to produce an immune response type dominated by Th1 cytokine regulation.

[0009] Mice were continuously orally treated with recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 Seven days later, Salmonella typhimurium was administered orally S. typhimurium Compared with the challenge control group, oral administration of recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 Effectively reduced the diarrhea rate and mortality rate of infected mice ( P < 0.05), and significantly alleviated the infection S. typhimurium CMCC 50115 caused villous atrophy and intestinal epithelial damage in the jejunum and ileum, and upregulated the expression of tight junction proteins Zo-1, occludin, and claudin-2 ( P < 0.05); oral administration of recombinant porcine Lactobacillus casei can stimulate infected mice to produce higher levels of S. typhimurium CMCC50115-specific serum IgG and mucosal SIgA antibody levels and reduced the development of inflammatory responses ( P < 0.05); the results of bacterial translocation assay showed that oral administration of recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 Able to reduce the number of Salmonella in the liver, spleen and mesenteric lymph nodes of mice ( P < 0.01), and reduced liver and spleen indexes ( P< 0.05), effectively inhibiting the invasion of Salmonella to peripheral organs after intestinal infection; oral administration of recombinant porcine Lactobacillus casei had an S. Typhimurium The protection rate of CMCC 50115 in mice was 70%.

[0010] Oral administration of recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 Seven days later, the piglets were cohabited with piglets challenged with PEDV to test the protective efficacy of piglets against PEDV cohabitation infection. The results showed that oral administration of recombinant porcine Lactobacillus casei effectively reduced the morbidity and mortality of piglets after PEDV cohabitation infection ( P < 0.05), autopsy showed that the intestinal pathology of piglets in the oral recombinant porcine Lactobacillus casei group was significantly reduced; qPCR detection of viral load in each intestinal segment after challenge showed that the intestinal viral load of piglets in the oral recombinant porcine Lactobacillus casei infection group was significantly lower than that in the challenge control group and the cohabitation infection group ( P < 0.05), and the degree of intestinal epithelial barrier damage was significantly reduced, and pathological changes were not obvious; the results of inflammatory factor detection showed that the levels of pro-inflammatory factors IL-1β, IL-12, IL-6 and TNF-α in piglets infected with oral recombinant porcine Lactobacillus casei were significantly reduced ( P < 0.05), while the level of anti-inflammatory factor IL-10 increased significantly ( P < 0.01), indicating that recombinant porcine Lactobacillus casei can alleviate the inflammatory response caused by PEDV infection; the protection rate of oral recombinant porcine Lactobacillus casei against infected piglets after challenge was 60% (3 / 5).

[0011] On the basis of the above research, the present invention first proposes a recombinant porcine Lactobacillus casei that co-expresses porcine β-defensin 2 and PEDV S1 protein. The recombinant porcine Lactobacillus casei uses porcine Lactobacillus paracasei as a live bacterial carrier and co-expresses porcine epidemic diarrhea virus protective antigen S1 protein and porcine β-defensin 2 (pBD2) on its surface.

[0012] Preferably, the recombinant porcine Lactobacillus casei contains multiple copies of porcine β-defensin 2 ( pBD2 ) gene expression cassette, in tandem with porcine β-defensin ( pBD2 ) an enterokinase recognition site was added between the gene expression cassettes, and based on homologous recombination technology, the lactic acid bacteria expression vector pPG-T7g10-PPT was used as a plasmid backbone, and the alanine auxotrophic porcine Lactobacillus paracasei that constitutively expressed the PEDV S1 protein was used as a host bacterium to obtain the recombinant porcine Lactobacillus casei that co-expressed porcine β-defensin 2 and PEDV S1.

[0013] Among them, preferably, the pBD2The main functional elements of the gene expression cassette include HCE promoter, T7g10 enhancer, and secretory expression signal peptide SP.

[0014] Preferably, the copy number of the porcine β-defensin 2 (pBD2) gene expression cassette is 2-4, more preferably 4.

[0015] Wherein, preferably, the alanine auxotrophic recombinant Lactobacillus paracasei expressing PEDV S1 is named S1 / ΔHLJ-27 , prepared according to the method described in the patent application with publication number CN118460584A and invention name "Gene editing system and application of auxotrophic lactic acid bacteria based on CRISPR-Cas9 system".

[0016] Secondly, the present invention also proposes a method for constructing a recombinant porcine Lactobacillus casei that co-expresses porcine β-defensin 2 and PEDV S1 protein. When the recombinant porcine Lactobacillus casei that co-expresses porcine β-defensin 2 and PEDV S1 protein contains a single copy of pBD2 When using a gene expression cassette, proceed as follows:

[0017] (1) Fresh pig liver tissue was obtained, total RNA was extracted and reverse transcribed, and the extracted cDNA was used as a template and primer pair pBD2-F / pBD2-R1 was used to amplify pBD2 The mature peptide sequence of the gene is synthesized, and the PCR product is used as a template, and the enterokinase recognition site and His tag are added to the 5' end of the pBD2 target gene fragment using primer pairs pBD2-F / pBD2-R2 and pBD2-F / pBD2-R3, and PCR amplification and recovery are performed, wherein the amino acid sequence of the enterokinase recognition site is DDDDK; the Lactobacillus pumilus S-layer protein signal peptide SP sequence containing the T7g10 enhancer sequence as shown in SEQ ID NO.2 is synthesized, and the primer pair TSP-F / TSP-R is used for PCR amplification and recovery; the above gel recovery product is fused and expressed, and the T7g10-SP-pBD2 sequence is obtained after recovery and purification;

[0018] ;

[0019] (2) The purified fragment T7g10-SP-pBD2 was connected to the pMD-19T Simple vector, and the correct plasmid was named pMD19T-T7g10-SP-pBD2;

[0020] (3) The vector plasmid pPG-T7g10-PPT and the cloning plasmid pMD19T-T7g10-SP-pBD2 were used SnaB I and ApaI restriction enzyme double digestion, obtain the same sticky ends, cut the gel to recover the vector large fragment pPG and small fragments of target genes T7g10-SP-pBD2 , ligated, and the positive recombinant plasmid identified and named as pPG-T7g10-SP-pBD2;

[0021] (4) Transformation of alanine-deficient recombinant Lactobacillus paracasei expressing PEDV S1 S1 / ΔHLJ-27

[0022] The positive recombinant plasmid pPG-T7g10-SP-pBD2 was then electroporated into S1 / ΔHLJ-27 After the correct competent cells were identified, the recombinant porcine Lactobacillus casei pPG-T7g10-SP-pBD2 / S1-ΔHLJ-27 .

[0023] When the recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 and PEDV S1 protein contains 2-4 copies pBD2 When using a gene expression cassette, proceed as follows:

[0024] (1) Construction of pMD19T-TSP-n×pBD2 (n=2, 3 or 4) recombinant plasmid:

[0025] The plasmid pMD19T-T7g10-SP-pBD2 constructed above was used as a template, and the first substrate sequence of homologous recombination was amplified by primers HR-F / HR-R, and the second substrate sequence was amplified by primers nHR-F / nHR-R. The two sequences were homologously recombined by fusion PCR, and then the T7g10-SP-2×pBD2 sequence was amplified by primers HR-F / nHR-R, which was connected to the pMD19T vector to construct a positive clone plasmid named pMD19T-TSP-2×pBD2; by analogy, pMD19T-TSP-2×pBD2 was used as a template, and the positive clone plasmids pMD19T-TSP-3×pBD2 and pMD19T-TSP-4×pBD2 were constructed in the same manner as above; the recombinant plasmids were identified by PCR using 19T-F / 19T-R as primers and sequenced; at the same time, the obtained plasmids were used SnaB I and Apa I restriction endonuclease for double digestion identification;

[0026] ;

[0027] (2) Construction of pPG-TSP-n×pBD2 (n=2, 3 or 4) recombinant plasmid:

[0028] The vector plasmid pPG-T7g10-PPT and the above-constructed cloning plasmids pMD19T-TSP-2×pBD2, pMD19T-TSP-3×pBD2 and pMD19T-TSP-4×pBD2 were used SnaB I and Apa I Double digestion with restriction endonucleases at 30°C for 2 h to obtain the same sticky ends, and the large vector fragment was recovered by gel cutting. pPG and small fragments of target genes TSP-2× pBD2 , TSP-3×pBD2 and TSP-4×pBD2 , then ligated under the action of T4 DNA ligase, and the correct positive recombinant plasmids were identified and named pPG-TSP-2×pBD2, pPG-TSP-3×pBD2, and pPG-TSP-4×pBD2;

[0029] (3) Construction of recombinant lactic acid bacteria expressing n×pBD2 (n=2, 3 or 4):

[0030] The above recombinant plasmids pPG-TSP-2×pBD2, pPG-TSP-3×pBD2 and pPG-TSP-4×pBD2 were transformed into S1-ΔHLJ-27 In competent cells, the correct one was identified and the recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 and PEDV S1 was obtained n×pBD2 / S1-ΔHLJ-27 (n=2, 3 or 4).

[0031] Finally, the present invention also proposes the use of the recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 and PEDV S1 in the preparation of drugs for preventing or treating diseases caused by PEDV, Salmonella typhi or simultaneous infection of the two.

[0032] Among them, preferably, the drug is an oral mucosal vaccine.

[0033] Compared with the prior art, the present invention has the following beneficial effects:

[0034] The invention uses the previously constructed swine-derived auxotrophic Lactobacillus paracasei expressing the PEDV S1 protective antigen gene as an oral mucosal delivery vector, and increases the exogenous expression amount of the pBD2 protein through genetic engineering tandem technology to construct a recombinant lactobacillus n×pBD2 / S1-ΔHLJ-27 Lactobacillus paracasei was selected as an oral mucosal delivery vector, and PEDV was inserted into its genome by genetic engineering. S1Antigen gene, targeting the intestinal mucosal infection of PEDV, uses the constitutive expression of S1 protein by host bacteria to stimulate mucosal specific immune response, thereby establishing the first line of defense to block PEDV infection; at the same time, in order to enhance the mucosal immune effect induced by oral vaccines, lactic acid bacteria expression vectors are used to secrete and express the tandem immune active molecule pBD2 protein, and the intestinal immune response state is enhanced by exogenously increasing the expression level of pBD2, thereby improving the body's acquired immunity level, thereby giving full play to the advantages of oral mucosal vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 Schematic diagram for the construction of recombinant plasmids;

[0036] Figure 2 The results of PCR identification of pMD19T-T7g10-SP-pBD2 and pMD19T-T7g10-Lsp-pBD2 plasmids;

[0037] Among them, a) pBD2 PCR identification of target gene; M: DL 2000 DNA Marker; 1-3: pBD2 Gene PCR amplification product; 4: negative control; b) pMD-19T Simple-pBD2 plasmid double restriction enzyme digestion identification: M: 2K Plus Ⅱ DNA maker: 1-2: negative control; 3-4: plasmid XB Ⅰ. Apa ⅠDouble enzyme digestion identification results;

[0038] Figure 3 The results of PCR identification of pPG-T7g10-SP-pBD2 and pPG-T7g10-Lsp-pBD2 plasmids;

[0039] Among them, a) PCR identification results of plasmid pPG-T7g10-SP-pBD2; M: DL 2000 DNA Ladder Marker; 1-2: PCR products of pPG-T7g10-SP-pBD2; 3: negative control; b) PCR identification results of plasmid pPG-T7g10-Lsp-pBD2; M: DL 2000 DNA Ladder Marker; 1-4: PCR products of pMD19T-T7g10-SP-pBD2; 5: negative control;

[0040] Figure 4 The results of Western blot identification of pBD2 expressed by recombinant lactic acid bacteria with different signal peptides;

[0041] Wherein: a) Lactobacillus pumilus S-layer protein signal peptide SP sequence induces secretory expression of pBD2; M: relative molecular mass standard of pre-stained protein; 1: recombinant porcine Lactobacillus casei 1×pBD2 / S1-ΔHLJ-27 Supernatant of bacterial liquid; 2: Recombinant porcine Lactobacillus casei 1×pBD2 / S1-ΔHLJ-27 Bacterial precipitation; 3: empty bacteria pPG-T7g10-S1 / S1-ΔHLJ-27 Bacterial supernatant; 4: Empty bacteria pPG-T7g10-PPT / S1-ΔHLJ-27 Bacterial precipitation; b) Peptidoglycan hydrolase signal peptide Lsp sequence induces secretory expression of pBD2; 1: Recombinant porcine Lactobacillus casei pPG-T7g10-Lsp-pBD2 / S1-ΔHLJ-27 Supernatant of bacterial liquid; 2: Recombinant porcine Lactobacillus casei pPG-T7g10-Lsp-pBD2 / S1-ΔHLJ-27 Bacterial precipitation; 3: empty bacteria pPG-T7g10-S1 / S1-Δ HLJ-27 Bacterial supernatant; 4: Empty bacteria pPG-T7g10-PPT / S1-ΔHLJ-27 Bacteria precipitation;

[0042] Figure 5 The results of PCR and restriction enzyme identification of pPG-n×pBD2 plasmid;

[0043] Among them, a) PCR identification results of plasmid pPG-TSP-2×pBD2, M: DL 2000 DNA Marker; 1-8: PCR amplification products of plasmid pPG-TSP-2×pBD2; 9: negative control; b) Double enzyme digestion identification of plasmid pPG-TSP-2×pBD2, M: DL 2000 DNA Marker; 1: Double enzyme digestion identification of plasmid pPG-TSP-2×pBD2; 2: negative control; b) PCR identification results of plasmid pPG-TSP-3×pBD2, M: DL 2000 DNA Marker; 1-6: PCR amplification products of plasmid pPG-TSP-3×pBD2; 7: negative control; d) Double enzyme digestion identification of plasmid pPG-TSP-3×pBD2, M: DL 2000 DNA Marker; Marker; 1: double enzyme digestion identification of plasmid pPG-TSP-3×pBD2; 2: negative control; e) PCR identification results of plasmid pPG-TSP-4×pBD2, M: DL 2000 DNA Marker; 1-5: PCR amplification products of plasmid pPG-TSP-4×pBD2; 6: negative control; f) double enzyme digestion identification of plasmid pPG-TSP-4×pBD2, M: DL 2000 DNA Marker; 1: double enzyme digestion identification of plasmid pPG-TSP-4×pBD2; 2: negative control;

[0044] Figure 6 PCR identification of the pPG-n×pBD2 plasmid of the recombinant porcine Lactobacillus casei;

[0045] Wherein, a) PCR identification result of plasmid pPG-TSP-2×pBD2, M: DL 2000 DNA Marker; 1-9: PCR amplification product of plasmid pPG-TSP-2×pBD2; 10: negative control; b) PCR identification result of plasmid pPG-TSP-3×pBD2, M: DL 2000 DNA Marker; 1-7: PCR amplification product of plasmid pPG-TSP-3×pBD2; 8: negative control; c) PCR identification result of plasmid pPG-TSP-4×pBD2, M: DL 2000 DNA Marker; 1-7: PCR amplification product of plasmid pPG-TSP-4×pBD2; 8: negative control;

[0046] Figure 7 Western blot detection of recombinant porcine Lactobacillus casei expressing n×pBD2;

[0047] Wherein: a) different recombinant porcine Lactobacillus casei supernatants expressing n×pBD2 proteins; M: relative molecular mass standard of prestained protein; 1: recombinant porcine Lactobacillus casei 1×pBD2 / S1-ΔHLJ-27 Supernatant of bacterial liquid; 2: Recombinant porcine Lactobacillus casei 2×pBD2 / S1-ΔHLJ-27 Supernatant of bacterial liquid; 3: Recombinant porcine Lactobacillus casei 3×pBD2 / S1-ΔHLJ-27 Supernatant of bacterial liquid; 4: Recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 Supernatant of bacterial solution; b) Gray value analysis results of protein band in a; c) Different recombinant porcine Lactobacillus casei bacterial lysates expressing n×pBD2 proteins; M: relative molecular mass standard of prestained protein; 1: recombinant porcine Lactobacillus casei 1×pBD2 / S1-ΔHLJ-27 Bacterial precipitation; 2: Recombinant porcine Lactobacillus casei 2×pBD2 / S1-ΔHLJ-27 Bacterial precipitation; 3: Recombinant porcine Lactobacillus casei 3×pBD2 / S1-ΔHLJ-27 Bacterial precipitation; 4: Recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 Bacterial precipitation; d) Gray value analysis results of protein bands in c;

[0048] Figure 8 is the standard curve for pBD2 protein quantification;

[0049] Fig. 9 Western blot detection of enterokinase hydrolysis of n×pBD2;

[0050] Fig.10 To test the in vitro inhibition rate of recombinant porcine Lactobacillus casei expressing pBD2 against pathogenic bacteria;

[0051] Among them, a) the antibacterial effect of pBD2 protein at different concentrations; b) the detection of in vitro antibacterial rate of pBD2 protein expressed by recombinant porcine Lactobacillus casei;

[0052] Fig.11 Indirect immunofluorescence detection of the effect of recombinant porcine Lactobacillus casei expressing pBD2 on pathogenic bacteria;

[0053] Among them, a) Staphylococcus aureus S. aureus IFA test of ATCC 43300 strain; b) IFA test of enterotoxigenic E. coli ETEC K88 strain; c) IFA test of Salmonella typhimurium S. typhimurium IFA test of CMCC 50115 strain;

[0054] Fig.12 Transmission electron microscopy analysis of the effect of recombinant porcine Lactobacillus casei expressing pBD2 on pathogenic bacteria;

[0055] Fig.13 To determine the effect of recombinant porcine Lactobacillus casei expressing pBD2 on the activity of Vero-E6 cells;

[0056] Fig.14 The inhibitory effects of different concentrations of pBD2 bacterial liquid protein on PEDV infection;

[0057] Among them, a) pretreatment group (Pretreatment); b) co-treatment group (Simultreatment); c) post-infection treatment group (Posttreatment);

[0058] Fig.15 The PEDV titer was determined by plaque assay;

[0059] Among them, a) pretreatment group (Pretreatment); b) co-treatment group (Simultreatment); c) post-infection treatment group (Posttreatment);

[0060] Fig.16 To measure the cell activity after PEDV infection;

[0061] Fig.17 The effect of recombinant porcine Lactobacillus casei expressing pBD2 on PEDV infection of Vero-E6 cells;

[0062] Fig.18 feeding procedures and sampling schedules for experimental mice;

[0063] Fig.19The effect of oral administration of recombinant porcine Lactobacillus casei on the growth performance of mice;

[0064] Fig. 20 This is the result of H&E staining of mouse small intestine tissue sections;

[0065] Among them, a) measurement of intestinal villus height; b) measurement of small intestinal crypt depth; c) small intestinal villus / crypt ratio;

[0066] Fig.21 For the determination of mouse small intestinal villi and crypts;

[0067] Fig. 22 The effect of oral administration of recombinant porcine Lactobacillus casei on organ indexes of mice;

[0068] Fig.23 is the content of CD4+T cells in mesenteric lymph nodes;

[0069] Fig.24 is the disease activity index of Salmonella -infected mice;

[0070] Note:* P < 0.05, **0.01 < P < 0.05,*** P < 0.01vs ST; # P < 0.05, ## 0.01 < P <0.05, ### P < 0.01 vs 4×pBD2 / S1-ΔHLJ-27 ;ns, P > 0.05;

[0071] Fig.25 is the number of Salmonella in mouse organ tissues;

[0072] Note:* P < 0.05, **0.01 < P < 0.05,*** P < 0.01vs ST; # P < 0.05, ## 0.01 < P <0.05, ### P < 0.01 vs 4×pBD2 / S1-ΔHLJ-27 ;ns, P > 0.05;

[0073] Fig.26 Real-time PCR detection of tight junction protein expression in mouse ileum;

[0074] Fig. 27 Western blot detection of tight junction protein expression in mouse ileum;

[0075] Note:* P < 0.05, **0.01 < P < 0.05,*** P < 0.01vs ST; # P < 0.05, ## 0.01 < P <0.05, ### P < 0.01 vs 4×pBD2 / S1-ΔHLJ-27 ;ns, P > 0.05;

[0076] Fig.28 To measure the content of anti-Salmonella specific antibodies in mice;

[0077] Among them, a) serum total IgG antibody level; b) intestinal mucosal total SIgA antibody level;

[0078] Note:* P < 0.05, **0.01 < P < 0.05,*** P < 0.01vs ST; # P < 0.05, ## 0.01 < P <0.05, ### P < 0.01 vs 4×pBD2 / S1-ΔHLJ-27 ;ns, P > 0.05;

[0079] Fig.29 To detect the secretion level of inflammatory factors in mice;

[0080] Among them, a) IL-1β; b) IL-10; c) IL-6; d) TNF-α;

[0081] Fig.30 Oral immunization, challenge and sampling schedule for experimental piglets;

[0082] Fig.31The effect of oral administration of recombinant porcine Lactobacillus casei on the growth performance of piglets;

[0083] Note:* P < 0.05, **0.01 < P < 0.05,*** P < 0.01vs PBS; # P < 0.05, ## 0.01 < P < 0.05, ### P < 0.01 vs 4×pBD2 / S1-ΔHLJ-27 ;ns, P > 0.05;

[0084] Fig.32 is the amount of 4×pBD2 / S1-ΔHLJ-27 in intestinal mucus;

[0085] Note: Different letters (a vs. b, a vs. c, a vs. d, b vs. c, b vs. d, c vs. d) indicate significant differences ( P < 0.05);

[0086] Fig.33 To detect organ index of immune piglets;

[0087] Among them, a) liver; b) spleen; c) thymus; d) mesenteric lymph nodes (MLN);

[0088] Fig.34 To measure the anti-PEDV specific IgG level in the serum of immunized piglets;

[0089] Note:* P < 0.05, **0.01 < P < 0.05,*** P < 0.01vs PBS; # P < 0.05, ## 0.01 < P < 0.05, ### P < 0.01 vs 4×pBD2 / S1-ΔHLJ-27 ;ns, P > 0.05;

[0090] Fig.35 To measure the level of anti-PEDV specific SIgA in nasal swabs of immunized piglets;

[0091] Note:* P < 0.05, **0.01 < P < 0.05,*** P < 0.01vs PBS; # P < 0.05, ## 0.01 < P < 0.05, ### P < 0.01 vs 4×pBD2 / S1-ΔHLJ-27 ;ns, P > 0.05;

[0092] Fig.36 To measure the anti-PEDV specific SIgA level in anal swabs of immunized piglets;

[0093] Note:* P < 0.05, **0.01 < P < 0.05,*** P < 0.01vs PBS; # P < 0.05, ## 0.01 < P < 0.05, ### P < 0.01 vs 4×pBD2 / S1-ΔHLJ-27 ;ns, P > 0.05;

[0094] Fig.37 To detect the titer of neutralizing antibodies in the serum of immunized piglets;

[0095] Note:* P < 0.05, **0.01 < P < 0.05,*** P < 0.01vs PBS; # P < 0.05, ## 0.01 < P < 0.05, ### P < 0.01 vs 4×pBD2 / S1-ΔHLJ-27 ;ns, P > 0.05;

[0096] Fig.38To detect the secretion level of serum cytokines in immunized piglets;

[0097] Note:* P < 0.05, **0.01 < P < 0.05,*** P < 0.01vs PBS; # P < 0.05, ## 0.01 < P < 0.05, ### P < 0.01 vs 4×pBD2 / S1-ΔHLJ-27 ;ns, P > 0.05;

[0098] Fig.39 To detect the levels of IgG1 and IgG2a antibodies in immunized piglets;

[0099] Note:* P < 0.05, **0.01 < P < 0.05,*** P < 0.01vs PBS; # P < 0.05, ## 0.01 < P < 0.05, ### P < 0.01 vs 4×pBD2 / S1-ΔHLJ-27 ;ns, P > 0.05;

[0100] Fig.40 To determine the survival rate of piglets after PEDV infection;

[0101] Fig.41 Score piglets for clinical signs;

[0102] Fig.42 For RT-PCR detection of PEDV in anal swabs of piglets;

[0103] Among them, a) RT-PCR detection of fecal virus excretion in piglets in the PEDV challenge group; b) RT-PCR detection of fecal virus excretion in piglets in the Co-PBS cohabitation infection group; c) oral administration of recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 RT-PCR detection of fecal virus excretion in immunized piglets;

[0104] Fig.43 The pathological changes of the small intestine of piglets were observed by autopsy;

[0105] Fig.44 is the PEDV virus copy number standard curve;

[0106] Fig.45 To determine the PEDV virus content in different intestinal segments;

[0107] Fig.46 Small intestinal tissue sections of challenged piglets;

[0108] Fig.47 The results of immunofluorescence detection of tight junction protein expression in frozen tissue of piglet ileum;

[0109] Fig.48 Western blot detection of tight junction protein expression in piglet ileum;

[0110] Fig.49 The results of the determination of anti-PEDV specific antibody content in challenged piglets;

[0111] Fig.50 These are the test results of the secretion levels of inflammatory factors in piglets challenged with poison. DETAILED DESCRIPTION

[0112] The present invention is further described below in conjunction with specific embodiments, but the embodiments are only used to illustrate the present invention and do not constitute any limitation to the protection scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention can be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the protection scope of the present invention.

[0113] Example 1 Construction of alanine auxotrophic recombinant Lactobacillus paracasei S1 / ΔHLJ-27 expressing PEDV S1

[0114] Alanine auxotrophic recombinant Lactobacillus paracasei S1 / ΔHLJ-27 expressing PEDV S1 has been described in a patent application with publication number CN118460584A and invention name “Gene editing system and application of auxotrophic lactic acid bacteria based on CRISPR-Cas9 system”. The specific method is as follows:

[0115] 1. Construction of positive recombinant bacteria pLCNICK-DA1 / HLJ-27:

[0116] The Alr gene of the L. paracasei HLJ-27 genome (Li Fengsai., Mei Zhuyuan., Ju Ning., Sui Ling., Fan Xiaolong., Wang Zi., Li Jiaxuan., Jiang Yanping., Cui Wen., Shan Zhifu., Zhou Han., Wang Li., Qiao Xinyuan., Tang Lijie., Wang Xiaona., Li Yijing.(2022). LactobacillusEvaluation of the immunogenicity of auxotrophic withCRISPR-Cas9D10A system-mediated chromosomal editing to express porcinerotavirus capsid protein . Virulence, 13(1), 1315-1330.) was used as the target sequence, and 1001 bp of the upstream and downstream of the Alr gene were selected as homology arms. The primers for amplifying the Alr gene of the L. paracasei HLJ-27 genome were Alr up -2-F / R、Alr down -2-F / R, the primer sequences are shown in Table 1, and the upstream homology arm obtained by PCR was named Alr up , the downstream homology arm is named Alr down .

[0117] The PAM sequence (NGG) was selected according to the Alr gene sequence. The single sgRNAs were designed and synthesized for the Alr gene using the https: / / wwws.blueheronbio.com / external / tools / gRNASrc.jsp#gRNA_CRISPR website, abbreviated as DA1-sgRNA (Table 2). Alr was obtained by fusion through PCR. up -Alr down -sgRNA sequence, and the fusion fragment was introduced into the pLCNICK gene editing vector (purchased from Addgene) using the Xba I and Apa I restriction endonuclease sites to obtain a gene editing plasmid containing sgRNAs, named pLCNICK-DA1.

[0118] The recombinant plasmid pLCNICK-DA1 was electrotransformed into competent cells of Lactobacillus paracasei HLJ-27, and cultured at 30℃ for 3 h. After centrifugation, the bacterial solution was spread on MRS plates containing 5 µg / mL erythromycin resistance and 200 μg / mL D-alanine, and cultured at 30℃ for 36 h. Plasmid PCR identification of recombinant Lactobacillus casei showed that the size of the amplified target gene fragment was consistent with the expected result, and the positive recombinant bacteria were named pLCNICK-DA1 / HLJ-27.

[0119]

[0120] According to the knockout site of the genomic Alr gene, identification primers were designed. The genome of the recombinant strain was extracted, and PCR was performed to identify whether the genomic Alr gene was missing using primers Alr-F / R (see Table 1). The PCR products identified by electrophoresis were sequenced and compared for homology, and then the alanine racemase auxotrophic mutant pLCNICK-DA1 / HLJ-27, i.e., the △Alr HLJ-27 mutant, was obtained.

[0121] 2. Construction of alanine racemase auxotrophic mutant expressing S1 gene

[0122] 2.1 Construction of gene editing plasmid pLCNICK-S1-DT3 and mutant strains

[0123] The thymidylate synthase thyA gene in the △Alr HLJ-27 genome was used as the insertion site. up -F / R and thyA down -F / R are primers (primer sequences are shown in Table 3), and the upstream and downstream homology arm sequences of the thyA site are amplified by PCR reaction.

[0124] According to the general principles of sgRNA design, based on the thyA sequence published on NCBI, a single sgRNA sequence targeting the thyA site was designed using the https: / / wwws.blueheronbio.com / external / tools / gRNASrc.jsp#gRNA_CRISPR online design software, abbreviated as sgRNA-DT3 (see Table 4). down They were fused with the purified product of sgRNAs, sgRNA-DT3, and the obtained fusion fragment was named thyA down -DT3.

[0125] Using pMD19Ts-VP4-DT1 plasmid as template, thyA up -F1 and RBS-R are primers to amplify Hasup -P776-RBS fragment; using pMD19T-S1 plasmid as template and S1-F / R as primers, the S1 fragment was amplified, and the nucleotide sequence is shown in SEQ ID NO.4; using pMD19Ts-DT3-VP4 plasmid as template, thyA down – F1, thyA-DT-R3 as primers, amplify Has down -sgRNA-DT3 sequence; then with thyA up -F, thyA-DT-R3 as primers, and Has up -P776-RBS, S1 and Has down -sgRNA-DT3 purified product, primers are shown in Tables 3 and 5, and the obtained fusion fragment is named S1-DT3.

[0126] S1-DT3 was inserted into the pLCNICK vector to obtain the gene editing plasmid ppLCNICK-S1-DT3. The gene editing plasmid was electroporated into L. paracasei HLJ-27 competent cells by electroporation, and the primers thyA-F / R (see Table 3) were used to perform PCR identification on whether the mutant genome thyA gene was missing and whether the exogenous gene S1 gene was inserted. The primer sequences and sgRNAs sequences are shown in Tables 3-5, respectively.

[0127]

[0128] 2.2 PCR identification results of the S1 / △Alr HLJ-27 mutant;

[0129] In order to study whether the S1 gene in the recombinant bacteria was successfully inserted into the thyA site, the genome of the strain successfully transformed with the pLCNICK-S1-DT3 gene editing plasmid was extracted for PCR identification. The identification primers were thyA-F / R primers. The results showed two PCR bands, 1849 bp and 3415 bp respectively. 1849 bp was wild type and 3415 bp was mutant, which was consistent with expectations, indicating that the pLCNICK-S1-DT3 plasmid successfully inserted the S1 exogenous gene into the thyA site of the genome of △Alr HLJ-27. After purification, the S1 / △Alr HLJ-27 mutant strain was obtained.

[0130] Example 2 Construction of recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 and PEDV S1

[0131] 1. Construction of pPG-TSP-n×pBD2 (n=1, 2, 3 or 4) recombinant plasmid:

[0132] Fresh pig liver tissue was taken, total RNA was extracted and reverse transcribed, and the mature peptide sequence of the pBD2 gene was amplified using the extracted cDNA as a template and primer pair pBD2-F / pBD2-R1. The PCR product was then used as a template and primer pairs pBD2-F / pBD2-R2 and pBD2-F / pBD2-R3 were used to add an enterokinase recognition site (DDDDK) and a His tag to the 5' end of the pBD2 target gene fragment for PCR amplification and recovery. The signal peptide SP sequence of the S-layer protein of Lactobacillus brevis (including the T7g10 enhancer sequence) was synthesized by Beijing Qingke Biological Co., Ltd. and was amplified and recovered by PCR using primer pair TSP-F / TSP-R. The peptidoglycan hydrolase signal peptide Lsp sequence was obtained from the plasmid pPG-T7g10-sp-LFCA constructed in the laboratory in the early stage and was amplified and recovered by PCR using primer pair TLsp-F / TLsp-R. The above gel recovery products were respectively subjected to fusion expression to obtain T7g10-SP-pBD2 and T7g10-Lsp-pBD2 sequences.

[0133] The primers used are shown in Table 6, and the gene sequences used are shown in Table 7. The construction strategy of the lactic acid bacteria expression vector for recombinant n×pBD2 (n = 1, 2, 3 or 4) genes is as follows Figure 1 The main functional elements of the n×pBD2 gene expression cassette include the HCE promoter, T7g10 enhancer, and secretory expression signal peptide SP. pBD2 generally exerts its biological activity and function in the form of a free monomeric peptide, so an enterokinase recognition site (DDDDK) is inserted between the tandem n×pBD2 molecules to facilitate the recognition and hydrolysis of the recombinant n×pBD2 protein into monomeric pBD2 molecules by enterokinase after extracellular expression.

[0134]

[0135]

[0136]

[0137] The two purified fragments were connected to the pMD-19T Simple vector at 16°C for 2 h, and the mixed product was transformed into E. coli DH5α competent cells by chemical heat. Single colonies on the LB solid plate were picked and inoculated into LB liquid medium containing 20 μg / mL Amp. Then, the extracted plasmids were identified by PCR using 19T-F / 19T-R as primer pairs and sent for sequencing. The identified correct plasmids were named pMD19T-T7g10-SP-pBD2 and pMD19T-T7g10-Lsp-pBD2 ( Figure 2The vector plasmid pPG-T7g10-PPT and the above-constructed cloning plasmid were double-digested with SnaB I and Apa I restriction endonucleases at 30°C for 2 h to obtain the same sticky ends. The large vector fragment pPG and the small target gene fragments T7g10-SP-pBD2 and T7g10-Lsp-pBD2 were recovered by gel excision, and then ligated at 16°C for 4 h under the action of T4 DNA ligase. The ligation products were heat-transformed into Escherichia coli TG1 competent cells, and a single colony on the LB solid culture medium cultured overnight was picked and inoculated into 1 mL of LB liquid culture medium containing 10 μg / mL Cm. The plasmid was then extracted, and the recombinant plasmid was identified by PCR using pPG-F / pPG-R as primers and sequenced. The positive recombinant plasmids identified correctly were named pPG-T7g10-SP-pBD2 and pPG-T7g10-Lsp-pBD2 ( Figure 3 ).

[0138] 2. Transformation of alanine auxotrophic recombinant Lactobacillus paracasei S1 / ΔHLJ-27 expressing PEDV S1

[0139] Subsequently, the positive recombinant plasmids were electrotransformed into competent cells of alanine auxotrophic recombinant Lactobacillus paracasei S1 / ΔHLJ-27 (prepared in Example 1) expressing PEDV S1. The specific operation steps were as follows: the electroporator was preheated in a clean bench for 15 min, and the parameters were set as follows: U=2200 V, R=400 Ω, C=25 F. S1-ΔHLJ-27 competent cells were placed on ice to thaw naturally; 10 µL (about 100 µg / mL) of plasmid was added, and the mixture was mixed by slowly pipetting with a pipette, and ice bathed for 5 min; the mixture was transferred to a pre-cooled electric rotating cup; after instantaneous electric shock, 1 ml of pre-cooled MRS recovery medium was quickly added, mixed evenly, and incubated at 37°C for 4 h; centrifuged at 3500 rpm×5 min, 800 µL of supernatant was discarded, and the bacteria were gently resuspended, spread on MRS solid agar medium containing 200 μg / mL D-alanine and 5 µg / mL Cm, and incubated at 37°C for 24-36 h. A single colony on the MRS plate after electrotransformation was picked and inoculated into Cm-resistant MRS liquid medium containing 200 μg / mL D-alanine, cultured at 37℃ for 24 h, centrifuged at 12000 rpm×1 min, the bacterial precipitate was washed 3 times with PBS, lysozyme (10 mg / mL) was added, and the culture was allowed to act at 37℃ for 1 h. The bacterial precipitate was washed 3 times with PBS again, and the plasmid was extracted using a plasmid DNA mini kit. The primers pPG-F / pPG-R were used for PCR and sequencing identification. The recombinant porcine Lactobacillus casei 1×pBD2 / S1-ΔHLJ-27 and pPG-T7g10-Lsp-pBD2 / S1-ΔHLJ-27 were successfully constructed. The secretory expression ability of pBD2 protein induced by different secretory signal peptides (SP and Lsp) was detected. The Western blot detection results of mouse anti-His monoclonal antibody showed that the signal peptide SP induced the best secretory expression of pBD2 protein in the supernatant ( Figure 4 ).

[0140] 3. Construction of pPG-TSP-n×pBD2 (n=1, 2, 3 or 4) recombinant plasmid:

[0141] Using plasmid pMD19T-T7g10-SP-pBD2 as template, primers HR-F / HR-R were used to amplify the first substrate sequence of homologous recombination, and primers nHR-F / nHR-R were used to amplify the second substrate sequence. The two sequences were homologously recombined by fusion PCR, and then primers HR-F / nHR-R were used to amplify the T7g10-SP-2×pBD2 sequence, which was connected to the pMD19T vector to construct a positive clone plasmid named pMD19T-TSP-2×pBD2; by analogy, using pMD19T-TSP-2×pBD2 as a template, the positive clone plasmid pMD19T-TSP-3×pBD2 was constructed by the same operation as above; and pMD19T-TSP-4×pBD2 was constructed in the same way as above. The recombinant plasmid was identified by PCR using 19T-F / 19T-R as primers and sequenced; at the same time, the obtained plasmid was double-digested with SnaB I and Apa I restriction endonucleases for identification ( Figure 5 ).

[0142] 4. Construction of recombinant lactic acid bacteria expressing n×pBD2 (n=1, 2, 3 or 4):

[0143] The vector plasmid pPG-T7g10-PPT and the above-constructed cloning plasmids pMD19T-TSP-2×pBD2, pMD19T-TSP-3×pBD2 and pMD19T-TSP-4×pBD2 were double-digested with SnaB I and Apa I restriction endonucleases at 30°C for 2 h to obtain the same sticky ends. The large vector fragment pPG and the small target gene fragments TSP-2×pBD2, TSP-3×pBD2 and TSP-4×pBD2 were recovered by gel excision, and then ligated at 16°C for 4 h under the action of T4 DNA ligase, and the ligation products were thermally transformed into Escherichia coli TG1 competent cells.

[0144] A single colony on the LB solid culture medium cultured overnight was picked and inoculated into 1 mL of LB liquid culture medium containing 10 μg / mL Cm, and cultured in a constant temperature shaking incubator at 37°C for 12 h; the plasmid was extracted and the recombinant plasmid was identified by PCR using pPG-F / pPG-R as primers and sequenced; at the same time, the obtained plasmid was double-digested with SnaB I and Apa I restriction endonucleases, and the correctly identified positive recombinant plasmids were named pPG-TSP-2×pBD2, pPG-TSP-3×pBD2 and pPG-TSP-4×pBD2.

[0145] The above recombinant plasmid was electrotransformed into S1-ΔHLJ-27 competent cells by electroporation. After electroporation, the culture was resumed at 37°C for 4 h. After centrifugation, the bacterial solution was spread on MRS solid agar medium containing 200 μg / mL D-alanine and 5 μg / mL Cm, and cultured at 37°C for 24-36 h. Single colonies were picked for PCR identification and sequencing. After correct identification, n×pBD2 / S1-ΔHLJ-27 (n=1,2,3,4) positive recombinant lactic acid bacteria ( Figure 6 ).

[0146] 5. Detection of the expression level of n×pBD2 (n=1, 2, 3 or 4) protein in recombinant porcine Lactobacillus casei:

[0147] 5.1 Western blot detection

[0148] Recombinant porcine Lactobacillus casei 1×pBD2 / S1-ΔHLJ-27, 2×pBD2 / S1-ΔHLJ-27, 3×pBD2 / S1-ΔHLJ-27 and 4×pBD2 / S1-ΔHLJ-27 were streaked on MRS plates (Cm resistance, 200 μg / mL D-alanine) and cultured at 37°C for 30 h. Single colonies were picked and inoculated into MRS liquid medium (Cm resistance, 200 μg / mL D-alanine) and cultured at 37°C for 12-16 h. After adjusting OD600 to 1, they were inoculated into 200 mL MRS (Cm resistance, 200 μg / mL D-alanine) liquid medium at a dilution ratio of 1:100 for expansion culture. After 18 h of culture, the three bacterial cultures were harvested respectively. First, 2 mL of bacterial culture was taken to adjust the OD600 to 4.5, and the bacterial precipitates were collected after centrifugation. The bacterial protein samples were prepared after ultrasonic disruption. The remaining bacterial culture was ice-bathed for 30 min and then centrifuged at 8000 rpm×5 min at low temperature. The culture supernatant was harvested and the supernatant protein was collected by TCA precipitation method to prepare the sample.

[0149] The pBD2 peptide standard-coupled KLH was used as an immunogen to prepare rabbit anti-pBD2 polyclonal antibodies. The pBD2 specific antibody titer detected by ELISA was 1:12800. The protein samples prepared above were subjected to SDS-PAGE electrophoresis, and the sample volume per well of each sample was 20 μL. After transfer, rabbit anti-pBD2 polyclonal serum (1:200) was used as the primary antibody and HRP-labeled goat anti-rabbit IgG (1:5000) was used as the secondary antibody for Western blot analysis. The results of Western blot detection of recombinant porcine Lactobacillus casei expressing n×pBD2 are shown in Figure 2. Figure 7 Western blot results showed that rabbit polyclonal antibody could specifically bind to the pBD2 protein expressed by recombinant porcine Lactobacillus casei.

[0150] 5.2 ELISA

[0151] The positive pBD2 peptide standard was diluted to different concentrations with coating solution, and 100 μL / well was coated on a 96-well enzyme-labeled reaction plate, incubated overnight at 4℃, and washed 3 times with PBST; 200 μL of 5% skim milk was added to each well, blocked at 37℃ for 2 h, and washed 3 times with PBST; rabbit anti-pBD2 polyclonal antibody (1:400) was used as the primary antibody, 100 μL was added to each well, incubated at 37℃ for 2 h, and washed 3 times with PBST; HRP-labeled goat anti-rabbit IgG (1:10000) was used as the secondary antibody, 100 μL was added to each well, incubated at 37℃ for 2 h, and washed 3 times with PBST; TMB colorimetric solution A and B were mixed at a ratio of 1:1, and 50 μL / well was used for color development at 37℃ for 15 min; an equal volume of 2 M sulfuric acid solution was added to terminate the reaction, and the absorbance was read at OD450 using an enzyme-labeled instrument. A standard curve was drawn based on the OD value and concentration value for the quantification of pBD2 protein. The culture supernatant and bacterial lysate after 6 h, 10 h, 14 h, 18 h, 22 h, and 24 h of culture were coated on a 96-well ELISA plate, and the expression level of the pBD2 protein was detected and calculated according to the above ELISA method and the established ELISA standard curve.

[0152] pBD2 protein quantitative standard curve Figure 8 The detection results of the recombinant porcine Lactobacillus casei supernatant and lysate expressing n×pBD2 are shown in Tables 8 and 9.

[0153]

[0154]

[0155] The results showed that when the recombinant porcine Lactobacillus casei was cultured for 18 h, the expression level of 4×pBD2 protein was the highest in the supernatant of the recombinant porcine Lactobacillus casei.

[0156] Example 3 Detection of in vitro antibacterial activity of recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 expressing pBD2

[0157] 1. Enterokinase hydrolyzes recombinant pBD2 protein: First, dilute the recombinant enterokinase to a working concentration of 0.5 IU / μL, mix it evenly with the bacterial liquid protein, and react it in a 22℃ water bath. The hydrolysis reaction system is 100 μL (10×rEK CleavageBuffer 10 μL, recombinant enterokinase 2 μL, recombinant porcine Lactobacillus casei liquid protein about 100 μg, ddH2O supplemented to 100 μL), collect the hydrolyzate, identify it by Western blot, and store it in a -80℃ freezer. The Western blot test results of enterokinase hydrolysis of n×pBD2 are as follows Fig. 9 shown.

[0158] 2. Determination of in vitro antibacterial rate

[0159] After secondary activation, recombinant lactic acid bacteria S1-ΔHLJ-27, Salmonella typhimurium CMCC 50115, Staphylococcus aureus ATCC 43300 and enterotoxigenic E. coli ETEC K88 were cultured to a concentration of 1×109 CFU / mL, and different concentrations of recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 bacterial protein samples were added. At the same time, the S1-ΔHLJ-27 bacterial protein sample was set as the control group. The samples were cultured at 37°C for 12 h, and 10 μL of the bacterial solution was spread on LB agar or SS agar after serial dilution with PBS. After incubation at 37°C for 12 h, the colonies were counted and the inhibition rate was calculated by the formula: inhibition rate = [1−(CFU sample / CFU control)]×100%.

[0160] The results of in vitro antibacterial rate test of recombinant porcine Lactobacillus casei expressing pBD2 on pathogenic bacteria are as follows Fig.10 The results showed that the inhibition rates of the recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 against the three strains were 51%, 63% and 66%, respectively (P < 0.001).

[0161] 3. Indirect Immunofluorescence Analysis

[0162] The above three pathogens were reacted with the recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 expression supernatant for 6 h; centrifuged at 3500 rpm×5 min, discarded the supernatant, and washed 3 times with PBS; a small amount of bacterial solution was taken for smear and dried, fixed with 4% paraformaldehyde at 37℃ for 30 min, and washed 3 times with PBS; the fixed smear was perforated with 0.1% Triton (diluted in PBS) for 10 min, and washed 3 times with PBS; blocked with 2% BSA at room temperature for 30 min, and washed 3 times with PBST; rabbit anti-pBD2 polyclonal antibody was used as the primary antibody, incubated at 37℃ for 1 h, and washed 3 times with PBST; all subsequent steps needed to be protected from light, the secondary antibody was FITC-labeled goat anti-rabbit IgG antibody (1:200), incubated at 37℃ for 1 h, and washed 3 times with PBST; incubated with DAPI staining solution (1:2000) for 5 min; wash 3 times with PBST; absorb the liquid on the slide with absorbent paper, add anti-fluorescence quencher to seal the slide, and observe and photograph the slide under a fluorescence microscope. The results of indirect immunofluorescence detection of the effect of recombinant porcine Lactobacillus casei expressing pBD2 on pathogenic bacteria are shown in Fig.11 shown.

[0163] 4. Transmission electron microscopy analysis

[0164] The above three pathogens were reacted with the recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 bacterial protein for 6 h; the bacterial precipitate was collected by centrifugation at 3500 rpm×5 min: washed with sterile water 3 times to prepare a bacterial suspension; glutaraldehyde was added to fix at 4°C for 3 h, and washed with sterile water 3 times; the mixed bacterial suspension was dripped on the copper mesh membrane with a sterile capillary pipette, and the water was absorbed by filter paper. After the sample was dried, it was placed under a low-power optical microscope for inspection, and the copper mesh with intact membrane and uniform bacterial distribution was selected; it was stained with 3% uranyl acetate-lead citrate for 5~10 s, and the stain was immediately absorbed with filter paper. After drying, the sample was observed under a transmission electron microscope. The results are as follows Fig.12 shown.

[0165] Analysis of the results of IFA and transmission electron microscopy observations showed that the pBD2 protein expressed by the recombinant porcine Lactobacillus casei could interact with the three pathogenic bacteria respectively. The dense surface structures of the three pathogenic bacteria showed varying degrees of damage, such as depressions, wrinkles or defects.

[0166] Example 4 Detection of in vitro anti-PEDV activity of recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 expressing pBD2

[0167] 1. Cytotoxicity test

[0168] Vero-E6 cells were plated in 96-well cell plates and cultured to a cell density of 70%. pBD2 peptide standard, recombinant lactic acid bacteria S1-ΔHLJ-27 and 4×pBD2 / S1-ΔHLJ-27 bacterial solution protein were diluted 2-fold to 128 µg / mL, 64 µg / mL, 32 µg / mL, 16 µg / mL, 8 µg / mL, 4 µg / mL and 2 µg / mL, respectively, and 100 μL / well was added to the cell plate. A negative control was also set up and cultured in a 37℃ 5% CO2 incubator for 12 h. 10 μL CCK-8 (5 mg / mL) was added to each well and incubated in a 37℃ 5% CO2 incubator for 3 h in the dark. The absorbance of each well at 450 nm was measured to detect the effect of recombinant pBD2 protein on cell viability. Eight replicate wells were set up in each group of the experiment, and the experiment was repeated 3 times independently. The calculation formula was: cell viability = [OD450 (control group) - OD450 (blank group)] / [OD450 (experimental group) - OD450 (blank group)].

[0169] The results of the determination of the effect of recombinant porcine Lactobacillus casei expressing pBD2 on the activity of Vero-E6 cells are shown in Fig.13 The results showed that different concentrations of pBD2 bacterial protein (2-256 μg / mL) had no toxic effect on Vero-E6 cells (P > 0.05).

[0170] 2. Effect of recombinant porcine Lactobacillus casei expressing pBD2 on PEDV proliferation

[0171] Vero-E6 cells were cultured in 24-well plates. When the cell density reached 90%, the cells were treated in three different ways to detect the effects of recombinant porcine Lactobacillus casei liquid protein pBD2 on the proliferation of PEDV virus. (A) Pretreatment group: Bacterial protein with a final concentration of 2-128 µg / mL and PEDV virus solution containing a final concentration of 25 μg / mL pancreatin (MOI = 0.1) were mixed and incubated at 37°C for 1 h, then inoculated into Vero-E6 cells. After adsorption at 37°C for 1 h, the virus solution was discarded and maintenance medium (final concentration of pancreatin was 6 μg / mL) was added. (B) Simultreatment group: Bacterial protein with a final concentration of 2-128 µg / mL and PEDV virus solution containing a final concentration of 25 μg / mL pancreatin (MOI = 0.1) were mixed and inoculated into cells. After adsorption at 37°C for 1 h, the virus solution was discarded and maintenance medium (final concentration of pancreatin was 6 μg / mL) was added. (C) Posttreatment group: Vero-E6 cells were inoculated with PEDV virus solution with a final concentration of 25 μg / mL pancreatin (MOI = 0.1) and adsorbed at 37°C for 1 h. h later, the virus solution was discarded, and maintenance medium containing bacterial protein at a final concentration of 2-128 µg / mL (the final concentration of trypsin was 6 μg / mL) was added respectively; no bacterial protein was added to the control group, and the others were treated in the same way; the experiment was repeated three times for each group, and samples were collected 24 h after virus infection for virus quantity detection. The cell samples of the cell samples to be tested were extracted with the TRIzol method, and the quantitative RNA was reverse transcribed into cDNA. The cDNA and SYBR green qPCR fluorescent quantitative dye of each group of samples were mixed with the primer pair qPEDV-F / qPEDV-R and the primer pair GAPDH-F / GAPDH-R, respectively, and the CT value of the gene to be tested was detected by a fluorescent quantitative PCR instrument, and the relative gene expression level was calculated by the 2-ΔΔCT method with GAPDH as a reference.

[0172] The inhibitory effects of different concentrations of pBD2 bacterial protein on PEDV infection Fig.14 The results showed that pBD2 bacterial protein inhibited the proliferation of PEDV at different stages of PEDV infection (P < 0.001), and the inhibitory effect was more obvious after direct binding with the virus (pretreatment group) (P < 0.05).

[0173] 3. Determination of PEDV titer by plaque assay

[0174] Bacterial protein and PEDV virus solution were inoculated into Vero-E6 cells with a density of 90% according to the above three methods. After 24 hours of infection, the cell supernatant samples were collected and diluted 1:10 with serum-free medium containing trypsin at a final concentration of 25 μg / mL, and then inoculated into a monolayer of Vero-E6 cells in a 6-well plate. Each sample was repeated 3 times and incubated in a 37℃ 5% CO2 incubator for 1 hour; 1.6% low-melting point agarose was melted in a water bath, and an equal volume of 2×DMEM after incubation was mixed with low-melting point agarose, and trypsin at a final concentration of 6 μg / mL was added to mix, and placed in a 40℃ water bath; after incubation, the virus solution was discarded, PBS was gently washed twice, 2 mL of maintenance medium was added to each well, and 1 mL of prepared warm agarose was added to each well. After standing at room temperature for the agarose layer to solidify, it was placed in an incubator and inverted for 24 hours, crystal violet was added for staining, and then cell plaques were counted and the virus titer was calculated. Results are shown in Fig.15 And as shown in Table 10.

[0175]

[0176] 4. IFA observation of PEDV infection in Vero-E6 cells

[0177] The cell samples to be tested were gently washed twice with PBS, fixed with 4% paraformaldehyde at room temperature for 30 min, and washed with PBS three times, each time for 5 min; mouse anti-PEDV S1 monoclonal antibody (1:1000) diluted with 2% BSA was used as the primary antibody, incubated at 37°C for 1 h, and washed with PBS three times, each time for 5 min; FITC-labeled goat anti-mouse IgG (1:100) was added in the dark, incubated at 37°C for 45 min, and washed with PBS three times, each time for 5 min; DAPI dye (1:1000) was added in the dark, stained at room temperature for 5 min, washed with PBS three times, each time for 5 min, and observed and photographed under a fluorescence microscope.

[0178] The results of cell activity assay after PEDV infection are as follows Fig.16 And as shown in Table 11.

[0179]

[0180] The results of the recombinant porcine Lactobacillus casei expressing pBD2 on PEDV infection of Vero-E6 cells are shown in Fig.17 The results showed that the cell survival rate was significantly increased after treatment with pBD2 bacterial protein (P < 0.05), and the syncytial lesions caused by PEDV infection were weakened, and the protective effect of the pretreatment group was the most significant (P < 0.05).

[0181] 5. Western blot detection of PEDV infection in Vero-E6 cells

[0182] Collect the cell samples to be tested, add 50 μL of cell lysis buffer containing 1% PMSF to each well, lyse at 4°C for 1 h, centrifuge at 1000 rpm×3 min at low temperature, take the supernatant, add 5×SDS and boil for 10 min to prepare protein samples for SDS-PAGE electrophoresis, use mouse anti-PEDV N protein polyclonal antibody (1:200) as primary antibody and HRP-labeled goat anti-mouse IgG antibody (1:5000) as secondary antibody for Western blot analysis. The results are shown in Figure 2. Fig.17 shown.

[0183] Example 5 Study on the effect of oral administration of recombinant porcine Lactobacillus casei on the anti-Salmonella infection in mice

[0184] 1. Preparation of Salmonella Typhimurium CMCC 50115 strain

[0185] The frozen Salmonella typhimurium CMCC 50115 strain was streaked on a non-resistant LB solid agar plate and cultured at 37°C for 12 h. A single colony was picked and inoculated into a non-resistant LB liquid culture medium and cultured overnight at 37°C for 14 h. After washing twice with PBS buffer, the bacterial pellet was resuspended and the final concentration of the bacterial solution was adjusted to 5×108 CFU / mL.

[0186] 2. Animal experiment design and experimental animal grouping

[0187] The experimental animals were 80 SPF BALB / c mice of 6-7 weeks old, weighing about 18-22 g / mouse, and serum test negative for Salmonella. The animal experiment was divided into two parts: oral recombinant porcine Lactobacillus casei test and Salmonella infection test. The feeding procedure was as follows Fig.18 8-week-old BALB / c mice were randomly assigned to each group after adaptive feeding. The experimental groups and feeding doses are shown in Tables 12 and 13.

[0188]

[0189] 3. Weight gain measurement results

[0190] Effects of oral administration of recombinant porcine Lactobacillus casei on growth performance of mice Fig.19 The results showed that compared with the control group, the body weight of mice orally administered with recombinant porcine Lactobacillus casei increased significantly (P < 0.05).

[0191] 4. H&E staining of tissue sections

[0192] The intestinal tissue was fixed in 4% paraformaldehyde for 48 h; dehydrated using the ethanol gradient method (75%, 85%, 95%, 100%), and then washed twice with xylene, each time for 10 min; immersed in paraffin for 3 times at 57°C, each time for 60 min; the tissue in paraffin was embedded with an embedding machine, and then sliced ​​into 3-4 μm slices. After drying, it was stained with hematoxylin for 15 min and eosin for 1 min, dehydrated and sealed; the H&E-stained intestinal tissue sections were observed under a microscope, and 3 fields of view were randomly selected and photographed. The villus height and crypt depth were measured using ImagePlus Pro 6.0 software, and the ratio of villus height to crypt depth was calculated.

[0193] The results are as follows Fig. 20 , 21 The results showed that the villi of the jejunum and ileum of the animals in the oral administration of 4×pBD2 / S1-ΔHLJ-27 group were more neat and well developed, and the height of the intestinal villi and the villus / crypt ratio were significantly higher than those in the control group (P < 0.05), indicating that oral administration of recombinant porcine Lactobacillus casei can improve animal growth performance and promote intestinal epithelial development.

[0194] 5. Determination of immune organ index

[0195] The liver, spleen and body weight of the dead mice were weighed and recorded, and the immune organ index of each group was calculated according to the following formula: organ index = organ weight (g) / mouse body weight (g).

[0196] The results are as follows Fig. 22 The results showed that the organ indexes of immune organs, including liver, spleen, thymus and mesenteric lymph nodes, of mice and piglets orally administered 4×pBD2 / S1-ΔHLJ-27 were significantly increased (P < 0.05), and the number of CD4+T lymphocytes in the mesenteric lymph nodes of mice was significantly increased (P < 0.05).

[0197] 6. Mouse spleen CD4+T lymphocyte detection

[0198] The mouse mesenteric lymph node was removed under sterile clean bench and placed in a 1.5 mL EP tube. 1 mL 1640 complete medium was added and the syringe core was gently ground. After filtering through a copper mesh, the single cell suspension was collected and centrifuged at 500 rpm for 5 min at 4°C, and the supernatant was discarded. The cells were washed twice with pre-cooled 1640 medium and centrifuged at 500 rpm for 5 min each time. The cell pellet was resuspended in sterile 1× PBS buffer and the cells were counted to adjust the number of cells to 1×106 / mL. 500 μL of cell suspension was taken and 0.5 μL of PE mouse CD4 monoclonal antibody was added while protecting from light. The cells were incubated at 37°C for 30 min in the dark, centrifuged at 500 rpm for 5 min, and 500 μL of 1× PBS was added to resuspend the cells. The samples were loaded on a FACS Calibur flow cytometer for detection.

[0199] The results are as follows Fig.23 shown.

[0200] 7. Determination of Disease Activity Index and Survival Rate in Mice

[0201] After the Salmonella attack, the clinical symptoms and mortality of mice in each group were observed and recorded, and scored according to the standards in Table 14.

[0202]

[0203] The results are as follows Fig.24 Oral administration of recombinant porcine Lactobacillus casei S. typhimurium The protection rate of CMCC 50115 in mice was 70%.

[0204] 8. Bacterial translocation detection

[0205] Mouse liver, spleen and mesenteric lymph nodes were collected, weighed and ground thoroughly with PBS, filtered through a sterile copper mesh and diluted with an appropriate amount of PBS. 100 μL of tissue cell suspension was inoculated on SS agar plates and cultured at 37°C for 12 h before colony counting.

[0206] The results are as follows Fig.25 The results of bacterial translocation assay showed that oral administration of recombinant porcine Lactobacillus casei 4×pBD2 / S1- ΔHLJ-27 Able to reduce the number of Salmonella in the liver, spleen and mesenteric lymph nodes of mice ( P < 0.01), and reduced liver and spleen indexes ( P < 0.05), effectively inhibiting the invasion of Salmonella to peripheral organs after intestinal infection.

[0207] 9. Fluorescence quantitative PCR and Western blot detection of gene expression levels in intestinal tissue

[0208] (1) Fluorescence quantitative PCR detection: About 0.1 g of mouse jejunal tissue samples were taken from each group and quickly ground into powder in liquid nitrogen. 1 mL of Trizol was added for RNA extraction and reverse transcription to obtain intestinal tissue cDNA. The target gene was detected according to the fluorescence quantitative PCR system in Table 15. Zo-1 , Claudin-2 and β-actin The primers were ZO-1-F / R, Claudin-2-F / R, and β-actin-F / R, and the relative expression of the target gene was calculated according to 2 -ΔΔCt Method calculation, obtained in parallel experiments 2 -ΔΔCt The average value was taken and statistical analysis was performed, and 3 replicates were set for each gene tested.

[0209]

[0210] The results are as follows Fig.26 shown.

[0211] (2) Western blot detection: Take an equal amount of intestinal tissue or cell samples from each group and add 500 μL of pre-cooled Western and IP cell lysis buffer containing 1% PMSF. Lyse for 2 h on a shaker at 4°C, centrifuge at 5000 rpm×5 min at 4°C, and collect the protein supernatant; extract the sample nuclear protein according to the specific operation steps of the nuclear protein extraction kit instructions, and use the Bio-Tech BCA protein content detection kit to determine the protein concentration in the supernatant sample. The specific operation steps are strictly in accordance with the instructions. Dilute each group of protein samples to a consistent final concentration, add 5×SDS Loading buffer and mix well, and boil in a boiling water bath for 15 min; after the protein samples are cooled, SDS-PAGE electrophoresis is performed with a sample volume of 20 μL / well. After the target protein is transferred to the PVDF membrane, the corresponding antibody is selected according to the target band for Western blot detection, and the grayscale of the target band is analyzed using Image J software.

[0212] The results are as follows Fig. 27 The results showed that compared with the challenge control group, oral administration of recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 Effectively upregulated the expression of tight junction proteins Zo-1, occludin and claudin-2 ( P <0.05).

[0213] 10. ELISA test for detection of Salmonella antibodies

[0214] The optimal antigen coating concentration and serum dilution for detecting Salmonella specific antibodies were determined by square array test. Fresh Salmonella single colonies were selected in non-antibody liquid LB, cultured overnight at 37°C, and the bacterial solution was transferred to 10 mL non-antibody LB culture medium at a ratio of 10% and cultured until the logarithmic growth phase. The bacterial concentration was adjusted to 10 10 CFU / mL, centrifuged at 10000rpm×5 min, washed with 15% glycerol-PBS solution, and resuspended the bacterial pellet with coating solution. The antigen was diluted twice in turn to 1×10 10 CFU / mL, 5×10 9 CFU / mL, 2.5×10 8 CFU / mL and 1.3×10 7 CFU / mL, respectively coated enzyme label strips. The corresponding antigen positive serum was used as the primary antibody, and was diluted with a two-fold dilution ratio and incubated. At the same time, the serum of normal untreated mice was used as a negative control. According to the results of the square array test, the positive / negative (P / N) value was calculated to determine the optimal antigen coating concentration and serum dilution. The test results of the optimal coating concentration of Salmonella are shown in Tables 16 and 17.

[0215]

[0216] 11. ELISA detection of mouse serum IgG and intestinal SIgA antibodies

[0217] The serum and intestinal mucus of mice in each group were collected, and the total IgG antibody level in mouse serum and the total SIgA antibody level in the intestine were detected according to the instructions of enzyme-immune mouse immunoglobulin IgG and SIgA ELISA kits.

[0218] Mouse anti-Salmonella specific serum IgG and specific intestinal SIgA antibody detection, according to the results of the square array test, the whole Salmonella bacteria were used as antigens to coat the 96-well microtiter reaction plate, 100 μL per well, coated at 37℃ overnight, washed 3 times with PBST, each time for 10 min; 200 μL 2% BSA was added to each well and blocked at 37℃ for 2 h, washed 3 times with PBST, each time for 10 min; 2% BSA diluted (1:10) mouse serum was added, acted at 37℃ for 2 h, washed 3 times with PBST, each time for 10 min; HRP-labeled goat anti-mouse IgG or IgA antibody diluted 1:10000 was added, incubated at 37℃ for 1 h, washed 3 times with PBST; after incubation in TMB colorimetric solution in the dark for 15 min, 50 μL 2M sulfuric acid was added to each well to terminate the reaction, and the OD450 value was measured with an enzyme reader.

[0219] The results are as follows Fig.28The results of immunoglobulin detection showed that the levels of serum total IgG and intestinal mucosal total SIgA antibodies in mice after oral administration of recombinant porcine Lactobacillus casei were significantly higher than those in the control group (P < 0.05), indicating that oral administration of recombinant porcine Lactobacillus casei can regulate the body's immune state and improve the body's active immune ability; further analysis of the PEDV-specific immune response induced in piglets after oral administration of recombinant porcine Lactobacillus casei showed that piglets were able to produce PEDV-specific IgG and mucosal-specific SIgA antibodies (P < 0.01), and the antibody level of piglets in the oral 4×pBD2 / S1-ΔHLJ-27 group was significantly higher than that in the pPG / S1-ΔHLJ-27 group (P < 0.05), and the serum neutralizing antibody titer was 1:65.

[0220] 12. Serum cytokine level determination

[0221] The serum of mice in each group was collected on the 7th day after oral administration of recombinant porcine Lactobacillus casei and after infection with Salmonella for the detection of serum cytokine levels of IFN-γ, IL-1β, IL-6, IL-10 and TNF-α. The standard curve was drawn and the corresponding cytokine levels were calculated according to the instructions of the ELISA cytokine detection kit.

[0222] The results are as follows Fig.29 The cytokine response showed that oral administration of recombinant porcine Lactobacillus casei could induce Th1, Th2 and Th17 cell-mediated immunity in piglets. The detection of IgG1 and IgG2a antibody levels showed that IgG1 / IgG2a < 1, indicating that recombinant porcine Lactobacillus casei induced piglets to produce an immune response type dominated by Th1 cytokine regulation.

[0223] Example 6 Study on the protective effect of oral administration of recombinant porcine Lactobacillus casei on piglets against PEDV infection

[0224] 1. Preparation of recombinant lactic acid bacteria solution

[0225] Single colonies of the recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27 and pPG / S1-ΔHLJ-27 activated by streaking were picked and inoculated into 5 mL of MRS culture medium containing Cm resistance and non-resistance with D-alanine, respectively, and cultured at 37°C overnight. 1% of the colonies were inoculated into MRS culture medium containing Cm resistance and non-resistance with D-alanine for expansion and cultured at 37°C for 18 h. The cells were collected by centrifugation at 5000 rpm for 5 min, washed three times with sterile PBS, resuspended in PBS and adjusted to a cell concentration of 1×1011 CFU / mL.

[0226] 2. Experimental piglet grouping and immunization procedures

[0227] The experimental animals were 31 healthy newborn (before lactation) Duroc piglets from the same house who were negative for PEDV serum antibodies. The animal experiment was divided into two parts: piglet oral immunization test and piglet PEDV protection test. The oral immunization procedure was a one-time gavage of 2.5 mL of recombinant porcine Lactobacillus casei 4×pBD2 / S1-ΔHLJ-27, S1-ΔHLJ-27 or an equal amount of PBS to newborn piglets at birth. The immunization, challenge and sampling time are shown in the table. Fig.30 The experimental piglet groups and oral doses are shown in Tables 18 and 19. In the piglet intestinal colonization test, the intestinal tissues of the piglets need to be collected twice, on the 7th and 21st days after oral immunization.

[0228]

[0229] 3. Effects of oral administration of recombinant porcine Lactobacillus casei on the growth, development and immune performance of piglets

[0230] Effects of oral administration of recombinant porcine Lactobacillus casei on growth performance of piglets Fig.31 shown.

[0231] 4. Determination of colonization ability of recombinant porcine Lactobacillus casei in the intestine of piglets

[0232] After oral immunization with recombinant porcine Lactobacillus casei, intestinal mucus from the duodenum, jejunum, ileum, cecum and colon of piglets was scraped and diluted 10 times with PBS. 100 µL of each dilution was plated (MRS, Cm resistance, 200 μg / mL D-alanine). After culturing at 37°C for 24-30 h, a single colony was picked from the plate with a colony count between 30 and 50 to extract the plasmid, and the strain was identified and counted using primers pPG-F / pPG-R.

[0233] The results are as follows Fig.32 shown.

[0234] 5. Determination of immune organ index

[0235] After oral administration of recombinant porcine Lactobacillus casei, the liver, spleen, thymus, mesenteric lymph nodes and body weight of each group of piglets were weighed and recorded, and the immune organ index of each group was calculated according to the following formula: organ index = organ weight (g) / piglet weight (kg).

[0236] The results are as follows Fig.33 shown.

[0237] 6. Analysis of immune response induced by oral recombinant porcine Lactobacillus casei

[0238] (1) Determination of specific IgG in piglet serum

[0239] Blood was collected from piglets through the anterior vena cava before and after immunization, incubated at 37°C for 1 h to promote coagulation, incubated at 4°C overnight, and centrifuged at 3000 rpm×5 min to collect serum for ELISA testing.

[0240] Indirect ELISA detection: 100 µL / well of PEDV virus solution was added to coat the 96-well enzyme-labeled reaction plate, coated overnight at 4°C, washed 3 times with PBST, added with 5% skim milk, blocked at 37°C for 2 h, washed 3 times with PBST, 5 min each time; 100 µL of piglet serum diluted ten times with PBS was added to each well, incubated at 37°C for 2 h, washed 3 times with PBST, 5 min each time; HRP-labeled goat anti-swine IgG antibody (1:5000) was used as the secondary antibody, incubated at 37°C for 1 h, washed 3 times with PBST, added with TMB colorimetric solution, and developed at 37°C in the dark for 10 min; 50 μL of 2M sulfuric acid stop solution was added to each well, and the absorbance was read at a wavelength of 450 nm using an enzyme-labeled instrument.

[0241] (2) Determination of neutralizing antibodies in piglet serum

[0242] The fixed virus dilution antibody method was used to determine the serum neutralizing antibody titer. Briefly, the immunized piglet serum was collected, filtered and sterilized, and inactivated at 56°C for 30 min; it was diluted 2-fold to 1:128 in a 96-well cell culture plate; the diluted serum was mixed with an equal amount of PEDV virus solution containing 100 TCID50, and trypsin solution was added at 37°C for 1 h; the mixture was added to the Vero-E6 monolayer cells in a 96-well plate and incubated at 37°C and 5% CO2 for 1 h; after changing the maintenance medium, the cells were cultured at 37°C and 5% CO2 for 48 h to observe whether syncytial cytopathic effect (CPE) occurred. The neutralization titer was expressed as the reciprocal of the highest dilution of serum that reduced the number of infected cells by at least 50% compared with the negative control serum.

[0243] (3) Determination of piglet-specific SIgA antibodies

[0244] Nasal and anal swab samples were collected from piglets before and after immunization. After collection, the swab samples were immersed in 1 mL of sterile PBS and left to stand overnight at 4°C. After centrifugation at 12000 rpm for 10 min at 4°C, the supernatant was collected as the primary antibody and HRP-labeled goat anti-swine IgA (1:5000) was used as the secondary antibody for ELISA detection.

[0245] (4) Detection of cytokines and antibody subtypes in serum

[0246] According to the instructions of the enzyme-linked immunosorbent assay kit, the levels of porcine immunoglobulins IgG1 and IgG2a, porcine interleukin 4 (IL-4), porcine interleukin 17 (IL-17) and porcine interferon γ (IFN-γ) in the serum of each group of piglets were measured.

[0247] The results of the determination of anti-PEDV specific IgG levels in the serum of immunized piglets are as follows Fig.34 The results of the determination of anti-PEDV specific SIgA levels in nasal swabs of immunized piglets are shown in Fig.35 The results of the determination of anti-PEDV specific SIgA levels in anal swabs of immunized piglets are shown in Fig.36 The results of the neutralizing antibody titer test of the immunized piglet serum are shown in Fig.37 The test results of cytokine secretion levels in the serum of immunized piglets are shown in Fig.38 The test results of IgG1 and IgG2a antibody levels in immunized piglets are shown in Fig.39 shown.

[0248] 7. Piglet protection experiment

[0249] (1) Clinical symptom score

[0250] After the infection, the clinical symptoms of the piglets in each group were observed and recorded, and the scores were scored according to the standards. The scores are shown in Table 20 (including the degree of diarrhea and mental state).

[0251]

[0252] The results of the survival rate test of piglets after PEDV infection are as follows Fig.40 The clinical symptom scores of piglets are shown in Fig.41 shown.

[0253] (2) Detoxification status detection

[0254] Anal swabs were collected from each group of piglets every 6 hours after the challenge, and the anal swabs were soaked in 1 mL of sterile PBS solution overnight, centrifuged at 12000 rpm × 5 min, and the supernatant was collected for RNA extraction and reverse transcription to obtain cDNA. RT-PCR verification was performed using cDNA as a template, and the primers used were PEDV-NF / PEDV-NR. After the PCR reaction was completed, it was identified by agarose gel electrophoresis.

[0255] The results are as follows Fig.42 shown.

[0256] (3) Pathological changes during autopsy

[0257] Observe the pathological changes of piglets in time after infection, perform autopsy immediately after death, record the pathological changes of the intestine during autopsy, remove organs and intestinal tissues (duodenum, jejunum, ileum, cecum, colon, rectum), and fix the tissues in 4% paraformaldehyde solution or store at -80℃ for later use.

[0258] Pathological changes in the small intestine of piglets Fig.43 Necropsy showed that the intestinal pathology of piglets in the oral recombinant porcine Lactobacillus casei group was significantly reduced.

[0259] (4) Determination of viral load in intestinal tissue

[0260] With the PEDV ORF3 gene sequence as a reference, quantitative PCR primers ORF3-F / ORF3-R were designed, PCR amplification was performed, and the ORF3 fragment was obtained and connected to the pMD19T-simple vector to construct the standard plasmid 19T-ORF3, which was diluted to different concentrations for the subsequent establishment of the standard curve. The calculation formula was: plasmid copy number = (6.02×1023)×(ng / μL×10-9) / (DNA length×660). 0.1 g of different intestinal tissues (duodenum, jejunum, ileum, cecum, colon) of piglets in each group after challenge were taken and ground with appropriate liquid nitrogen. After sufficient grinding, 1 mL TRIzol was added to extract RNA, which was then reverse transcribed to obtain cDNA as a fluorescent quantitative PCR reaction template. Real-time quantitative PCR was used to measure the viral load in the intestine, and the viral load was calculated according to the standard curve.

[0261] The standard curve of PEDV virus copy number is as follows: Fig.44 The results of the determination of PEDV virus content in different intestinal segments are shown in Fig.45 The results showed that the intestinal viral load of piglets in the oral recombinant porcine Lactobacillus casei infection group was significantly lower than that in the challenge control group and the cohabitation infection group (P < 0.05).

[0262] (5) Histopathological observation

[0263] The intestinal tissue sections and H&E staining procedures of piglets were the same as above. Fig.46 The results showed that the degree of intestinal epithelial barrier damage in the group infected with oral recombinant porcine Lactobacillus casei was significantly reduced, and the pathological changes were not obvious.

[0264] (6) Immunofluorescence of frozen sections

[0265] Fresh porcine small intestine tissue was taken for embedding frozen tissue blocks; 5 μm sections were cut with a freezing microtome, left to dry at room temperature, and then fixed with cold acetone at 4°C for 10 min; washed with PBS, added with 1.2% H2O2 for 20 min; washed with PBS, added with 0.3% TritonX-100 for 20 min; blocked with 2% BSA blocking solution at room temperature for 2 h; the primary antibody was Zo-1 monoclonal antibody (1:200), incubated overnight at 4°C; the secondary antibody was FITC-labeled goat anti-rabbit IgG antibody (1:100), incubated at room temperature for 1 h; washed with PBST, added with DAPI nuclear dye (1:1000); washed with PBST, added with anti-fluorescence quencher to seal the slides, and observed and photographed under an inverted fluorescence microscope.

[0266] Results of immunofluorescence detection of tight junction protein expression in frozen tissue of piglet ileum Fig.47 shown.

[0267] (7) Western blot detection of gene expression levels in intestinal tissue

[0268] The protein sample preparation and Western blot analysis of piglet intestinal tissue were the same as above. The Western blot results of tight junction protein expression in piglet ileum are shown in Figure 2. Fig.48 shown.

[0269] (8) Determination of PEDV-specific serum IgG and SIgA antibody levels

[0270] After the virus attack, the serum and intestinal mucus of each group of piglets were collected, and the whole PEDV virus was used as the preparation antigen. ELISA detection was performed using mouse anti-PEDV S1 protein monoclonal antibody and HRP-labeled goat anti-mouse IgG antibody. Fig.49 shown.

[0271] (9) Detection of inflammatory factors in serum

[0272] The serum of piglets in each group after infection was collected, and the inflammatory factors in the serum, including porcine tumor necrosis factor α (TNF-α), porcine interleukin 1β (IL-1β), porcine interleukin 6 (IL-6), and porcine interleukin 10 (IL-10), were detected by ELISA method with reference to enzyme-linked immunosorbent assay kits.

[0273] The test results of inflammatory factor secretion levels in challenged piglets are as follows Fig.50The results showed that the levels of pro-inflammatory factors IL-1β, IL-12, IL-6 and TNF-α in piglets infected with oral recombinant porcine Lactobacillus casei were significantly reduced (P < 0.05), while the level of anti-inflammatory factor IL-10 was significantly increased (P < 0.01), indicating that recombinant porcine Lactobacillus casei can alleviate the inflammatory response caused by PEDV infection; the protection rate of oral recombinant porcine Lactobacillus casei against piglets infected with PEDV after infection was 60% (3 / 5).

Claims

1. A recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 (pBD2) and porcine epidemic diarrhea virus (PEDV) S1 protein, characterized in that: The recombinant porcine lactobacillus casei uses porcine lactobacillus paracasei as a live bacterial carrier, and co-expresses porcine epidemic diarrhea virus protective antigen S1 protein and porcine beta-defensin 2 on its surface.

2. The recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 and PEDV S1 protein according to claim 1, characterized in that: The recombinant porcine lactobacillus casei contains multiple copies of tandem porcine beta-defensin 2 gene expression cassettes, an enterokinase recognition site is added between the tandem porcine beta-defensin 2 gene expression cassettes, and based on homologous recombination technology, a lactic acid bacteria expression vector pPG-T7g10-PPT is used as a plasmid skeleton, and an alanine auxotrophic porcine lactobacillus paracasei constitutively expressing PEDV S1 protein is used as a host bacterium to obtain the recombinant porcine lactobacillus casei that co-expresses porcine beta-defensin 2 and PEDV S1 protein.

3. The recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 and PEDV S1 protein according to claim 2, characterized in that: The copy number of the porcine beta-defensin 2 gene expression cassette is 2-4.

4. The recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 and PEDV S1 protein according to claim 3, characterized in that: The copy number of the porcine beta-defensin 2 gene expression cassette is 4.

5. The recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 and PEDV S1 protein according to any one of claims 2 to 4, characterized in that: The main functional elements of the porcine beta-defensin 2 gene expression box include HCE promoter, T7g10 enhancer and secretory expression signal peptide SP.

6. The recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 and PEDV S1 protein according to claim 2, characterized in that: The host bacteria of the alanine auxotrophic porcine Lactobacillus paracasei constitutively expressing PEDV S1 protein is S1 / ΔHLJ-27.

7. A method for constructing a recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 and PEDV S1 protein according to claim 1, characterized in that: When the recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 and PEDV S1 protein contains a single copy of the pBD2 gene expression cassette, the following method is used: (1) fresh pig liver tissue was taken, total RNA was extracted and reverse transcribed, the mature peptide sequence of the pBD2 gene was amplified using the extracted cDNA as a template and primer pair pBD2-F / pBD2-R1, and then the PCR product was used as a template, and the primer pair pBD2-F / pBD2-R2 and pBD2-F / pBD2-R3 were used to add an enterokinase recognition site and a His tag at the 5' end of the pBD2 target gene fragment, and PCR amplification and recovery were performed, wherein the amino acid sequence of the enterokinase recognition site is DDDDK; the Lactobacillus brevis S-layer protein signal peptide SP sequence containing the T7g10 enhancer sequence as shown in SEQ ID NO.2 was synthesized, and the primer pair TSP-F / TSP-R was used to perform PCR amplification and recovery; the above gel recovery product was fusion expressed, and the T7g10-SP-pBD2 fragment was obtained after recovery and purification; pBD2-F:TCTAGAATTAACCTGCTTACGGGTCTTG pBD2-R1:GCGGATGCAGCACTTGGC pBD2-R2: CTGCCGCCCTTGTCGTCGTCGTCGCGGATGC pBD2-R3: GGGCCCGTGGTGGTGGTGGTGGTGCCCGCTGCCGCCGCTGCCG TSP-F:TACGTAGGGAGACCACAACGGTT TSP-R: GTGGTCAGCTGAAGCAGTCGTTG (2) The purified T7g10-SP-pBD2 fragment was ligated to the pMD-19T Simple vector, and the correct plasmid was named pMD19T-T7g10-SP-pBD2; (3) The vector plasmid pPG-T7g10-PPT and the cloning plasmid pMD19T-T7g10-SP-pBD2 were double-digested with SnaB I and Apa I restriction endonucleases, respectively, to obtain the same sticky ends. The large vector fragment pPG and the small target gene fragment T7g10-SP-pBD2 were recovered by gel cutting, and connected. The positive recombinant plasmid was identified and named pPG-T7g10-SP-pBD2; (4) Transformation of alanine auxotrophic recombinant Lactobacillus paracasei S1 / ΔHLJ-27 expressing PEDV S1: Subsequently, the positive recombinant plasmid pPG-T7g10-SP-pBD2 was electroporated into S1 / ΔHLJ-27 competent cells, and the correct one was identified to obtain the recombinant porcine Lactobacillus casei pPG-T7g10-SP-pBD2 / S1-ΔHLJ-27 co-expressing porcine β-defensin 2 and PEDV S1.

8. A method for constructing a recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 and PEDV S1 protein according to any one of claims 1 to 6, characterized in that: When the recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 and PEDV S1 protein contains 2-4 copies of the pBD2 gene expression cassette, the following method is used: (1) Construction of pMD19T-TSP-n×pBD2 recombinant plasmid, n=2, 3 or 4: The plasmid pMD19T-T7g10-SP-pBD2 constructed in claim 6 is used as a template, the first substrate sequence of homologous recombination is amplified by primers HR-F / HR-R, the second substrate sequence is amplified by primers nHR-F / nHR-R, the two sequences are homologously recombined by fusion PCR, and then the T7g10-SP-2×pBD2 sequence is amplified by primers HR-F / nHR-R, which is connected to the pMD19T vector to construct a positive clone plasmid named pMD19T-TSP-2×pBD2; by analogy, using pMD19T-TSP-2×pBD2 as a template, the positive clone plasmids pMD19T-TSP-3×pBD2 and pMD19T-TSP-4×pBD2 are constructed by the same operation as above; the recombinant plasmids are identified by PCR using 19T-F / 19T-R as primers and sequenced; at the same time, the obtained plasmids are cloned using SnaB I and Apa I restriction endonuclease for double digestion identification; 19T-F:TGTAAAACGACGGCCAGT 19T-R: CAGGAAACAGCTATGACC HR-F:TACGTAGGGAGACCACAACGGTT HR-R: CTTGTCGTCGTCGTCGCGGATGC nHR-F: GACGACGACGACAAGGACCACTACATATGTGCC nHR-R: GGGCCCGTGGTGGTGGGTGGTGGTGC (2) Construction of pPG-TSP-n×pBD2 recombinant plasmid, n=2, 3 or 4: The vector plasmid pPG-T7g10-PPT and the above-constructed cloning plasmids pMD19T-TSP-2×pBD2, pMD19T-TSP-3×pBD2 and pMD19T-TSP-4×pBD2 were double-digested with SnaB I and Apa I restriction endonucleases at 30°C for 2 h to obtain the same sticky ends. The large vector fragment pPG and the small target gene fragments TSP-2×pBD2, TSP-3×pBD2 and TSP-4×pBD2 were recovered by gel cutting, and then ligated under the action of T4 DNA ligase. The correct positive recombinant plasmids were identified and named pPG-TSP-2×pBD2, pPG-TSP-3×pBD2 and pPG-TSP-4×pBD2; (3) Construction of recombinant lactic acid bacteria expressing n×pBD2, n=2, 3 or 4: The above-mentioned recombinant plasmids pPG-TSP-2×pBD2, pPG-TSP-3×pBD2 and pPG-TSP-4×pBD2 were respectively electro-transformed into S1-ΔHLJ-27 competent cells by the electro-transformation method. After the correct ones were identified, the recombinant porcine Lactobacillus casei n×pBD2 / S1-ΔHLJ-27 co-expressing porcine β-defensin 2 and PEDV S1 was obtained, wherein n=2, 3 or 4.

9. Use of the recombinant porcine Lactobacillus casei co-expressing porcine β-defensin 2 and PEDV S1 protein according to any one of claims 1 to 6 in the preparation of a medicament for preventing or treating diseases caused by PEDV, Salmonella typhi or simultaneous infection with both.

10. The use according to claim 9, characterized in that The medicine is an oral mucosal vaccine.

Images