Spirocyclic compounds

By developing compounds that inhibit the helicase function of WRN protein, the therapeutic need for MSI-H cancer has been addressed, achieving the effects of inhibiting proliferation and apoptosis in MSI-H cancer, and providing a new treatment option.

CN119039303BActive Publication Date: 2026-07-03SHANGHAI SINOV BIOPHARMACEUTICAL CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANGHAI SINOV BIOPHARMACEUTICAL CO LTD
Filing Date
2024-09-20
Publication Date
2026-07-03

Smart Images

  • Figure CN119039303B_ABST
    Figure CN119039303B_ABST
Patent Text Reader

Abstract

The application discloses a kind of spiro compound as shown in formula (I), its use and the pharmaceutical composition containing it.The compounds have strong inhibition effect on WRN, thereby having the effect of inhibiting related cancer cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a spirocyclic compound, its uses, and pharmaceutical compositions containing it. Background Technology

[0002] During cancer progression, the loss of DNA mismatch repair function frequently occurs, as seen in 10%-30% of colorectal cancer, endometrial cancer, ovarian cancer, and gastric cancer. Due to this loss, cancer cells have a higher mutational burden, and deletions or insertions frequently occur in repetitive DNA regions; this phenomenon is known as microsatellite instability. Although progress has been made in the treatment of microsatellite highly unstable (MSI-H) cancers, and pembrolizumab (a PD-1 antibody) as first-line therapy has shown longer progression-free survival than chemotherapy in patients with advanced colorectal cancer exhibiting MSI-H / dMMR, leading to its approval for first-line treatment, there remains a clinical need for colorectal cancer and other MSI-H indications.

[0003] Large-scale functional genomics screening of multiple cell lines, including Novartis' analysis of 398 cell lines from the Cancer Cell Line Encyclopedia (CCLE) cell bank (McDonald E.R. et al., Project DRIVE: A Compendium of Cancer Dependencies and Synthetic Lethal Relationships Uncovered by Large-Scale, Deep RNAi Screening. Cell 170(3):577-592 (2017)), revealed that WRN (Werner syndrome protein) is essential for the survival of cell lines with microsatellite instability-high (MSI-H) due to loss of DNA mismatch function (Behan, FM et al. Prioritization of cancer therapeutic targets using CRISPR-Cas9 screens. Nature 568, 511-516 (2019); Chan, EM et al. WRN helicase is a synthetic lethal target in microsatellite unstable cancers. Nature 568, 551-556 (2019); Kategaya, L., Perumal, SK, Hager, JH & Belmont, L.D. Werner syndrome helicase is required for the survival of cancer cells with microsatellite instability. iScience 13, 488-497 (2019); Lieb, S. et al. Werner syndrome helicase is a selective vulnerability of microsatellite instability-high tumor cells. Elife 8, e43333 (2019)). WRN has a synthetic lethal relationship with MSI-H. In cancer cells lacking DNA mismatch repair function, the absence of WRN inhibits cell proliferation, activates multiple DNA damage biomarkers, and induces cell division arrest and apoptosis. However, for cancer cells with intact DNA mismatch repair function, the absence of WRN does not lead to this result.These findings demonstrate that WRN provides the DNA repair and maintenance functions essential for the survival of MSI-H cancer cells. Recently, the mechanism by which MSI-H cells depend on WRN has been clarified: the two-nucleotide TA repeat sequence is unstable only in MSI-H cells, capable of large-scale amplification, leading to atypical DNA secondary structures that require WRN unwinding (Van Wietmarschen, N. et al. Repeat expansions confer WRN dependency in microsatellite-unstable cancers. Nature 586, 292-298, 200.). In the absence of WRN (or with inhibited WRN unwinding function), the amplified TA repeat sequence in MSI-H cells is cleaved by nucleases, resulting in chromosome breakage. Therefore, inhibiting the helicase function of WRN is an attractive therapeutic strategy for cancer cells lacking DNA mismatch function.

[0004] Cancer still requires new treatments and therapies, especially those with microsatellite instability-high (MSI-H) or loss of DNA mismatch repair (dMMR), including colorectal cancer, gastric cancer, endometrial cancer, or ovarian cancer. Summary of the Invention

[0005] This invention provides compounds of formula (I) or pharmaceutically acceptable salts thereof:

[0006]

[0007] Where R1 is H or C 1-3 Alkyl group; R2 is OH or -NH-(CO)-C 1-3 alkyl.

[0008] In a more preferred embodiment, R1 is H or methyl; R2 is OH or -NH-(CO)-CH3.

[0009] The compound or its pharmaceutically acceptable salt described in this invention may be any of the following compounds:

[0010]

[0011] This invention also provides the use of the compounds shown above or pharmaceutically acceptable salts thereof in the preparation of WRN inhibitors. This use includes the use in the treatment of colorectal cancer, gastric cancer, endometrial cancer, or ovarian cancer.

[0012] The present invention also provides a pharmaceutical composition comprising the compound shown above or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

[0013] As described herein, the term "pharmaceutically acceptable salt" refers to a pharmaceutically acceptable organic or inorganic salt of the compounds of the present invention. Detailed Implementation

[0014] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0015] Example 1 EVO32781

[0016]

[0017] Step 1:

[0018] Sodium 3-carboxybenzenesulfonate (326.87 mg, 1.46 mmol), N,N-dimethylformamide (6 mL), HATU (655.24 mg, 1.72 mmol), N,N-diisopropylethylamine (513.97 mg, 3.98 mmol, 692.68 μL), and 2-BOC-2,7-diaza-spiro[4.4]nonane (300.00 mg, 1.33 mmol) were added to the reaction flask. The reaction mixture was stirred at room temperature for 3 hours under argon protection. LC-MS showed that a product was formed, indicating that the starting materials reacted completely. The reaction mixture was quenched with water (1 mL). The residue was directly purified by reverse-phase column chromatography (water (containing 0.1% formic acid) / acetonitrile system) and concentrated to give a yellow bubbly solid EVO32781-A1 (500.00 mg, yield 91.89%). LCMS(ESI)m / z=409.1[MH] - .

[0019] Step 2:

[0020] EVO32781-A1 (500.00 mg, 1.22 mmol), dichloromethane (6 mL), and trifluoroacetic acid (2.98 g, 26.14 mmol, 2 mL) were added to the reaction flask, and the reaction mixture was stirred at room temperature for 2 hours. LC-MS showed product formation, indicating complete reaction of the starting materials. The reaction mixture was concentrated under reduced pressure, and the residue was added to dichloromethane (20 mL) and concentrated again. This operation was repeated three times to obtain a yellow oily substance, EVO32781-A2 (400.00 mg). The product was used directly in the next step without further separation. LC-MS (ESI) m / z = 409.1 [MH] - .

[0021] Step 3:

[0022] EVO32781-A2 (400.00 mg, crude), dichloromethane (5 mL), and N,N-diisopropylethylamine (832.83 mg, 6.44 mmol, 1.12 mL) were added dropwise to a reaction flask. Acryloyl chloride (128.31 mg, 1.42 mmol) in dichloromethane (1 mL) was added dropwise under an ice-water bath. The reaction mixture was stirred at room temperature for 2 hours. LC-MS showed product formation, indicating complete reaction of the starting materials. The reaction solution was directly purified by preparative high-performance liquid chromatography to obtain a pale yellow solid EVO32781 (5.00 mg, yield 1.06%). LC-MS (ESI) m / z = 363.3 [MH] - . 1 HNMR(400MHz,DMSO-d6)δ7.79-7.62(m,2H),7.54-7.35(m,2H),6.65-6.44(m,1H),6.19- 6.03(m,1H),5.71-5.57(m,1H),3.71-3.50(m,4H),3.42-3.24(m,4H),2.11-1.75(m,4H).

[0023] Example 2 EVO32853

[0024]

[0025] Step 1:

[0026] At room temperature, EVO32845-A0 (2.5 g, 10.91 mmol), benzyl mercaptan (1.63 g, 13.10 mmol), Pd2(dba)3 (699 mg, 0.76 mmol), XantPhos (947 mg, 1.64 mmol), DIPEA (4.23 g, 32.74 mmol), and 1,4-dioxane (25 mL) were added sequentially to a single-necked flask. The reaction mixture was purged three times with argon gas and then heated to 100 °C with stirring overnight. After the reaction was complete, the mixture was cooled to room temperature, filtered, and the filter cake was washed with DCM. The filtrate was concentrated to obtain a crude product, which was purified by medium-pressure normal-phase column chromatography (PE / EA = 0-6%) to give EVO32845-A1 (2.5 g) as a pale yellow oil. LCMS (ESI) m / z = 273.2 [M+H] + .

[0027] Step 2:

[0028] At 0°C, EVO32845-A1 (1.5 g, 5.51 mmol) was dissolved in CH3CN / H2O / HOAc (20 mL, 200 / 5 / 2.5), followed by the addition of dichlorohydantoin (1.63 g, 8.26 mmol). The reaction mixture was stirred at 0°C for 1 hour. The reaction mixture was then concentrated to obtain crude EVO32845-A2 (1.7 g), a pale yellow solid.

[0029] LCMS(ESI)m / z=229.2[MH] - .

[0030] Step 3:

[0031] At 0°C, 1.7 g (6.84 mmol) of EVO32845-A2 was dissolved in 20 mL of THF, followed by the addition of 10 mL of ammonia. The reaction mixture was stirred at 0°C for 1–2 hours. The mixture was then diluted with water and extracted twice with ethyl acetate. The combined organic phases were concentrated to obtain a crude product, which was then pulped with PE / EA (5 / 1), filtered, and the filter cake was dried to obtain 1 g (1 g) of white solid EVO32845-A3. LCMS (ESI) m / z = 230.2

[0032] [M+H] + .

[0033] Step 4:

[0034] At 0 °C, EVO32845-A3 (1 g, 4.36 mmol) and TEA (1.32 g, 13.09 mmol) were dissolved in THF (15 mL), and then acetyl chloride (514 mg, 6.54 mmol) was added. The reaction system was stirred overnight at room temperature. After the reaction was completed, the crude product was directly concentrated and purified by medium-pressure normal-phase column chromatography (DCM / 10% MeOH = 0-15%) to obtain EVO32845-A4 (0.8 g) as a pale yellow solid.

[0035] LCMS(ESI)m / z=270.3[MH] - .

[0036] Step 5:

[0037] At room temperature, 150 mg (0.55 mmol) of EVO32845-A4 was dissolved in 6 mL of THF and 2 mL of H2O, followed by the addition of 70 mg (1.66 mmol) of LiOH·H2O. The reaction mixture was stirred overnight at room temperature. The pH of the reaction mixture was adjusted to 3-5 with 1 M HCl, and the solution was concentrated to obtain a crude EVO32845-A5 (160 mg) pale yellow solid. LCMS (ESI) m / z = 256.1 [MH] - .

[0038] Step 6:

[0039] At room temperature, EVO32845-A5 (80 mg, 0.31 mmol) was dissolved in DMF (3 mL), and then HATU (177 mg, 0.47 mmol) was added. The reaction mixture was stirred at room temperature for 5-10 minutes, followed by the addition of EVO32853-A0 (70 mg, 0.31 mmol) in DMF (1 mL) and TEA (94 mg, 0.93 mmol). The reaction mixture was stirred at room temperature for another hour. The reaction mixture was then purified directly by medium-pressure reversed-phase column chromatography (0.1% HCOOH in H2O / CH3CN = 5%-65%), followed by lyophilization to obtain EVO32853-A1 (100 mg) as a white solid. LCMS (ESI) m / z = 464.4 [MH] - .

[0040] Step 7:

[0041] At room temperature, 100 mg (0.21 mmol) of EVO32853-A1 was dissolved in 5 mL of DCM, followed by the addition of 2 mL of TFA. The reaction mixture was stirred at room temperature for 1 hour. The reaction mixture was then concentrated to obtain a crude EVO32853-A2 (100 mg) pale yellow oil. LCMS (ESI) m / z = 366.3 [M+H] + .

[0042] Step 8:

[0043] At 0 °C, EVO32853-A2 (100 mg, 0.27 mmol) and TEA (111 mg, 1.09 mmol) were dissolved in THF (5 mL), followed by the addition of acryloyl chloride (37 mg, 0.41 mmol). The reaction mixture was stirred at room temperature for 3–4 hours. After concentration, the mixture was prepared by prep-HPLC (acidic preparation) to obtain an impure crude product, which was then purified by prep-TLC (DCM / MeOH = 15 / 1) and lyophilized to obtain EVO32853 (14 mg, yield: 12.20%) as a white solid. LCMS (ESI) m / z = 420.2 [M+H] + HPLC: 97.6%. 1 H NMR(400MHz,DMSO-d6)δ7.70-7.61(m,2H),7.45-7.38(m,1H),6.62-6.48(m,1H),6.17-6.05(m,1H) ,5.69-5.60(m,1H),3.68-3.37(m,8H),2.36(d,J=4.0Hz,3H),2.04-1.78(m,4H),1.70-1.68(m,3H).

[0044] Biological Effects Examples

[0045] Protein expression and purification of WRN truncated variant

[0046] Constructing expression carriers:

[0047] 1. Synthesized cDNA sequence encoding WRN (N517-Q1093) (Genscript Biotech)

[0048] Corporation), so that the N-terminus has an 8xHis tag-Strep-TEV cleavage site, constructing

[0049] The pFastBac1 vector (YouBio, catalog number) was inserted at the BamHI and EcoRI sites, yielding...

[0050] The recombinant plasmid pFastBac1-8His-Strep-TEV-WRN(N517-Q1093) was obtained.

[0051] 2. Take 50 μL of DH10Bac competent cells (biomed, #BC112-01) and thaw them slowly on ice. Add 1 μL of pFastBac1-8His-Strep-TEV-WRN (N517-Q1093) recombinant plasmid, incubate on ice for 30 minutes, then incubate in a 42°C water bath for 45 seconds, and then incubate on ice for 2 minutes.

[0052] 3. Add 450 μL of SOC medium (2% Tryptone (OXOID, #LP0042), 0.5% Yeast Extract (OXIOD, #LP0021), 0.58% NaCl (Hushi, #10019360), 0.019% KCl (Hushi, 1002792168398), 0.203% MgCl2·6H2O (Hushi, 10012828), 0.246% MgSO4·7H2O (Hushi, 10013016), 0.36% Glucose (Biodee, #DE0149-500g)), and incubate at 220 rpm and 37℃ for 4 hours in a horizontal shaker.

[0053] 4. Dilute the cell suspension 10-fold with SOC medium, then spread 50 μL onto an agarose plate (containing 1% Tryptone, 0.5% Yeast Extract, 1% NaCl, and 1.5% Agar (BioFroxx).

[0054] #8211GR500), 50 μg / mL Kanamycin (Solarbio, #K8020-5g), 7 μg / mL Gentamycin (Solarbio, G8170-1g), 10 μg / mL Tetracycline (Solarbio, #T8180-5g), 40 μg / mL X-gal (Solarbio, #8050-1g) and 40 μg / mL IPTG (lnalco, #1758-1400) were grown at 37℃ in the dark for 48 h;

[0055] 5. Select two single colonies and place them in 5 mL of SOC medium, then incubate overnight at 37°C and 250 rpm.

[0056] Extraction of recombinant Bacmid:

[0057] 1. Take 1.5 mL of bacterial culture medium into an EP tube (Axygen, #MCT-200-CS) and centrifuge at 13300 rpm for 1 minute;

[0058] 2. Remove the supernatant and extract recombinant Bacmid using a plasmid extraction kit (Qiagen#DP103-03).

[0059] Following the kit instructions, transfer the supernatant after centrifugation to a new tube and add 750 μL of [unclear - possibly a specific liquid or solution].

[0060] Mix isopropanol (Greagent, #G75885B) gently a few times and let stand on ice for 10 minutes.

[0061] 3.13, centrifuge at 300 rpm for 15 minutes;

[0062] 4. Remove the supernatant, add 500 μL of 70% ethanol (Greagent, catalog number 1101143), invert the EP tube 8 times to clean the precipitate, and centrifuge at 300 rpm for 5 minutes.

[0063] 5. Remove the supernatant and add 500 μL of autoclaved 70% ethanol in a sterile environment in a laminar flow hood;

[0064] 6. Repeat steps 8 and 9;

[0065] 7. Remove as much supernatant as possible, centrifuge at 13,300 rpm for 2 minutes;

[0066] 8. Air dry the precipitate for 5 minutes, then dissolve it in 40 μL of autoclaved TE buffer;

[0067] 9. Nanodrop determination of recombinant Bacmid concentration;

[0068] Insect cell transfection:

[0069] 1. Sf-900TMII SFM media (Gibco#10902088) diluted Sf9 cells (Gibco,

[0070] #11496015) to 1×10 6 cells / mL, take 3mL into a 25mL culture flask;

[0071] 2. Take 15 μg of recombinant Bacmid and add 100 μL of Grace's Insect Medium (Gibco,

[0072] #11605094), then add 7 μL of X-treme transfection reagent (Roche).

[0073] #6366236001), incubate at room temperature for 15-20 minutes.

[0074] 3. Transfer the incubation product to a culture flask containing Sf9 cell culture medium and incubate at 27°C and 100 rpm for 4 days;

[0075] Collecting P0 viruses:

[0076] 4. Four days after transfection, observe the cell status and prepare to collect the virus;

[0077] 5. First, add serum (final concentration 2%, Sijiqing #11011-8611), and centrifuge at 3200 rpm for 5 minutes at 4℃;

[0078] 6. Collect the supernatant and store it at 4℃, labeling it as P0 virus;

[0079] P1 virus preparation:

[0080] 7. Take 1 mL of P0 virus and add it to 50 mL of Sf9 cell culture medium (cell density 1.5-1.8 × 10⁶ cells / mL). 6

[0081] (cells / mL), cultured at 27℃ and 100 rpm for 3 days;

[0082] 8. After culturing for 3 days, check the cell status and prepare to collect the cells;

[0083] 9. Add serum (final concentration 2%), centrifuge at 3500 rpm for 5 minutes at 4°C;

[0084] 10. Collect the supernatant and store it at 4℃, labeling it as P1 virus;

[0085] P2 virus preparation:

[0086] 11. Take 4 mL of P1 virus and add it to 200 mL of Sf9 cell culture medium (cell density 1.5-1.8 × 10⁻⁶).

[0087] 10 6 (cells / mL), cultured at 27℃ and 100 rpm for 3 days;

[0088] 12. After culturing for 3 days, check the cell status and prepare to collect the cells;

[0089] 13. Add serum (final concentration 2%), centrifuge at 3500 rpm for 5 minutes at 4°C;

[0090] 14. Collect the supernatant and store it at 4℃, and label it as P2 virus.

[0091] Protein expression and purification:

[0092] 15.6 bottles of 800mL Sf9 cell culture medium (2×10⁶) 6 12.8 mL of P2 virus was added to each of the cells / mL, and the cells were incubated at 27°C and 100 rpm for 48 h.

[0093] Centrifuge at 16.4℃ and 8000 rpm for 10 minutes, then collect the cells;

[0094] 17. Use 800 mL of cell lysis buffer (50 mM Tris-HCl pH 7.5, 500 mM NaCl, 5%).

[0095] Cells were resuspended in glycerol, 0.5 mM TCEP, 1 mM PMSF, and 5 mM MgCl2, and one tablet of cOmplete™ protein inhibitor (Roche #11697498001) was added.

[0096] 18. Cells were disrupted under high pressure (Nanjing Naton Electromechanical Manufacturing Co., Ltd., model NT-H3, working pressure 650 bar), repeated 4 times, followed by centrifugation at 16000 rpm for 60 minutes at 4°C. The supernatant was collected for affinity chromatography.

[0097] 1) Through Strep- XT affinity column (5 mL, IBA lifesciences#2-5027-001), with 50

[0098] mM HEPES pH 7.5, 500mM NaCl, 5% glycerol, 0.5mM TCEP, 1mM

[0099] Elution was performed using PMSF and 75mM Biotin buffer.

[0100] 2) Add 6His-GST-Thrombin-TEV protease to the elution product and digest overnight at 4°C;

[0101] 3) The enzyme digestion products were subjected to ion exchange using HiTrap Heparin HP (5 mL, GE Healthcare #17-0406-01);

[0102] 4) Remove residual protease by passing through a GST column;

[0103] 5) Purification molecular size exclusion chromatography was performed using HiLoad 16 / 600 Superdex 200pg (GE Healthcare #28-9893-35) at a flow rate of 1mL / min;

[0104] 19. SDS-PAGE is used to determine protein purity, which must be greater than 99%. The protein is frozen at -80°C for subsequent enzyme activity testing.

[0105] Detection of the inhibitory effect of the compound on WRN truncated ATPase activity

[0106] ADP-Glo TM The kinase assay kit (Promega#V9101) is a chemiluminescent ADP detection method with advantages such as high versatility, good uniformity, and high-throughput screening. It can be used to detect the activity of ADP-producing enzymes (such as ATPase). The assay is performed in two steps: first, after the kinase reaction, ADP-Glo ​​is added... TM The reagent terminates the kinase reaction and consumes the remaining ATP; then, a kinase detection reagent is added to convert ADP to ATP, and the newly synthesized ATP is measured by a luciferase / luciferin reaction, with the chemiluminescence signal detected by a photometer. The light signal is positively correlated with the ADP concentration, thus allowing the determination of the inhibition of WRNATPase activity by different concentrations of the compound, thereby fitting a concentration-effect curve and calculating the compound's IC50. The specific operating steps are as follows:

[0107] The buffer solutions used in this experiment were 25 mM HEPES (Gibco#15630-080), 5 mM NaCl (Sigma#59222C-100 mL), 0.01% F-127 (Sigma#P2443), 1 mM MgCl2 (Sigma#M1028-100 mL), and 1 mM TCEP (Sigma#646547).

[0108] 1. The compound was dissolved in DMSO to prepare a 10 mM stock solution. The compound was then serially diluted 3-fold to eight concentration points. 3 μL of each solution was added to a PerkinElmer 384-well plate.

[0109] #6008280). Add 3 μL of 5% DMSO to each of the High Control and Low Control wells.

[0110] 2. Add 6 μL of 5 nM WRN cutoff solution to each well and incubate with the compound at room temperature for 10 minutes.

[0111] 3. Add 6 μL of a mixture of ATP and DNA duplex fork (2.5 mM ATP, 25 nM) to each well.

[0112] DNA was prepared into a 15 μL reaction system and reacted at room temperature for 60 minutes.

[0113] 4. Take 5 μL of the reaction mixture from each well and add 5 μL of ADP-Glo ​​reagent stop solution (ADP-Glo) to each well. TM Incubate the kinase kit in a 384-well plate (well 2) at room temperature for 50 minutes to terminate the reaction.

[0114] 5. Take 5 μL of ADP (ADP-Glo) TM The kinase kit was supplemented with 5 μL of ADP-Glo ​​reagent (ADP-Glo). TM In the wells of the kinase kit (standard control wells);

[0115] 6. Add 10 μL of Kinase Detection Reagent (ADP-Glo) to all wells. TM The kinase kit was incubated at room temperature for 40 minutes. The light signal values ​​were read using a SpectraMaxi3x.

[0116] 7. Data Analysis: The pore inhibition rate (Inhibition%) of the compound is calculated as (avg High Control - Cpd well) / (avg High Control - Low Control) * 100%. Using GraphPad Prism 9.0 software, a four-parameter fitting equation was used to plot the concentration-effect curve and calculate the IC50. 50 value.

[0117] Detection of the inhibitory effect of the compound on the unwinding activity of WRN truncated DNA

[0118] Experimental Principle: Two incompletely paired single-stranded DNA fragments, one with a quenching group and the other with a fluorescent group, anneal to form a DNA duplex fork structure. WRN can unwind this DNA duplex fork into single-stranded DNA, allowing the detection of single-stranded DNA levels via fluorescence signal to evaluate the helicase activity of the WRN. The specific experimental steps are as follows:

[0119] The buffer solution used in this experiment has the same formulation as the buffer solution used in the ATPase enzyme activity experiment.

[0120] 1. Synthesis of a single-stranded DNA fragment (quenched single-stranded DNA of SEQ ID NO:1):

[0121] TTTTTTTTTTTTTTTTCGTACCCGATGTGTTCGTTC, SEQ ID NO:2 fluorescent single-stranded DNA: GAACGAACACATCGGGTACGTTTTTTTT, synthesized by Sangon Biotech (Shanghai) Co., Ltd., purified by HPLC), enzyme-free water (Invitrogen).

[0122] #10977015) Dissolve primers to 100 μM;

[0123] 2. Dilute the single-stranded DNA fragment to 20 μM with 500 mM NaCl solution (final NaCl concentration 50 μM).

[0124] Add enzyme-free water to make up the volume. Mix equal amounts of single-stranded DNA fragments (10 μM) and place in...

[0125] In the PCR instrument (BIORAD#C1000 Touch), the program was set to: 95℃ for 5 minutes, 25℃ for 1 minute.

[0126] Annealing of single-stranded DNA was performed at 4°C for 30 minutes (Ramp: 0.1°C / s) to obtain DNA.

[0127] duplex fork;

[0128] 3. Transfer 20 μL of 30 nM fluorescent single-stranded DNA fragment and 20 μL of 30 nM DNA duplex fork to 384 wells (Corning #4514), respectively. Detect the fluorescence signal using a microplate reader: excitation wavelength 520 nm, emission wavelength 590 nm. Calculate the annealing efficiency based on the corresponding fluorescence signals: (DNA duplex fork / ...

[0129] (Single-stranded DNA) × 100%, annealing efficiency must be > 90%;

[0130] 4. The compound was dissolved in DMSO to prepare a 10 mM stock solution. The compound was then serially diluted 3-fold to a total of 10 concentration points (7.5 × compound detection concentration, 7.5% DMSO).

[0131] 5. Add 2 μL of the compound solution to a 384-well plate. Add 2 μL of 7.5% DMSO to each of the High Control and Low Control wells.

[0132] 6. Add 5 μL of 6 nM WRN cutoff solution to each well, centrifuge at 1000 rpm for 1 minute, and incubate at room temperature for 30 minutes;

[0133] 7. Add 8 μL of a mixture of DNA duplex fork and ATP (18.75 nM DNA, 5.63 mM ATP) to each well, centrifuge at 1000 rpm for 1 minute, and react at room temperature for 20 minutes.

[0134] 8. Add 4 μL of 1.625% SDS solution (Sigma#75746-250G) to each well to terminate the reaction;

[0135] 9. Use a fluorescence microplate reader (MD SpectraMax i3x) to read the excitation wavelength (520nm) and emission wavelength (590nm).

[0136] fluorescence signal intensity at nm;

[0137] 10. Data Analysis: Compound Pore Inhibition Rate (Inhibition%) = (avg High Control - Cpdwell) /

[0138] (avg High Control - Low Control)*100%, using GraphPad Prism 9.0 software, a four-parameter fitting equation was used to plot the concentration-effect curve and calculate the IC50. 50 The values ​​and results are as follows: Where A represents IC 50 ≤100nM; B indicates 100nM < IC 50 ≤1000nM; C indicates 1000nM < IC 50 ≤10000nM; "-" indicates untested.

Claims

1. A compound of formula (I) or a pharmaceutically acceptable salt thereof: in, R1 is H or C 1-3 Alkyl group; R2 is OH or -NH-(CO)-C 1-3 alkyl.

2. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein R1 is H or methyl.

3. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein R2 is OH or -NH-(CO)-CH3.

4. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein the compound is any one of the following:

5. A pharmaceutical composition, characterized in that, It comprises the compound as claimed in claim 1 or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

6. Use of the compound of any one of claims 1-4 or a pharmaceutically acceptable salt thereof or the pharmaceutical composition of claim 5 in the preparation of a WRN inhibitor.