Method for detecting specific site 5-hydroxymethylated cytosine

Abstract

The invention provides a method for detecting 5-hydroxymethylated cytosine (5-hydroxymethylated cytosine, 5hmC) at a specific site, and particularly provides a method for detecting 5-hydroxymethylated cytosine (5-hydroxymethylated cytosine, 5hmC) at a specific site of 5-hydroxymethylated cytosine (5-hydroxymethylated cytosine, 5hmC). According to the method, an electrochemical biosensing platform is utilized, a semi-labeled primer is designed and specifically amplified to generate hybrid double-stranded DNA, and the double-labeled double-stranded DNA can be captured and generate a current signal. The T7 endonuclease I can recognize and cut A-C mismatch in DNA hybridization generated after oxidation and hydrosulphite treatment and hydrosulphite treatment, thereby causing reduction of current signals. The change of the current signal is positively correlated with the content of 5hmC. The kit has high sensitivity, and can detect 10pg of hydroxymethylated DNA in the presence of 100,000 times of methylated DNA or unmethylated DNA; the detection period is short and can be completed within 24 hours, and the single-base resolution ratio is achieved.

Description

Technical Field

[0001] The invention relates to the field of electrochemical biosensing, and in particular to a method for detecting 5-hydroxymethylated cytosine at a specific site. Background Art

[0002] 5-Hydroxymethylcytosine (5hmC) is the hydroxymethylated form of 5-methylcytosine (5mC) and was first discovered in bacteriophages in 1952. In 2009, two independent research teams confirmed the existence of 5hmC in mouse brain cells and stem cells, which triggered widespread attention and research on 5hmC in the scientific community. Studies have found that the conversion of 5mC to 5hmC is catalyzed by the 10-11 translocation (Ten-eleven Translocation, TET) family protein in the presence of Fe2+ and ketoglutarate. Further studies have shown that 5hmC at specific sites is not only closely related to cell differentiation, but also to the occurrence and development of a variety of solid tumors. In addition, the study of 5hmC in specific gene fragments provides a new perspective for this application to gain a deeper understanding of the gene expression mechanism. It has been found that 5hmC shows significant changes in diseases such as myelodysplastic syndrome, Huntington's disease and Alzheimer's disease, and the reduction of 5hmC content has been regarded as an important hallmark feature of cancer diagnosis and treatment.

[0003] At present, the detection methods of 5hmC can be divided into three categories according to the different genomic resolutions. The first method includes thin layer chromatography, high performance liquid chromatography and liquid chromatography-mass spectrometry, which can detect the overall level of 5hmC in the whole genome, but can only reflect large-scale changes in 5hmC. The second method is based on DNA immunoprecipitation technology, using 5hmC-specific antibodies or antibodies to modified 5hmC to measure the enrichment of 5hmC at specific sites, but these methods cannot quantify the 5hmC content of a single CpG site, so they cannot be used to study the effects of environmental factors on 5hmC at a specific CpG site. The third method is single-base resolution detection technology, which can quantify 5hmC at a single CpG site in the genome, thereby providing more biological information. For example, these differently hydroxymethylated CpG sites can be annotated to genes, providing important information for subsequent pathway analysis and mechanism research.

[0004] Currently, the most widely used single-base level 5hmC measurement methods are bisulfite sequencing and its derivative methods, including TET-assisted bisulfite sequencing and oxidation + bisulfite sequencing. Although these sequencing-based methods have excellent performance, they are complex to operate and time-consuming (usually at least two weeks). Therefore, there is an urgent need for a simple, time-saving and efficient detection method to detect 5-hydroxymethylated cytosine at specific sites of specific genes. Summary of the invention

[0005] The existing 5-hydroxymethylated cytosine detection methods in the prior art are complex to operate, time-consuming and generally cannot target specific sites. In view of the shortcomings of these detection methods, the present application provides a method for detecting 5-hydroxymethylated cytosine at specific sites, which is simple, rapid and highly sensitive.

[0006] The method provided by the present invention is based on a double-stranded DNA model containing unmethylated, methylated and hydroxymethylated DNA constructed in vitro. First, the double-stranded DNA model is treated with CpG methyltransferase to distinguish hydroxymethylated DNA from the other two base types of DNA (methylated DNA and unmethylated DNA); then, double-labeled double-stranded DNA is obtained and captured as a current signal by sulfite treatment and oxidation + sulfite treatment, semi-labeled primer specific amplification and double-stranded DNA hybridization; finally, AC mismatch caused by 5-hydroxymethylated cytosine is recognized and cut by T7 endonuclease I, and the decrease in the current signal is observed to indicate the presence of 5-hydroxymethylated cytosine in the sample. The method can detect the content of 5-hydroxymethylated cytosine in double-stranded DNA in real time, has high sensitivity and accuracy, and single base resolution, and can still detect 10pg of hydroxymethylated DNA in the presence of 100,000 times excess methylated or unmethylated DNA.

[0007] In order to achieve the above objectives, the present invention provides the following technical solutions:

[0008] The technical solution of the present invention provides a method for detecting 5-hydroxymethylated cytosine at a specific site, comprising the following steps:

[0009] S1 prepares the double-stranded DNA sample to be tested and treats the double-stranded DNA with CpG methyltransferase;

[0010] S2 divides the double-stranded DNA treated by S1 into two parts, which are respectively recorded as DNA-A and DNA-B; wherein DNA-A is treated with bisulfite; DNA-B is first oxidized with an oxidant and then treated with bisulfite;

[0011] S3 designs semi-labeled primers, uses biotin-labeled primers to specifically amplify DNA-A obtained after S2 treatment, and uses digoxigenin-labeled primers to specifically amplify DNA-B obtained after S2 treatment;

[0012] S4 performs DNA hybridization on the two differently labeled double-stranded DNAs obtained in S3 to obtain hybrid double-stranded DNA;

[0013] S5 uses an electrochemical biosensing platform to detect the above hybrid double-stranded DNA, in which the double-labeled double-stranded DNA can be captured and generate a current signal;

[0014] S6 uses a base mismatch recognition and cleavage enzyme to recognize and cleave the AC mismatch caused by 5hmC. If the current signal is lower than the current signal in step S5, it means that the DNA to be tested contains 5-hydroxymethylated cytosine; if the current signal does not decrease, it means that the DNA to be tested does not contain 5-hydroxymethylated cytosine.

[0015] Furthermore, the double-stranded DNA sample described in S1 is obtained from the cells to be tested by extracting and amplifying the DNA of the cells to be tested, and the obtained double-stranded DNA is treated with CpG methyltransferase to distinguish hydroxymethylated DNA from non-hydroxymethylated DNA;

[0016] Furthermore, the DNA extraction and amplification are performed according to conventional operations in the art, the primers required for amplification are designed according to the cells to be tested, and the template is the DNA sequence of the fragment to be tested; the CpG methyltransferase treatment uses a kit and is performed according to the steps indicated in the instructions of the kit. After treatment, C is converted into 5mC, while 5mC and 5hmC remain unchanged.

[0017] Furthermore, in step S1, after the CpG methyltransferase treatment, the DNA needs to be purified to remove impurities therein, and the impurities include CpG methyltransferase, methyltransferase reaction solution, and S-adenosylmethionine (SAM); the purification operation is a conventional operation in the field, generally a purification kit is used for purification, and the steps shown in the kit are followed; alcohol needs to be completely removed during the purification process, and the method for removing alcohol is to volatilize the alcohol at room temperature for more than 1 hour, in order to eliminate the influence of alcohol on the subsequent oxidation treatment step.

[0018] Furthermore, after equal division in step S2, 1 μg of DNA-A and 1 μg of DNA-B were placed in 1.5 mL EP tubes respectively to ensure the consistency of total mass.

[0019] Furthermore, the oxidant in step S2 is KRuO4, and the concentration is 0.3-1.2 mM, preferably 0.9 mM; the ratio of the oxidant KRuO4 to DNA-B is 2 μL:1 μg, and the oxidant is added twice.

[0020] Furthermore, the bisulfite in step S2 is preferably sodium bisulfite;

[0021] The bisulfite treatment step can be performed using a DNA bisulfite conversion kit commonly used in the art and according to the steps described in the kit, or according to conventional bisulfite treatment steps in the art;

[0022] Furthermore, the semi-labeled primers described in step S3 refer to labeling the 5' ends of the primers of DNA-A and DNA-B with biotin and digoxigenin respectively; the sequence of the primers is designed according to the sequence of the DNA to be tested; the primer construction method and biotin and digoxigenin labeling adopt the methods commonly used by those skilled in the art;

[0023] The specific amplification operation is performed according to the PCR amplification operation commonly used in the art. The specific amplification system (50 μL) is: upstream primer: 2.5 μL (10 pmol), downstream primer: 2.5 μL (10 pmol), High-Fidelity 2XMaster Mix: 25μL, Template DNA: 10ng, MiliQ: to 50μL;

[0024] The amplification reaction conditions were pre-denaturation at 98°C for 3 min, denaturation at 98°C for 10 s, annealing at 60°C for 30 s, annealing and extension at 72°C for 30 s, extension at 72°C for 5 min after the cycle, 4°C+∞, and 30 cycles; the template chain sequences of DNA-A and DNA-B were the same.

[0025] During the bisulfite treatment of DNA-A and subsequent specific amplification, both 5mC and 5hmC are read as C, and the DNA strand containing C is labeled with biotin;

[0026] During the above-mentioned oxidation + bisulfite treatment of DNA-B and subsequent specific amplification, 5mC is read as C, 5hmC is first oxidized to 5fC, then converted to U and read as T, and then the DNA strand containing C or T is labeled with digoxigenin after PCR amplification.

[0027] Furthermore, the DNA hybridization described in step S4 is a conventional operation in the art, and the obtained hybrid double-stranded DNA has 9 types, including:

[0028] biotin-CG-digoxin, biotin-CA-digoxin, biotin-CG, CG-digoxin, CG, CA-digoxin, TG, TG-digoxin, and TA-digoxin;

[0029] Among them, all biotin C and unmodified G single strands in the hybrid double-stranded DNA come from DNA-A, and the other single strands come from DNA-B; in particular, biotin-CA-digoxigenin is a mismatched DNA caused by 5hmC; only two double-labeled double-stranded DNAs (biotin-CG-digoxigenin and biotin-CA-digoxigenin) can be captured on the biosensor electrode and show current signals after adding streptavidin-horseradish peroxidase (SA-HRP) and TMB (3,3',5,5'-tetramethylbenzidine).

[0030] Furthermore, the double-labeled double-stranded DNA in step S5 includes the above-mentioned biotin CG digoxin and biotin CA digoxin, which are specifically bound to the electrode through the digoxin-digoxin antibody, and the biotin is combined with horseradish peroxidase-coupled streptavidin, wherein the horseradish peroxidase catalyzes TMB (3,3',5,5'-tetramethylbenzidine) to generate a current signal.

[0031] Furthermore, the electrochemical biosensor platform in step S5 is composed of a 16-channel electrochemical tester and a 16-channel screen-printed electrode array, wherein each channel is composed of a three-electrode system; the three-electrode system includes a carbon working electrode, a carbon auxiliary electrode, and an Ag / AgCl reference electrode.

[0032] Further, the base mismatch recognition cleavage enzyme in step S6 can recognize and cleave AC mismatches; the base mismatch recognition cleavage enzyme is preferably T7 endonuclease I, thymine glycosylase, endonuclease V and Taq Muts, more preferably T7 endonuclease I; when T7 endonuclease I is used, the reaction temperature of the cleavage is 37 to 42°C, preferably 37°C, the reaction time is preferably 4 to 16 hours, and Mg is preferably Mg. 2+ The concentration is preferably 1 to 15 mM, more preferably 1 mM.

[0033] Furthermore, the specific parameters initially set when measuring on the electrochemical biosensor platform are as follows (used to define important parameters during measurement, such as voltage range, scan rate, number of scans, and sampling frequency): initial voltage (V): -0.3, maximum voltage (V): 0.6, minimum voltage (V): -0.3, start scanning direction: positive, scan rate (V / s): 0.1, number of scans: 2, sampling interval (V): 0.001, rest time (seconds): 2, sensitivity (A / V): 1e -5 .

[0034] Then the steady-state time-current curve method was used to determine the current value, and the parameters were set as follows: initial voltage (V): -0.05, time interval: 0.1, running time (seconds): 100, static time (seconds): 3, sensitivity (A / V): 1e -5 , and finally record the current value at 100 seconds.

[0035] Further, in step S6, if the current signal is lower than the current signal in step S5, the change value of the current signal is recorded as △Current;

[0036] △Current=593.98ln(X)+6538.8, the R of this formula is 2=0.9627, where X = 5hmC / C, i.e., the ratio of the concentration of 5-hydroxymethylated cytosine 5hmC to the concentration of cytosine C in the sample to be tested. The ratio X, i.e., the relative content of 5hmC in the sample to be tested, can be calculated according to the formula and △Current;

[0037] In addition, △Current=609.1ln(Y)+7274.8, the R 2 =0.9866, where Y = 5hmC / 5mC, i.e., the ratio of the concentration of 5-hydroxymethylated cytosine 5hmC to the concentration of 5-methylated cytosine 5mC in the sample to be tested. The ratio Y, i.e., the relative content of 5hmC in the sample to be tested, can be calculated according to the formula and △Current;

[0038] Finally, the content of 5-hydroxymethylated cytosine can be calculated based on the above two relative contents X, Y and the total mass of the sample to be tested.

[0039] Compared with the prior art, the present invention has at least the following beneficial effects:

[0040] (1) The technical solution of the present invention successfully constructed a method for detecting 5-hydroxymethylated cytosine, and used this method to achieve real-time quantification of 5hmC changes during the differentiation of umbilical cord mesenchymal stem cells;

[0041] (2) The method provided by the present invention overcomes the shortcomings of existing sequencing methods, which are labor-intensive and time-consuming, and provides a powerful tool for studying the role of 5hmC in early development and cell homeostasis, and is expected to further reveal the role of 5hmC in early development and cell homeostasis;

[0042] (3) The method provided by the present invention has high sensitivity and can detect 10 pg of hydroxymethylated DNA in the presence of 100,000 times methylated DNA or unmethylated DNA;

[0043] (4) The detection method of the present invention has a short detection cycle, can be completed within 24 hours, and has single-base resolution. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 A schematic diagram of the implementation of the present invention;

[0045] Figure 2 The effect of the present invention in an in vitro model is demonstrated; the marks in the figure indicate: (a) the response current at different 5hmC:C ratios, (b) the response current at different 5hmC:5mC ratios, (c) the sensitivity of 5hmC in a DNA chain containing 5mC, (d) the sensitivity of 5hmC in a DNA chain containing C;

[0046] Figure 3Optimization of key conditions for DNA purification, bisulfite treatment, and oxidation + bisulfite treatment;

[0047] Figure 4 To compare the effects of different base mismatch recognition and cleavage enzymes on different mismatch cleavages;

[0048] Figure 5 It is an optimized demonstration of the key conditions for T7 endonuclease I cleavage;

[0049] Figure 6 is the effect of temperature on T7 endonuclease I cleavage;

[0050] Figure 7 is the effect of time on T7 endonuclease I cleavage;

[0051] Figure 8 This is a real-time quantitative display of the present invention for detecting changes in 5hmC during the differentiation of umbilical cord mesenchymal stem cells. DETAILED DESCRIPTION

[0052] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention is described in detail below in conjunction with specific embodiments. It should be noted that the following embodiments will help those skilled in the art to further understand the present invention, but do not limit the present invention in any form. It should be noted that for those of ordinary skill in the art, several variations and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0053] Experimental Materials:

[0054] The plasmid pBR322 used in the examples was from Addgene, and the other DNA chains were synthesized and purified by Bioengineering (Shanghai) Co., Ltd.;

[0055] Anti-digoxigenin antibody, TMB substrate reagent (3,3',5,5'-tetramethylbenzidine), dhmCTP, dGTP, dATP, dGTP, and ZymoTaq TM DNA polymerases were purchased from Thermo Fisher;

[0056] TakaRa MiniBEST DNA Fragment Purification Kit Ver.4.0, WizardRPlus Minipreps DNA Purification System, and Illstra MicroSpin G-50Columns were purchased from Shanghai Yingjun Company;

[0057] SA-HRP (purchased from Roche, Mannheim, Germany), gel-red dye, 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC), N-hydroxysuccinimide sulfonic acid sodium salt (NHS), 1% casein, Taq TM Enzyme, Lambda exonuclease, VentR DNA enzyme, CpG methyltransferase (M.SssⅠ), T7 endonuclease I (M0320), TDG enzyme, endonuclease V, Taq Muts and HhaI enzyme were purchased from Sigma-Aldrich (St. Louis, MO).

[0058] The remaining materials, unless otherwise specified, are from commercial sources that are easily available to those skilled in the art.

[0059] Example 1 Construction of the detection process based on the in vitro DNA model

[0060] This example is based on a DNA model constructed in vitro and introduces a detection strategy based on a double parallel process, including: bisulfite and oxidant + bisulfite parallel treatment, semi-labeled primer DNA specific amplification and T7 nuclease I-mediated single base mismatch recognition biosensor ( Figure 1 ). Here are the detailed steps of this method:

[0061] Construction and methylation treatment of S1 DNA model

[0062] The DNA model includes three types of DNA: unmethylated DNA (C), methylated DNA (5mC) and hydroxymethylated DNA (5hmC). Unmethylated DNA was obtained by PCR amplification of a CG-containing sequence (sequence shown in SEQ ID NO.1) of the Escherichia coli plasmid pBR322; methylated DNA was obtained by CpG methyltransferase acting on the above PCR product; hydroxymethylated DNA was obtained by primer extension based on nitrogenous bases of d5hmCTP and dGTP, and then extended using normal dNTP; finally, all the obtained products were treated with CpG methyltransferase to distinguish hydroxymethylated DNA from non-hydroxymethylated DNA.

[0063] The constructed DNA model was methylated using CpG methyltransferase to convert C to 5mC, while 5mC and 5hmC remained unchanged. The treatment system was as follows: 1μg DNA sample, 1μL CpGmethyltransferase M.SssI (M0226L, New England Biolabs, USA), 5μL 10*methyltransferase reaction solution (500mM NaCl, 100mM Tris-HCl, 100mM MgCl2, 10mM DTT, pH 7.9), 5μL S-adenosylmethionine (SAM) (1600μM) were added to the 50μL reaction system, and finally nuclease-free water was used to fill up to 50μL. The reaction system was reacted at 37℃ for 1h, and then the reaction was terminated at 65℃ for 20min.

[0064] After the treatment is completed, the obtained DNA model mixture needs to be purified using a kit to remove impurities therein, including CpG methyltransferase, methyltransferase reaction solution, and S-adenosylmethionine (SAM). The steps are generally performed according to the steps indicated in the kit. The solvent of the purification kit contains alcohol, which will affect the subsequent oxidation treatment steps. Therefore, the alcohol needs to be completely removed during the process. The method for removing alcohol is to volatilize the mixture at room temperature for more than 1 hour. The purified DNA is used for subsequent experiments.

[0065] S2 Bisulfite Treatment and Oxidation + Bisulfite Treatment:

[0066] The methylated DNA of S1 was divided into two parts, respectively named DNA-A and DNA-B, and placed in clean 1.5 ml EP tubes; DNA-A was treated with bisulfite; DNA-B was first oxidized with the oxidant KRuO4 and then treated with bisulfite.

[0067] The specific steps of oxidation treatment with oxidant KRuO4 are as follows:

[0068] ① Add 1μg DNA-B to 0.05M NaOH (total volume 32μL), denature at 37℃ for 30min, then quickly cool on ice for 5min; then add 1μL KRuO4 solution (final concentration 0.5mM), react on ice for 1h; then add a second round of 1μL KRuO4 solution (final concentration 1mM), and continue to react on ice for 1h. ② Use QIAquick PCR Purification Kit to purify according to the operating instructions in the kit, and finally dissolve the obtained DNA-B product in 50μL MiliQ for use.

[0069] The specific steps of bisulfite treatment are carried out according to the instructions of the kit (Biyuntian D0068S), or according to the common bisulfite treatment steps in the art, refer to the following steps:

[0070] ① Denature 1 μg DNA-B (50 μL MiliQ) and 1 μg DNA-A (purified by QIAquick PCR Purification Kit and dissolved in 50 μL MiliQ) at 95°C for 20 min and denature at 45°C for 15 min under 0.3 mol / L NaOH. ② Add 520 μL of 3.6 mol / L sodium bisulfite solution (pH 5.0, containing hydroquinone at a final concentration of 10 mmol / L) and incubate at 55°C in the dark for 16 h. ③ After incubation, the DNA was desalted using Wizard Plus Minipreps DNA Purification System (Promega) and then dissolved in 50 μL 1 mmol / L Tris-HCl (pH 8.0). ④ Add 0.3 mol / L NaOH and perform desulfonation at 40°C for 15 min. ⑤ Neutralize with 50 μL 3 mol / L ammonium acetate and add 1 μL 20 mg / L glycogen; ⑥ After overnight precipitation in 70% ethanol, resuspend the DNA in 30 μL 1 mmol / L Tris-HCl (pH 8.0) for later use.

[0071] S3 DNA specific amplification:

[0072] Semi-labeled primers were designed, and the 5' ends of DNA-A and DNA-B primers were labeled with biotin and digoxigenin, respectively. The upstream and downstream primer sequences of DNA-A are shown in SEQ ID NO.2 and SEQ ID NO.3, and the upstream and downstream primer sequences of DNA-B are shown in SEQ ID NO.4 and SEQ ID NO.5. The DNA-A obtained by S2 was specifically amplified using the biotin-labeled primers, and the DNA-B was specifically amplified using the digoxigenin-labeled primers.

[0073] The specific amplification system (50 μL) is: upstream primer Fw: 2.5 μL (10 pmol), downstream primer Rv: 2.5 μL (10 pmol), High-Fidelity 2X Master Mix: 25μL, Template DNA: 10ng, MiliQ: to 50μL. The amplification reaction conditions are 98℃ pre-denaturation for 3min, 98℃ denaturation for 10s, 60℃ annealing for 30s, 72℃ annealing extension for 30s, 72℃ extension for 5min after the cycle, 4℃+∞, and the number of cycles is 30. The template strand sequences of DNA-A and DNA-B are the same, as shown in SEQ ID NO.6.

[0074] During the bisulfite treatment and subsequent specific amplification of the above-mentioned DNA-A, both 5mC and 5hmC are read as C, and the DNA chain containing C is labeled with biotin; during the oxidation + bisulfite treatment and subsequent specific amplification of the above-mentioned DNA-B, 5mC is read as C, 5hmC is first oxidized to 5fC, then converted to U and read as T, and then the DNA chain containing C or T is labeled with digoxigenin after PCR amplification.

[0075] Hybridization and signal recognition of S4 double-stranded DNA

[0076] The two groups of specifically amplified DNA obtained by S3 (i.e., DNA-A and DNA-B) were hybridized to obtain 9 types of hybrid double-stranded DNA, including biotin CG digoxin, biotin CA digoxin, biotin CG, CG digoxin, CG, CA digoxin, TG, TG digoxin, and TA digoxin. Among them, all biotin C and unmodified G single strands in the hybrid double-stranded DNA came from DNA-A, and the other single strands came from DNA-B. In particular, biotin CA digoxin was caused by 5hmC. Mismatched DNA; only two kinds of double-labeled double-stranded DNA (biotin CG digoxigenin and biotin CA digoxigenin) can be captured on the biosensor electrode and show current signals after adding streptavidin-horseradish peroxidase (SA-HRP); these two kinds of double-labeled double-stranded DNA are bound to the electrode through digoxigenin-digoxigenin antibody, and biotin is combined with horseradish peroxidase-coupled streptavidin, where horseradish peroxidase catalyzes TMB (3,3',5,5'-tetramethylbenzidine) to produce electrochemical signals.

[0077] The double-stranded DNA after hybridization was used for electrical signal detection on an electrochemical biosensor platform (Huasen New Technology (Suzhou) Nanotechnology Co., Ltd.). The detector parameters were set as follows: initial voltage (V): -0.3, maximum voltage (V): 0.6, minimum voltage (V): -0.3, start scanning direction: positive, scanning rate (V / s): 0.1, number of scans: 2, sampling interval (V): 0.001, static time (seconds): 2, sensitivity (A / V): 1e -5 .

[0078] Steady-state time current curve method parameters: initial voltage (V): -0.05, time interval: 0.1, running time (seconds): 100, static time (seconds): 3, sensitivity (A / V): 1e -5 , and finally record the current value at 100 seconds.

[0079] The electrochemical biosensor platform consists of a 16-channel electrochemical tester and a 16-channel screen-printed electrode array, wherein each channel consists of a three-electrode system; the three-electrode system includes a carbon working electrode, a carbon auxiliary electrode, and an Ag / AgCl reference electrode.

[0080] S5 mismatch recognition and signal detection

[0081] The introduction of T7 nuclease I recognizes and cuts mismatched DNA (biotin, CA, digoxigenin), resulting in a decrease in the current signal. Since AC mismatches originate from 5hmC, their number is positively correlated with the current difference ( Figure 2 ).

[0082] Figure 2 a represents the response current at different 5hmC:C ratios, Figure 2 b shows the response current at different 5hmC:5mC ratios, showing that the current intensity has a good correlation with the 5hmC concentration; Figure 2 c represents the sensitivity of 5hmC in the DNA strand containing 5mC, and the dashed line represents the blank plus 3 times the standard deviation. Figure 2 d represents the sensitivity of 5hmC in the C-containing DNA chain, the dotted line represents the blank plus 3 times the standard deviation, and the error bar represents the standard deviation of three independent measurements; it can be seen that the detection method provided by the present invention has a very high sensitivity.

[0083] In addition, Figure 2 a and Figure 2 In b, according to 5hmC / C and △Current, the standard curve △Current=593.98ln(X)+6538.8, R 2 =0.9627, where X = 5hmC / C; Based on 5hmC / 5mC and △Current, the standard curve △Current = 609.1ln(Y) + 7274.8, R 2 =0.9866, where Y = 5hmC / 5mC. In the practical application of this method, the above two formulas can be used as calculation formulas for determining the relative concentration of 5-hydroxymethylated cytosine in unknown samples.

[0084] Through the above steps, this embodiment provides an effective dual parallel process for accurately detecting and identifying single base mismatches in DNA, especially the presence and quantification of 5hmC.

[0085] Example 2 Optimization of key conditions in the oxidative bisulfite treatment process

[0086] The present invention establishes a method for judging the cleavage efficiency of HhaI enzyme and systematically explores the factors affecting the efficiency of oxidative bisulfite treatment ( Figure 3 ). In the figure, + represents the addition of this reagent, - represents the absence of this reagent, 1: the product is not cut, the darker the single band, the higher the oxidation efficiency; 2: the darker the band with a small product size, the higher the sulfite treatment efficiency.

[0087] The results show that the concentration of oxidant KRuO4 (reference Figure 3 The electrophoresis diagram on the lower left shows that the optimal concentration is 0.9 mM KRuO4), reaction pH (reference Figure 3 Upper left electrophoresis, pH = 9 is the best condition) and complete removal of alcohol before oxidation + bisulfite treatment (reference Figure 3 The electropherogram on the right is crucial.

[0088] Example 3 Optimization of key conditions for T7 endonuclease I cleavage

[0089] The present invention systematically studies the efficiency of different base mismatch recognition cleavage enzymes, including T7 endonuclease I, thymine glycosylase, endonuclease V and Taq Muts ( Figure 4 ), the results showed that T7 endonuclease I had the highest cleavage efficiency and was able to cleave both AC and GT mismatches, but had a higher cleavage efficiency for AC mismatches ( Figure 4 and Figure 5 b). Cutting efficiency is affected by reaction temperature ( Figure 6 ), reaction time( Figure 7 ) and Mg 2+ concentration( Figure 5 a) Effect, the results in the figure show that the optimal cutting conditions are 37°C, 4-16 hours and 1mM Mg 2+ .

[0090] Example 4 Dynamic Detection of 5hmC during Differentiation of Umbilical Cord Mesenchymal Stem Cells into Adipocytes

[0091] Based on the 5hmC detection method constructed and optimized in Examples 1 to 3, this example induces umbilical cord mesenchymal stem cells to differentiate into adipocytes, and dynamically detects the 5hmC content in the adipocytes during the process, verifying that the detection method provided by the present invention has high sensitivity and good correlation. This example mainly includes the following steps:

[0092] Step 1: Cell differentiation and harvesting

[0093] Mesenchymal stem cells were induced to differentiate into adipocytes, and 1×10 7 Positive cells were observed by Oil Red-O staining on the 7th day, and the number of adipocytes increased on the 14th day, confirming successful induction ( Figure 8 aTop figure).

[0094] Step 2: Genomic DNA extraction and PCR

[0095] The genomic DNA of the cells collected at the above time points was extracted and PCR amplified based on the IGF2BP1 promoter (the sequence of the IGF2BP1 promoter is shown in SEQ ID NO.7, and the upstream and downstream primer sequences are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively). The PCR amplification system (50 μL) was: upstream primer Fw: 2.5 μL (10 pmol), downstream primer Rv: 2.5 μL (10 pmol), High-Fidelity 2X Master Mix: 25 μL, Template DNA: 100 ng, MiliQ: to 50 μL. The PCR program was set as 98°C pre-denaturation for 3 min, 98°C denaturation for 10 s, 63°C annealing for 30 s, 72°C annealing extension for 20 s, 72°C extension for 5 min after the cycle, 4°C + ∞, and the number of cycles was 30.

[0096] Step 3: 5hmC detection

[0097] The PCR product in step 2 is treated with the detection method provided in this application ( Figure 8 a) and detected the changes in the current signal. The results showed that the current value increased on the 7th day and decreased on the 14th day, indicating that the quantitative change trend of 5hmC during the differentiation process was first increased and then decreased ( Figure 8 b). In addition, according to the standard curve fitted in Example 1, the relative concentration of 5-hydroxymethylated cytosine in the sample can be calculated according to ΔCurrent, and then the content of 5-hydroxymethylated cytosine can be calculated in combination with the total mass of the sample to be tested.

[0098] Step 4: DNA Sequencing

[0099] The amount of T measured after oxidation + bisulfite treatment reflects the amount of 5hmC, such as Figure 8 As shown in Figure 3, 5hmC was almost absent on the first day, reached the highest on the seventh day, and decreased on the 14th day. This example uses the biosensor strategy of the present invention to dynamically and quantitatively detect 5hmC, showing the change trend of the amount of 5hmC during differentiation ( Figure 8 ).

[0100] The above Examples 1 to 4 demonstrate the specific construction and optimization methods of the present invention and their effects in practical applications, and prove the effectiveness and high sensitivity of this strategy in the recognition of DNA single-base mismatches and the detection of dynamic changes of 5hmC during cell differentiation.

[0101] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

[0102] The sequence information involved in this application is as follows:

[0103] SEQ ID NO.1 (unmethylated DNA sequence in DNA model):

[0104] 5'-CCAGTGACGAAGGCTTGAGCGAGGGCGTGCAAGATTCCGAATACCG CAAGCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAGCGGTCCTCGCCGA AAATGACCCAGAGCGCTGCCGGCACCTGTCCTACGAGT-3'

[0105] SEQ ID NO.2 (sequence of upstream primer Fw of DNA-A in Example 1):

[0106] Biotin-CCAGTGACGAAGGCTTGAG

[0107] SEQ ID NO.3 (sequence of downstream primer Rv of DNA-A in Example 1):

[0108] ACTCGTAGGACAGGTGCC

[0109] SEQ ID NO.4 (sequence of upstream primer Fw of DNA-B in Example 1):

[0110] CCAGTGACGAAGGCTTGAG

[0111] SEQ ID NO.5 (downstream primer Rv sequence of DNA-B in Example 1):

[0112] Dig-ACTCGTAGGACAGGTGCC

[0113] SEQ ID NO.6 (sequence of the template strand specifically amplified by DNA-A and DNA-B in Example 1):

[0114] CCAGTGACGAAGGCTTGAGCGAGGGCGTGCAAGATTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAGCGGTCCTCGCCGAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTACGAGT

[0115] SEQ ID NO.7 (sequence of the IGF2BP1 promoter portion in Example 4):

[0116] GCGTCCCTCTCCTGAAGACCCCAGAGTCTTCGGCTTATCTTCGTCTGTTTCGGCCGTCCCCGCCTGTCAGTCGCTAGCAGTTAACCGGGGAGGGGTGAGCAACCCCGCCCCCCAAAACGAATGAAAAATAACCGTACATTTTACCCTTTAAGACATGTGAGATCTGGGCTGGAC

[0117] SEQ ID NO.8 (sequence of upstream primer Fw of IGF2BP1 promoter in Example 4):

[0118] GCGTCCCTCTCCTGAAGAC

[0119] SEQ ID NO.9 (downstream primer Rv sequence of IGF2BP1 promoter in Example 4):

[0120] GTCCAGCCCAGATCTCACAT.

Claims

1. A method for detecting 5-hydroxymethylated cytosine at a specific site, characterized in that: The method comprises the following steps: S1 prepares the double-stranded DNA sample to be tested and treats the double-stranded DNA with CpG methyltransferase; S2 divides the double-stranded DNA treated by S1 into two parts, which are respectively recorded as DNA-A and DNA-B; DNA-A is treated with bisulfite; DNA-B is first oxidized with an oxidant and then treated with bisulfite; S3 designs semi-labeled primers, uses biotin-labeled primers to specifically amplify DNA-A treated by S2, and uses digoxigenin-labeled primers to specifically amplify DNA-B treated by S2; S4 performs DNA hybridization on the two differently labeled double-stranded DNAs obtained in S3 to obtain hybrid double-stranded DNA; S5 detects the above hybrid double-stranded DNA using an electrochemical biosensing platform, in which the double-labeled double-stranded DNA is captured by the specific binding of digoxigenin-antibody and generates a current signal after the addition of streptavidin-horseradish peroxidase SA-HRP and 3,3',5,5'-tetramethylbenzidine; S6 uses base mismatch recognition and cleavage enzymes to recognize and cleave AC mismatches caused by 5hmC, and observes whether the current value decreases; If the current signal does not decrease, it means that the DNA to be tested does not contain 5-hydroxymethylated cytosine; If the current signal is lower than the current signal in step S5, it means that the DNA to be tested contains 5-hydroxymethylated cytosine; the change value of the current signal is recorded as ΔCurrent, and the content of 5-hydroxymethylated cytosine is calculated according to the formula.

2. A method for detecting 5-hydroxymethylated cytosine at a specific site according to claim 1, characterized in that: The double-stranded DNA sample described in S1 comes from the cells to be tested, and is obtained by extracting and amplifying the DNA of the cells to be tested; the obtained double-stranded DNA is treated with CpG methyltransferase to distinguish hydroxymethylated DNA from non-hydroxymethylated DNA.

3. A method for detecting 5-hydroxymethylated cytosine at a specific site according to claim 1, characterized in that: The bisulfite in S2 is sodium bisulfite; the oxidant is KRuO4 with a concentration of 0.3-1.2 mM; the ratio of the oxidant KRuO4 to DNA-B is 2 μL:1 μg.

4. A method for detecting 5-hydroxymethylated cytosine at a specific site according to claim 1, characterized in that: The semi-labeled primers described in S3 refer to primers of DNA-A and DNA-B that are labeled with biotin and digoxigenin at their 5' ends, respectively.

5. A method for detecting 5-hydroxymethylated cytosine at a specific site according to claim 1, characterized in that: There are 9 kinds of hybrid double-stranded DNAs described in S4, including biotin CG digoxin, biotin CA digoxin, biotin CG, CG digoxin, CG, CA digoxin, TG, TG digoxin and TA digoxin; the biotin CA digoxin is a mismatched DNA caused by 5hmC.

6. A method for detecting 5-hydroxymethylated cytosine at a specific site according to claim 1, characterized in that: S5 The double-labeled double-stranded DNA includes biotin CG digoxin and biotin CA digoxin as described in claim 5, which will generate a current signal in the electrochemical biosensor platform; the digoxin on the double-labeled double-stranded DNA specifically binds to the digoxin antibody on the sensor, thereby capturing the double-labeled double-stranded DNA and binding it to the electrode; after adding streptavidin-horseradish peroxidase SA-HRP and 3,3',5,5'-tetramethylbenzidine, the biotin on the double-labeled double-stranded DNA binds to streptavidin, and the horseradish peroxidase coupled to streptavidin catalyzes 3,3',5,5'-tetramethylbenzidine, thereby generating a current signal.

7. A method for detecting 5-hydroxymethylated cytosine at a specific site according to claim 1, characterized in that: S5 The electrochemical biosensor platform is composed of a 16-channel electrochemical tester and a 16-channel screen-printed electrode array, wherein each channel is composed of a three-electrode system, and the three-electrode system includes a carbon working electrode, a carbon auxiliary electrode, and an Ag / AgCl reference electrode.

8. A method for detecting 5-hydroxymethylated cytosine at a specific site according to claim 1, characterized in that: The specific parameters for the measurement on the electrochemical biosensor platform in S5 are as follows: initial voltage: -0.3 V, maximum voltage: 0.6 V, minimum voltage: -0.3 V, start scanning direction: positive, scanning rate: 0.1 V / s, number of scans: 2, sampling interval: 0.001 V, static time: 2 seconds, sensitivity: 1e -5 A / V; Steady-state time current curve method parameters: initial voltage: -0.05V, time interval: 0.1, running time: 100 seconds, static time: 3 seconds, sensitivity: 1e -5 A / V, finally record the current value at 100 seconds.

9. A method for detecting 5-hydroxymethylated cytosine at a specific site according to claim 1, characterized in that: S6 The base mismatch recognition and cleavage enzyme can recognize and cleave AC mismatches; the base mismatch recognition and cleavage enzyme is selected from any one of T7 endonuclease I, thymine glycosylase, endonuclease V and Taq Muts; when T7 endonuclease I is used, the reaction temperature for cleavage is 37 to 42°C, the reaction time is 4 to 16 hours, and Mg 2+ The concentration is 1~15mM.

10. The method for detecting 5-hydroxymethylated cytosine at a specific site according to claim 1, characterized in that: The formula in step S6 is: △Current=593.98ln(X)+6538.8, the R of this formula is 2 =0.9627, where X = 5hmC / C, i.e., the ratio of the concentration of 5-hydroxymethylated cytosine 5hmC to the concentration of cytosine C in the sample to be tested, and the ratio X is calculated according to the formula and △Current; In addition, △Current=609.1ln(Y)+7274.8, the R 2 =0.9866, where Y = 5hmC / 5mC, i.e., the ratio of the concentration of 5-hydroxymethylated cytosine 5hmC to the concentration of 5-methylated cytosine 5mC in the sample to be tested, and the ratio Y is calculated according to the formula and △Current; Finally, the content of 5-hydroxymethylated cytosine in the sample is calculated according to the two relative content ratios X and Y and the total mass of the sample to be tested.

Images