Application of soybean COX VIB family gene GmCOX6b

Abstract

The invention discloses an application of a gene GmCOX6b of a soybean COX VIB family. The nucleotide sequence of the soybean GmCOX6b protein coding gene GmCOX6b is shown as SEQ ID NO. 1, and the nucleotide sequence of the soybean GmCOX6b protein coding gene The constructed plant overexpression vector pBA002-GmCOX6b is expressed in a soybean receptor Jack, it is found that transgenic plants are changed in the aspects of plant types and yield traits, the plant height is obviously reduced, and the hundred-grain weight is obviously increased. The gene can be introduced into a plant as a target gene, and through expression of the GmCOX6b gene, the plant type of the transgenic plant is influenced, and the yield is regulated and controlled. Therefore, the soybean GmCOX6b protein coding gene GmCOX6b disclosed by the invention can be applied to the aspects of improving plant type characters through genetic engineering, increasing yield such as hundred-grain weight and the like.

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering and relates to the application of soybean COXVIB family gene GmCOX6b, and specifically relates to the application of COXVIB family gene GmCOX6b derived from soybean, which is expressed in various tissues, highly expressed in pods 7 days after flowering and related to plant height and pod development, in regulating plant plant type traits, number of pods per plant, 100-grain weight and other yield traits. Background Art

[0002] Soybean (Glycine Max (L.) Merr.) is an important food and oil crop. Cultivating high-yield soybean varieties and increasing soybean yield per unit area have become difficult problems that breeders need to overcome. Cytochrome c oxidase (COX), also known as mitochondrial complex IV, is the last electron acceptor in the respiratory chain and participates in the reduction of O2 to H2O. COX is a multimeric complex composed of multiple structural subunits encoding the mitochondrial genome and the nuclear genome. It is a typical protein for the transcription, translation and regulatory interaction of the two genomes. COX VIB members belong to the subunit proteins of the mitochondrial respiratory chain complex IV. Since COX is a multi-subunit respiratory chain complex enzyme, subunit deletions and assembly errors caused by DNA mutations will cause COX structural disorders, functional loss, and cause mitochondrial dysfunction, growth inhibition, and induce mitochondrial myopathy and other diseases (Kumar et al., 2024). In the model plant Arabidopsis, a total of 72 genes encoding Arabidopsis homologous COX-related proteins were found, of which 10 were reported plant-specific COX subunits (Senkler et al., 2017). At present, some genes that directly or indirectly affect plant COX activity have also been found, which may help us further understand the role of COX in plant growth and development. For example, AtCOX17 / AtCOX17-2 (Garcia et al., 2016), COX11 (Radin et al., 2015), AtHCC1 (Steinebrunner et al., 2014), AtCOX10 (Mansilla et al., 2015), PpPPR_78 (Uchida et al., 2011), COD1 (Dahan et al., 2014), DEK10 (Qi et al., 2017) and SmK11 (Ren et al., 2023) directly or indirectly affect the normal assembly of COX and thus affect mitochondrial activity and normal function, ultimately restricting growth and development. Mutations in these key genes lead to changes in COX activity, which have an impact on many aspects of plant embryogenesis, germination, vegetative growth and development, and aging (Mansilla et al., 2018). For example, deficiency of the COX subunits AtCOX10 and AtHCC1 causes embryonic lethality at different developmental stages, mainly at the heart and torpedo stages (Mansilla et al. 2015). In addition, mutants in different COX editing and RNA processing factors, or in proteins associated with complex IV stability, also show severe embryonic lethality (Takenaka et al., 2012, Welchen et al., 2012, Francs-Small et al., 2012).cod1-1 and cod1-2 are mutants of RNA editing factors that lack COX activity. Only embryos of immature seeds cultured in special culture media can germinate (Dahan et al., 2014). Disruption of Smk11 (Small kernel 11), which was cloned in maize, severely affects COX assembly and activity, leading to plant growth and seed development defects (Ren et al., 2023). Arabidopsis heterozygous AtCOX10 mutants have respiratory defects with lower levels of COX activity and show early onset and accelerated progression of natural senescence and darkness-induced senescence (Mansilla et al., 2015). These research results all indicate that plant COX is important for plant growth and development. However, compared with yeast and mammals, little is known about the biosynthesis of COX in plants. Further work is needed to elucidate the roles and significance of the plant-specific subunits, identify putative plant-specific COX assembly factors, clearly establish the interactions between the different proteins involved in COX biosynthesis, and clarify whether the stress-related functions of several accessory proteins are linked to COX activity or more broadly to retrograde signaling and other mitochondrial regulatory pathways. Summary of the invention

[0003] The purpose of the present invention is to disclose a soybean COX VIB family gene GmCOX6b.

[0004] Another object of the present invention is to provide genetic engineering applications of the gene in plant type traits, regulating pod number, 100-grain weight, etc.

[0005] The purpose of the present invention can be achieved through the following technical solutions:

[0006] The soybean COX VIB family gene GmCOX6b, the nucleotide sequence is SEQ ID NO.1.

[0007] The amino acid sequence of the protein encoded by the soybean COX VIB family gene GmCOX6b of the present invention is SEQID NO.2.

[0008] An expression vector containing the soybean COX VIB family gene GmCOX6b of the present invention.

[0009] The soybean GmCOX6b protein encoding gene of the present invention is used for reducing soybean plant height and increasing 100-grain weight.

[0010] The recombinant expression vector of the present invention is used in reducing soybean plant height and increasing 100-grain weight.

[0011] When using GmCOX6b to construct a plant expression vector, any enhanced promoter or inducible promoter can be added before its transcription start nucleotide. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding a selective marker gene (GUS gene, GFP gene, etc.) that can be expressed in plants or a resistance gene for an antibiotic marker (gentamicin marker, kanamycin marker, hygromycin marker, etc.). Considering the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened by phenotypic traits.

[0012] The plant expression vector carrying GmCOX6b of the present invention can be used to transform plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and the transformed plant tissues can be cultivated into plants. The transformed plant host can be monocotyledonous plants such as rice, wheat, and corn, or dicotyledonous plants such as tobacco, Arabidopsis, soybean, rapeseed, cucumber, tomato, poplar, lawn grass, and alfalfa.

[0013] Beneficial effects:

[0014] In the present invention, GmCOX6b belongs to the MLP subfamily of the COX VIB family and contains a COX VIB domain. Through tissue expression analysis, it was found that GmCOX6b was mainly expressed in the pod, and subcellular localization showed that the GmCOX6b protein was located in the cytoplasm, nucleus, and cell membrane. GmCOX6b was overexpressed in Arabidopsis, and it was found that compared with the control, the number of siliques of transgenic Arabidopsis was significantly increased, and the plant type traits were changed. Statistical analysis of the thousand-grain weight of transgenic Arabidopsis showed that the GmCOX6b transgenic strain could significantly increase the thousand-grain weight of seeds compared with the control. The present invention discloses the effectiveness of the gene in regulating the development of plant pods, as well as the changes in yield traits. The yield of crops can be increased by directionally modifying the number of pods of crops.

[0015] By using the plant overexpression vector pBA002-GmCOX6b, the GmCOX6b of the present invention is introduced into the plant body to obtain transgenic plants, and the pod-setting of the plants can be regulated. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0017] Figure 1 Cloning of GmCOX6b gene

[0018] Primers were designed based on the GmCOX6b sequence information predicted by the phytozome website, and PCR amplification was performed using the cDNA of Nannong 1138-2 as a template to obtain a 234 bp DNA fragment. After sequencing analysis, the sequence information of the fragment was consistent with the sequence predicted by the phytozome website, that is, the 234 bp fragment was the GmCOX6b gene. The marker was 2k, and from bottom to top, it was 100, 250, 500, 750, and 2000 bp.

[0019] Figure 2 Tissue expression analysis of GmCOX6b gene.

[0020] Real-time fluorescence quantitative PCR technology was used to study the expression of GmCOX6b in different tissues of Nannong 1138-2, including roots, stems, leaves, flowers, 7d pods, 14d pods, 21d pods, 35d pods and 35d seeds.

[0021] Figure 3 Subcellular localization of GmCOX6b

[0022] Figure 4 PCR identification and relative expression analysis of transgenic soybean.

[0023] (A) Results of T2 transgenic soybean gene sequence identification using specific primers. Lane 1 represents the receptor Jack, negative control. Lane 2 represents H2O, blank control. Lane 3 represents plasmid, positive control. Lanes 4 to 5 represent transgenic line OE-7. Lanes 6 to 7 represent transgenic line OE-17. M represents 2000bp Marker, and the band composition (from bottom to top) is: 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp. (B) Results of T2 transgenic soybean vector sequence identification using specific primers. Lanes 1-8 represent transgenic line OE-7. Lanes 9-15 represent transgenic line OE-17. Lane 15 represents H2O, blank control. Lane 17 represents the receptor Jack, negative control. Lane 18 represents plasmid, positive control. M represents 2000bp marker, band composition (from bottom to top): 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp. (C)) Detection of the expression level of GmCOX6b gene in different strains (n=3). OE-7 and OE-17 represent two GmCOX6b gene overexpression strains. *: significant difference at p<0.05 level. ***: significant difference at p<0.001 level.

[0024] Figure 5Statistical analysis of agronomic traits of T2 transgenic soybean. N≥10. OE-7 and OE-17 represent two GmCOX6b gene overexpression lines, respectively, and Jack receptor is the control. (A) Number of main stem nodes. (B) Plant height, unit: cm. (C) Number of branches. (D) Number of pods per plant. (E) Number of grains per plant. (F) Yield per plant, unit: g. (G) 100-grain weight, unit: g. * indicates significant difference at p<0.05 level; ** indicates extremely significant difference at p<0.01 level; ***: significant at p<0.001 level. DETAILED DESCRIPTION

[0025] The present invention is further described in detail below in conjunction with the accompanying drawings and examples, and with reference to data. These examples are only intended to illustrate the present invention, and are not intended to limit the scope of the present invention in any way. In the following examples, various processes and methods not described in detail are conventional methods known in the art. The primers used are all indicated when they first appear, and the same primers used thereafter are all the same as the first indicated content.

[0026] Example 1 Cloning and identification of soybean GmCOX6b and its encoding gene

[0027] NAN1138-2 was used as the experimental material and was planted in the plant light culture room of Nanjing Agricultural University in June 2021. The cDNA of the pods at day 35 after flowering was used as a template, and GmCOX6b-F and GmCOX6b-R were used as primers for PCR amplification.

[0028] Upstream primer GmCOX6b-F: CGCAATTGTTGATCGAGTCTG;

[0029] Downstream primer GmCOX6b-R: AAAGACTTCTCATGCCTCGGA.

[0030] The GmCOX6b gene was amplified from the total RNA of soybean pod organs by RT-PCR. Soybean pod tissue was taken and ground with a mortar. The mixture was added to a 1.5 mL EP tube containing lysis solution, and then transferred to a glass homogenizer after sufficient shaking. After homogenization, the mixture was transferred to a 1.5 mL EP tube and total RNA was extracted using a plant total RNA extraction kit (TIANGEN DP404). The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis, and then the RNA content was determined on a spectrophotometer. The total RNA obtained was used as a template and reverse transcription was performed according to the instructions of the reverse transcription kit provided by Takara to synthesize the first chain of cDNA. PCR amplification reaction was performed. The PCR reaction system was: 2 μl cDNA (0.05 μg), 2 μl of upstream and downstream primers (10 μM), 25 μl 2×Phanta Max Buffer, 1 μl dNTP (10 mM) and 1U PhantaMax Super-Fidelity DNA polymerase (Vazyme), and 50 μl was supplemented with ultrapure water. The PCR program was as follows: pre-denaturation at 94°C for 3 min on a Bio-RAD PTC200 PCR instrument; denaturation at 94°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 45 s, for a total of 30 cycles; then extension at 72°C for 5 min to terminate the reaction, and storage at 4°C. The PCR product was recovered and cloned into the pClone007 vector to obtain the T-GmCOX6b vector, and the cDNA sequence of the soybean gene GmCOX6b with a complete coding region was obtained after sequencing. SEQ ID NO.1, a full length of 234 bp, encoding 77 amino acids shown in SEQ ID NO.2.

[0031] Example 2 Expression characteristics of GmCOX6b in different organs of soybean

[0032] RNA was extracted from roots, stems, leaves, flowers, 7d pods, 15d pods, 25d pods, 35d pods, 45d pods, and 35d seeds of Nannong 1138-2 material and converted into cDNA for RT-PCR analysis.

[0033] The extraction of total RNA was the same as in Example 1. The soybean constitutively expressed gene Tubulin was used as the internal reference gene, and the amplification primers were Tubulin forward primer sequence: GGAGTTCACAGAGGCAGAG, Tubulin reverse primer sequence: CACTTACGCATCACATAGCA. cDNA from different soybean tissues or organs was used as a template for real-time fluorescence quantitative PCR analysis. The amplification primers for GmCOX6b were: GmCOX6b-qPCR-F: GAGTTTCATAGATGCTTGGCAGC, GmCOX6b-qPCR-R: CCCATTCTCCCTCTGTTCATTC. Results ( Figure 2 ) analysis showed that the expression of GmCOX6b was relatively high in 7DAF pods, indicating that GmCOX6b may be related to soybean pod development.

[0034] Example 3 Subcellular localization of GmCOX6b

[0035] Subcellular localization was performed using the transient expression method of Nicotiana benthamiana. The vector used was P2, and the primers were GmCOX6b-P2-F:ACAAATCTATCTCTCTCGAGATGGCGGAGATTGAACT, GmCOX6b-P2-R:GCTCACCATGGATCCAAGAGGTCCTGGAAAAGTCCC. PCR amplification, after the target band was correct, the rubber was cut and recovered, and the recovered rubber product was connected to the vector by homologous recombination to construct the subcellular localization vector P2-GmCOX6b (the gene is at the N-terminus of GFP). After transient expression in tobacco, it was cultured in the dark for 48 hours. After laser irradiation with a laser confocal microscope (Zeiss, LSM780), a green fluorescent signal was generated to locate the protein and observe and take pictures. The results are shown in Figure 3-5 As shown, the empty vector was distributed throughout the cells, and the GmCOX6b:GFP fusion protein was distributed in the cell membrane and nucleus, indicating that GmCOX6b may function in the nucleus and membrane.

[0036] Example 4 Genetic Engineering of GmCOX6b

[0037] The vector was constructed using the double enzyme digestion method, which was divided into two steps: enzyme digestion reaction and recombination reaction. The primer sequences were: F: CGCGCCGGGCCCAGGCCTACGCGTATGGCGGAGATTGAACT, R: ATCGGGGAAATTCGAGCTCTCAAAGAGGTCCTGGAAAAGT.

[0038] The pBA002 vector was double-digested by BamH1 and Kpn1, and the target fragment was amplified from the T-GmCOX6b vector by the above-mentioned linker primers, and then recombined and ligated. The product was the expression vector pBA002-GmCOX6b, which was transformed into Escherichia coli DH5α. The transformation solution was spread on LB solid medium containing 50 mg / L Kana to screen positive clones. After sequencing verification, the plasmid was extracted to obtain the pBA002-GmCOX6b plant overexpression vector, and pBA002-GmCOX6b was transferred into Agrobacterium tumefaciens strain EHA105 by freeze-thaw method. pBA002-GmCOX6b was transformed into soybean through the mediation of Agrobacterium strain EHA105. The recipient material Jack seeds were sterilized with chlorine gas in a fume hood for 6 hours, and then the seeds were germinated in SG4 solid medium for 1 night. The seed coat of the beans that germinated overnight was removed, the seeds were divided into two, part of the hypocotyl was removed, and 7 wounds were made in the axil of the leaves. At the same time, prepare the bacterial solution for infection. The Agrobacterium tumefaciens bacterial solution containing the pBA002-GmCOX6b recombinant vector was shaken at 28°C and 200rpm to an OD600 value of 0.8-0.9, centrifuged at 4000rpm for 10min, discarded the supernatant, and then resuspended in CCM solution to an OD600 value of 0.5-0.6. The prepared explants were placed in the bacterial solution and infected at 28°C and 150rpm for 30min. Then the explants were taken out and spread flat on CCM solid culture medium with the wound facing down, and placed at 25°C for co-culture for 4-5d. Then the explants were washed with sterilized ultrapure water and Wish-Liquid, and then the explants were obliquely inserted into SIM culture medium without glufosinate at 45°C, and cultured at 26°C for 15d to induce germination. After 15 days, the large buds were cut off and replaced with SIM culture medium with 6mg / L glufosinate to induce germination. After two weeks, the cotyledons and yellow leaves were removed and replaced with SEM medium with 4 mg / L glufosinate. Then, subculture was performed in a 15-day cycle, and the dose of glufosinate was gradually reduced. When the buds of the explants grew to about 6 cm, the clustered buds were transferred to the rooting medium and cultured for about 10 days, and the induced roots were visible. After the root system grew well, it was transplanted into the sterilized mixed nutrient soil and placed in an artificial incubator (16h light / 8h dark, 25°C) for growth.

[0039] The overexpression positive seedlings were positively identified at the DNA level in the offspring, using gene sequence specific primers F: CTAACAGAACTCGCCGTAA; R: TCAAAGAGGTCCTGGAAA and vector sequence specific primers Bar-F: AAACCCACGTCATGCCAGTTC and Bar-R: CGAGACAAGCACGGTCAACTT. The results of real-time fluorescence quantitative PCR reaction showed that compared with the control, the expression level of GmCOX6b gene in transgenic materials increased significantly, among which the expression level of OE-17 strain increased by about 140 times. ( Figure 4 ). The sequences of the fluorescence quantitative primers and the primer sequences of the internal reference gene Tubulin are the same as those in Example 2.

[0040] Phenotypic observations were conducted on the T2 generation 35S::GmCOX6b transgenic soybeans. Under the conditions of the net house, the plant height of the two overexpression lines OE-7 and OE-17 was significantly reduced and the 100-grain weight was significantly increased compared with the control. In addition, the number of main stem nodes, pods and grains per plant of the OE-7 line was reduced, and although the overall 100-grain weight was significantly increased, the yield per plant was reduced; while the number of branches, pods and yield per plant of the OE-17 line were significantly increased ( Figure 5 ). It is speculated that the number of pods per plant may have a greater impact on the yield per plant than the 100-grain weight, resulting in a decrease in the yield of the OE-7 strain, but the reduction in plant height may be beneficial to increasing the yield per unit area under dense planting conditions. This also provides a new research idea for increasing soybean yield.

Claims

1. The soybean GmCOX6b protein encoding gene, whose nucleotide sequence is: SEQ ID NO.

1.

2. The GmCOX6b protein encoded by the gene according to claim 1, whose amino acid sequence is: SEQ ID NO.

2.

3. A recombinant expression vector containing the soybean GmCOX6b protein encoding gene according to claim 1.

4. Use of the soybean GmCOX6b protein encoding gene according to claim 1 in reducing soybean plant height and increasing 100-grain weight.

5. Use of the recombinant expression vector according to claim 3 in reducing soybean plant height and increasing 100-grain weight.

Images