SNP (Single Nucleotide Polymorphism) molecular marker of porcine lncRNA NEAT1 promoter region and application of SNP molecular marker in meat production traits

Abstract

The invention belongs to the technical field of molecular biology and molecular markers, and particularly relates to an SNP molecular marker of a pig lncRNA NEAT1 promoter region and application of the SNP molecular marker in pig meat traits. According to the present invention, the 6811209-6812099 section gene sequence of the pig chromosome 2 is obtained, the fragment length is 891 bp, and the BLAST comparison is performed on the NCBI website to discover that the nucleotide polymorphism (SNP) site exists in the amplified fragment; the mutation of the SNP locus is specifically at the 6811742nd basic group of the chromosome 2, and the basic group is changed from C to T. The mutation site is named as rs324459978 according to a naming rule of an Ensesbl database, and the mutation site is named as rs324459978. The invention provides a new marker for pig molecular marker-assisted selection, and the application of the new marker can accelerate the breeding improvement process of high-quality pigs.

Description

Technical Field

[0001] The present invention belongs to the technical field of pig genetic marker screening and application, and specifically relates to a SNP molecular marker in the promoter region of pig lncRNA NEAT1 and its application as a pig meat production trait. The genetic marker is cloned from the 6811742 base of pig chromosome 2. Background Art

[0002] With the rapid development of biotechnology in my country and people's increasing attention to healthy lifestyles, long non-coding RNA (lncRNA) has gradually emerged in gene regulation and biological research. In recent years, more and more studies have shown that lncRNA not only plays a key role in gene expression regulation, but is also closely related to the occurrence and development of a variety of human diseases. As an emerging regulatory factor, the study of lncRNA provides a new perspective for revealing complex biological processes and promotes the personalized development of disease prevention and treatment.

[0003] In the context of animal breeding and genetic improvement, it is crucial to understand single nucleotide polymorphisms (SNPs) associated with lncRNA. The presence of these SNPs may affect the function of lncRNA and thus interfere with the expression and regulation of genes. Characteristics that affect biological traits, including growth rate, disease resistance, and production performance, often involve the synergistic effects of multiple genes. As an important regulatory factor, lncRNA's variation types (such as nucleotide substitutions, insertions, or deletions) may affect the expression of downstream genes by changing its structure or interaction. Especially in the process of pig breeding, the improvement of genetic traits is of great significance to improving production performance.

[0004] Traditional breeding methods have certain limitations in selecting animal traits, especially for traits with low heritability, and the results are often not ideal. This is mainly because traditional breeding relies on phenotypic selection, and the genetic basis of many traits is complex and is affected by multiple genetic and environmental factors. In addition, phenotypic selection requires a long period of observation and accumulation. This reduces breeding efficiency. Therefore, there is an urgent need to find more efficient selection tools to improve breeding efficiency and accuracy.

[0005] In this context, marker-assisted selection (MAS) technology came into being and has become an important means in modern animal breeding. MAS technology can accurately identify genetic markers related to economic traits and select excellent genotypes by analyzing individual genotype information, providing a reliable basis for breeding, thereby achieving more efficient selection. This method can not only overcome the defects of traditional phenotypic selection, but also provide a new perspective for the study of the genetic mechanism of complex traits. A large number of studies have shown that lncRNA SNPs can affect the binding sites in the promoter region of genes, thereby regulating the binding efficiency of transcription factors and DNA, and then affecting the transcriptional activity of genes. At the same time, lncRNA can further regulate gene expression by changing the three-dimensional structure of chromatin and epigenetic modifications. For example, some lncRNA SNPs have a profound effect on the expression of target genes by changing the nuclear protein complex to which they bind or changing their interaction with small molecule RNAs.

[0006] As an important lncRNA, NEAT1 has been shown to be closely related to muscle growth and development in pigs and mice. Studies have shown that NEAT1 is significantly upregulated during the differentiation and muscle regeneration of C2C12 cells, and shows a downward trend in the later stage. In addition, NEAT1 can promote the proliferation of C2C12 cells and pig skeletal muscle satellite cells, while inhibiting their differentiation. Further in vivo experiments found that interfering with the expression of NEAT1 led to an increase in the muscle volume and weight of mice, while increasing the cross-sectional area of ​​muscle fibers. This result shows that interfering with NEAT1 can effectively promote the growth of postnatal muscles.

[0007] Main references

[0008] [1]Yin,H.et al.(2019).Long Non-coding RNAs in Regulating GeneExpression:A Large Player of the Genetic World.Cellular&Molecular BiologyLetters,24(1),37.

[0009] [2]Wang,K.et al.(2018).Long Non-coding RNAs:Key Regulators of GeneExpression and Potential Therapeutic Targets for Diseases.BiochemicalPharmacology,154,62-70.

[0010] [3]Zhang,L.et al.(2020).Identification of SNPs in Long Non-codingRNAs and Their Associations with Phenotypic Traits in Beef Cattle.BMCGenomics,21(1),325.

[0011] [4]Li,Y.et al.(2021).The Role of Long Non-coding RNA in MuscleDevelopment and Regeneration.Frontiers in Genetics,12,Article 659756.

[0012] [5]Yuan,Y.et al.(2021).Long Non-Coding RNA NEAT1 Modulates theProliferation and Differentiation of Myoblasts.Scientific Reports,11(1),6679..

[0013] [6]Zhou,Y.,&Li,J.(2019).Molecular Marker-Assisted Selection in AnimalBreeding:Tools,Trends and Challenges.Frontiers in Genetics,10,Article 1143.

[0014] [7]Su,H.et al.(2020).Long Non-coding RNAs as Key Regulators of GeneExpression in Animals:Implications for Animal Breeding.Animals,10(1),130.

[0015] [8] Ge, T. et al. (2022). Understanding the Function of Long Non-codingRNAs in Livestock Trait Phenotypes: A Review. Journal of Animal Science and Biotechnology, 13(1), 1-12. Summary of the invention

[0016] The purpose of the present invention is to provide a SNP molecular marker in the promoter region of pig lncRNA NEAT1. Through preliminary laboratory exploration, this study found a SNP site in the promoter region of pig lncRNA NEAT1, which is located at the 6811742 base of pig chromosome 2.

[0017] Another object of the present invention is to provide the application of SNP molecular markers in the promoter region of pig lncRNA NEAT1 in meat production traits. By cloning the gene sequence of the 6811209-6812099 segment of pig chromosome 2, and using direct sequencing to find SNP sites and genotyping methods, the correlation with pig growth traits is analyzed, thereby establishing new marker-assisted selection sites for pig growth traits and improving pig muscle yield.

[0018] The present invention is achieved through the following technical solutions:

[0019] The present invention obtains the gene sequence of the 6811209-6812099 segment of the pig chromosome 2, the length of the segment is 891bp, and the nucleotide sequence is shown in the sequence table SEQ ID NO.1 in the attached figure. By performing BLAST comparison on the NCBI website, it is found that there is a nucleotide polymorphism (SNP) site in the amplified segment, specifically as follows Figure 2 The mutation of this SNP site is specifically at the 6811742 base of chromosome 2, where the base changes from C to T. According to the naming rules of the Ensembl database, the mutation site is named rs324459978.

[0020] The experimental materials include American Large White pigs. Whole genome DNA was extracted from the blood of American Large White pigs, and primer pairs were designed based on the pig gene sequence (NC_010444.4) published in the NCBI database. The sequences of the primer pairs are as follows:

[0021] Forward primer (SEQ ID NO. 2): 5'-AGTTCAAGTGCTGCCTTC-3',

[0022] Reverse primer (SEQ ID NO. 3): 5'-GCCCTTCTTTCGGATTTCT-3'.

[0023] The above primer pair can detect and type the SNP sites in the gene region of the 6811209-6812099 segment of pig chromosome 2.

[0024] After PCR amplification, purification of PCR products, cloning and sequencing, and sequence comparison analysis using the above primer pair, a genetic marker associated with pig growth traits was screened. The nucleotide sequence of the genetic marker is shown below, where the mutation site is located at position 534 of the sequence, and the specific sequence (SEQ ID NO.1) is as follows:

[0025] AGTTCAAGTGCTGCCTTCCCAGCCTAACTGCGACCCCGCACCCCACGGCCTGCCTTCTTGCTCATGTTCAGGGCATCGACGGCCAGATATCGCCTCCAGCAAGGGTGGCGAGACCCTCAGCCTCCTCCAGTCTCTGCCTCCCTCCTTCAGACAAAGCAGGGCACAGGGGGCCGCCCAGCCTACGCAGAAGCGGCCCCCTCCCAGGGGTCAAGTTCCCCTTCTCCAGCGGGCAGCAGCGACAGCCAGGCCTGGAGTCTGCTCCTCTCCCTGGGTTCCTGCGGGCCCTTTCGAGGCAGCTCTGCCCTGCAAGACTTCCCTAAGGTCTAGTCTCCCCTCTAACCTGCCTCCAGCAGGCACACTCCCACCCCCAGCCCGCCAGTATCTTCTGACTCTGTCACCGCCCCCATCTGTCCCCTGAGGCCCTAAACTGCCACCTCCTCCCCCACAACTCAGCCCGGGCCCGCGGCCCTCCCTGTGGCTAACTCCTGCTGGACGGGCCACAACTTTTGCTTTTATAGCCCCGGCCGCGTCACR(C / T)CGGGGCATTGCTCAACGGGACGATTCCTCCACCGCCACCGGAAAAAAAGTCCCTCCCTGACCCTGTCTGAGGAGACGCCTCGGGGTGGCACCGGGTGTCCCGGGCTGTCCGCCCTCTCAGACGCCCCAGTTATCCCCGCCCCCCTTAGCAGTGCTTCCTGAGATCCACGACCCATCTCAAGGTCCCCTTTGGGAGGTGGATTCCAGGGGGAAAAGGGGAGACGTCCCCTTTTCTTTCACGGGCCCGGGGAATTAGGGGATGGGTAGGGGAGGTGGCTTGGGAGCTGCCCTCTCAAGAAGAAGGGACCGCCCGGGGTTGCCTCAGGTCACCCTTTCCCGAGAAATCCGAAAGAAGGGC

[0026] The present invention provides a method for screening genetic markers associated with porcine growth traits, and the method comprises the following steps:

[0027] Genomic DNA was extracted from the blood of American Large White pigs. Primers were designed based on the genomic sequence of -422 to +468 bp upstream of the NEAT1 transcription start site. The genomic DNA of pigs was amplified by PCR using the primers, and the nucleotide sequence of -422 to +468 upstream of the NEAT1 transcription start site was obtained by direct sequencing (see SEQ ID NO.1 for details), which contained 1 SNP site. The mutation site can be used as a genetic marker to perform association analysis on the growth traits of American Large White pigs.

[0028] The present invention provides a genotyping method for detecting SNP sites in the above sequence.

[0029] The present invention further provides an application of the association analysis between individuals with different genotypes and growth traits using direct sequencing. A systematic understanding of the role of lncRNA and its SNPs in gene regulation not only helps to analyze the genetic mechanism of biological traits, but also provides an important theoretical basis for improving agricultural productivity and promoting animal health. Deepening the relevant exploration of lncRNA SNP research will bring new opportunities for the development of personalized breeding and precision medicine. The study on the relationship between lncRNA NEAT1 and the SNPs in its promoter region and pig growth traits has important scientific value and application prospects, and can provide new strategies for the genetic improvement of pigs.

[0030] For more detailed technical solutions, please see the "Specific Implementation Methods".

[0031] Compared with the prior art, the present invention has the following advantages and effects:

[0032] The experiment found that the polymorphic site rs324459978 was significantly correlated with the eye muscle area and the age at which the pig reached 100 kg in American Large White pigs (P<0.05). Among them, the eye muscle area of ​​CC genotype individuals was significantly higher than that of TT genotype individuals (P<0.05); in terms of the age at which the pig reached 100 kg, the age at which the CC genotype reached 100 kg was significantly shorter than that of the TT genotype individuals (P<0.01). From the perspective of genetic stability and genetic progress, the CC genotype has obvious advantages in shortening the age at which the pig reached 100 kg and increasing the eye muscle area. Based on the above results, the polymorphic site rs324459978 can be used as a molecular breeding marker to increase the meat production of pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 : The present invention clones and detects the 6811209-6812099 segment of porcine chromosome 2. The concentration of agarose gel is 1.5%. Explanation of reference numerals: Lanes 1-4: PCR amplification products, Lane M: DL2000Maker.

[0034] Figure 2 : The nucleotide sequence of the 6811209-6812099 segment of porcine chromosome 2. Explanation of the accompanying drawings: There is a mutation site in the sequence shown, which is a specific site that causes polymorphism in this segment. SEQ ID NO.1 is the nucleotide sequence of the 6811209-6812099 segment of porcine chromosome 2, and this sequence is used as the nucleotide sequence of the genetic marker of the present invention. There is an allele mutation site at the 534th base of the sequence, that is, a mutation from "C" to "T". The base at the mutation site in the sequence is the base before the mutation, and the mutation method is shown in this specification.

[0035] Figure 3 : The sequencing result of the genetic marker sequence of the present invention. There is a double peak pattern, which is a mutation of the base "C" to "T". DETAILED DESCRIPTION

[0036] Example 1: Obtaining DNA fragments from the 6811209-6812099 region of porcine chromosome 2 and establishing a SNP detection method

[0037] The American Large White pig was selected for the experiment, and the primer pair was designed based on the genome sequence of the 6811209-6812099 segment of pig chromosome 2. The specific sequence is as follows:

[0038] Forward primer (SEQ ID NO. 2): 5'-AGTTCAAGTGCTGCCTTC-3',

[0039] Reverse primer (SEQ ID NO. 3): 5'-GCCCTTCTTTCGGATTTCT-3'.

[0040] The above primer pairs were used to perform PCR amplification in genomic DNA of pigs from different experimental groups.

[0041] The PCR reaction system is shown in Table 1.

[0042] Table 1 PCR reaction system

[0043]

[0044] The PCR reaction conditions are shown in Table 2.

[0045] Table 2 PCR reaction conditions

[0046]

[0047] After the obtained PCR product was purified and cloned, it was commissioned to Wuhan Hece Gene Technology Co., Ltd. for sequence determination. BLAST comparison analysis revealed a C / T base mutation at the 534th base of the sequence.

[0048] Example 2: Association analysis and application of the genetic markers of the present invention with meat production traits of different pig breeds

[0049] In order to determine the correlation between SNPs in the 6811209-6812099 region of chromosome 2 and pig phenotypic differences, this example selected American Large White pigs (642 heads) as test materials. Polymorphism detection was performed by direct sequencing, and the correlation between polymorphic sites and pig meat production traits was analyzed. The mixed linear model (Mixed) in SAS statistical software was used to analyze the association between genotype and phenotypic values. Among them, the analysis model of American Large White pigs is as follows: ijkl =u+G i +F j +S k +B l +ε ijklm , where Y ijkl is the observed value of the trait; u is the total average value of the trait; G i is the genotype effect; F j , S k , B l are fixed effects, namely family, gender, and batch effects; ε ijklm is a random error, assuming that it obeys N(0, σ 2 )distributed.

[0050] After polymorphism detection of rs324459978 site in the 6811209-6812112 region of pig chromosome 2, three genotypes were detected in the above populations. The genotype frequencies and their distribution are shown in Table 3.

[0051] Table 3 Genotype frequency and allele frequency of polymorphic site rs324459978 in American pig population

[0052]

[0053] From Table 3, it can be concluded that the C allele frequency of the polymorphic site rs324459978 in the American Large White pig population is higher than the T allele frequency.

[0054] Table 4 Association analysis between polymorphic site rs324459978 and meat production traits

[0055]

[0056] Note: The above values ​​are least squares mean ± standard error. In each pig breed, the same letters in the same column indicate no significant difference (P>0.05), different letters indicate significant difference (P<0.05), and no mark indicates no significant difference (P>0.05). The numbers in brackets indicate the number of pigs.

[0057] The analysis in Table 4 showed that the polymorphic site rs324459978 was significantly correlated with the eye muscle area and the age at which the pig reached 100 kg in American Large White pigs (P<0.05). Among them, the eye muscle area of ​​CC genotype individuals was significantly higher than that of TT genotype individuals (P<0.05); in terms of the age at which the pig reached 100 kg, the age at which the pig reached 100 kg was significantly shorter than that of the pig reached 100 kg (P<0.01). From the perspective of genetic stability and genetic progress, the CC genotype has obvious advantages in shortening the age at which the pig reaches 100 kg and increasing the eye muscle area. Based on the above results, the polymorphic site rs324459978 can be used as a molecular breeding marker to increase the pig meat production trait.

Claims

1. The SNP molecular marker in the promoter region of pig lncRNA NEAT1 is characterized by: The SNP molecular marker includes a nucleotide sequence as shown in SEQ ID NO.

1. The mutation of the SNP site is specifically at the 6811742nd base of chromosome 2, where the base changes from C to T.

2. The SNP molecular marker according to claim 1, characterized in that: The pigs include American Large White pigs and French Large White pigs.

3. The SNP molecular marker according to claim 1, characterized in that: The sequences of the primer pairs used to detect SNP molecular markers are shown in SEQ ID NO.2 and SEQ ID NO.

3.

4. The use of the SNP molecular marker according to claim 1 in improving the meat production traits of pigs, characterized in that: The polymorphic site rs324459978 was significantly correlated with the eye muscle area and the age at which the pigs reached 100 kg in American Large White pigs. The eye muscle area of ​​the CC genotype individuals was significantly higher than that of the TT genotype individuals. In terms of the age at which the pigs reached 100 kg, the CC genotype individuals were significantly shorter than the TT genotype individuals in terms of the age at which the pigs reached 100 kg.

Images