Application of galaodonium iodide, clohydroxylazamide, dihydroxytheophylline and thiocolchicine compounds in preparation of product for inhibiting combination or cutting of SpCas9 to substrate

Abstract

The invention belongs to the technical field of CRISPR (clustered regularly interspaced short palindromic repeats) Cas9 gene editing, and particularly relates to an application of a galaodonium iodide compound, a clohydroxylazamide compound, a dihydroxytheophylline compound and a thiocolchicine compound in preparation of a product for inhibiting combination or cutting of SpCas9 to a substrate. According to the present invention, one or a combination of more selected from the group consisting of SpCas9, clohydroxylazamide, dihydroxytheophylline and thiocolchicine is used, and the combination of SpCas9 and DNA is destroyed so as to achieve the effect of interfering the DNA cutting by SpCas9;

Description

Technical Field

[0001] The present invention relates to the field of CRISPR Cas9 gene editing technology, and specifically to the use of galactoside, chloranilamide, ethophylline and thiocolchicoside compounds in the preparation of products that inhibit SpCas9 from binding to or cutting a substrate. Background Art

[0002] In 1987, Ishino et al. first discovered a large number of repetitive sequences containing regular intervals when studying the alkaline phosphatase gene of Escherichia coli in Nucleotide sequence of the iap gene, responsible for alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product. Journal of Bacteriology 169, 5429-5433. However, due to the limitations of technology and knowledge at the time, no further research was conducted. Until the beginning of this century, after a large number of subsequent studies by researchers, it was found that this sequence was widely present in bacteria and archaea, and the tandem repeats arranged at intervals were named Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR).

[0003] The CRISPR / Cas system is a complex phage defense mechanism composed of a CRISPR array and a series of related Cas proteins. The CRISPR array itself consists of three main parts: a leader sequence located at the front end of the array, a series of highly conserved repeat sequences, and multiple spacers. The leader sequence, as the promoter of the CRISPR array, regulates the expression of the CRISPR gene and is generally located at the start of the CRISPR array; the repeat sequence is 21 to 48 bp long, contains a palindromic sequence, and can form a hairpin structure (R-loop); the spacer sequence is integrated from exogenous DNA fragments, and they are the basis for the CRISPR system to recognize foreign genetic material. In order to better distinguish different CRISPR systems, researchers divided CRISPR / Cas into two categories and six types (Ⅰ-VI) according to the types and sequences of CRISPR associate (Cas) proteins and their roles in the bacterial immune defense process: Class 1 includes Type Ⅰ, Type Ⅲ and Type Ⅳ, which require multiple Cas effector proteins to form a complex to play the role of endonuclease; Class 2 includes Type Ⅱ, Type Ⅴ and Type Ⅵ, which only require a single Cas effector protein to perform functions. For example, the Type Ⅱ CRISPR / Cas system only requires one protein, Cas9, to effectively cut double-stranded DNA. It is this simple and efficient advantage that gives the Type Ⅱ CRISPR / Cas9 system a broad space for development, and its related research is also the most extensive and in-depth. According to the authoritative clinical trial website (ClinicalTrials), there are currently 70 clinical trials on CRISPR / Cas9 (as of May 2024), and the types of diseases treated cover single gene genetic diseases, ophthalmic diseases, AIDS and many other aspects. It is particularly worth mentioning that in December 2023, Casgevy (based on the CRISPR / Cas9 system), a gene editing therapy for the treatment of sickle cell disease jointly developed by the US biotechnology company Vertex Pharmaceuticals (VRTX.US) and the Swiss pharmaceutical company CRISPR Therapeutics (CRSPR.US), has been officially launched with the approval of the European Medicines Agency (EMA) and the US Food and Drug Administration (FDA).

[0004] The CRISPR / Cas9-mediated genome editing process can be roughly divided into three key stages: first, the Cas9 protein binds to the single-stranded guide RNA (sgRNA) to form a complex; second, the complex recognizes and binds to the specific PAM (Protospacer Adjacent Motif) sequence on the target DNA under the guidance of the sgRNA; finally, the Cas9 protein cuts the target DNA to produce double-strand breaks (DSB). Different types of Cas proteins in the CRISPR system use their own specific PAM sequences to confirm the target site. Taking the CRISPR / Cas9 system as an example, its PAM sequence is usually NGG, where N can be any base. After Cas9 protein-mediated DNA cutting, cells will respond to DSBs through two main DNA repair mechanisms: one is the non-homologous end joining repair mechanism (NHEJ), which may cause small insertions or deletions (indels); the other is homology directed repair (HDR), which can accurately repair DSBs with the addition of exogenous repair templates.

[0005] Compared with previous gene editing technologies, the CRISPR / Cas9 system has several significant advantages: first, it can edit the genome accurately and efficiently; second, the CRISPR / Cas system is not restricted by species and is applicable to genome editing of a variety of organisms such as plants, bacteria, and animals; finally, the CRISPR / Cas system has the ability to edit multiple target sites on the genome at the same time. However, the CRISPR / Cas9 system also has many shortcomings. One of them is that DNA repair after DSB mainly depends on NHEJ. This repair mechanism may produce errors during the repair process, resulting in the loss of gene function or the acquisition of new unknown functions; another major problem is the off-target effect, that is, the gene editing tool may cut the wrong target DNA site, which is an unavoidable side effect of gene editing technology based on the principle of nucleic acid complementarity. With the application of the CRISPR / Cas system, the accumulation of off-target effects may lead to chromosome translocation and even induce genotoxic mutations.

[0006] In order to provide a good, effective, and safer medication window for clinical applications, and to provide an efficient CRISPR system switch for basic research, it is necessary to accurately control the CRISPR / Cas9 system, so the development of CRISPR / Cas9 system inhibitors becomes particularly important. Scientists have discovered a variety of protein molecules (Anti-CRISPR, ACR) that antagonize the CRISPR / Cas9 system, but these molecules have low affinity for the most commonly used Cas9 protein, SpCas9 (Cas9 from Streptococcus pyogenes). In addition, because ACR is essentially a protein molecule, it has strong immunogenicity and poor drugability, making it difficult to promote in clinical practice. Small molecule compounds can largely overcome these two deficiencies and are recognized as the most promising means to solve this problem. Amit Choudhary's research group at Harvard Medical School published two articles on small molecule inhibitors of CRISPR / Cas9 in Cell and Nature Cell Biology in 2019 and 2022, respectively: A High-Throughput Platform to Identify Small-Molecule Inhibitors of CRISPR-Cas9. Cell. 2019 May. and A general approach to identify cell-permeable and synthetic anti-CRISPR small molecules. Nat Cell Biol. 2022 Dec. They have successively developed two small molecule drugs, BRD0539 and BRD7586, but the in vivo safety of these two drugs has not been verified, and the synthesis process is complicated and the cost is high, which undoubtedly limits their further promotion. We hope to screen out small molecule inhibitors that can effectively control the CRISPR / (Sp)Cas9 system from the FDA-approved small molecule drug library, thereby avoiding the drawbacks of previous candidate drugs. In the existing scientific literature, there are no reports that galamate, chloranilamide, ethoxyphylline, and thiocolchicoside can bind to SpCas9 or inhibit its endonuclease activity. In addition, there are no studies reporting that these three compounds can bind to SpCas9 or affect its endonuclease activity when used in combination. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides the use of galamonium iodide, chloranilamide, ethophylline, and thiocolchicoside in the preparation of products that inhibit SpCas9 from binding or cutting substrates.

[0008] Use of galamate, chloranil, ethynyl, and thiocolchicoside in the preparation of products that inhibit SpCas9 from binding or cutting substrates, wherein one or more of galamate, chloranil, ethynyl, and thiocolchicoside are used in combination;

[0009] The concentration of galaminium iodide ranged from 1.56 to 500 μM;

[0010] The concentration of closan was 1.56-500 μM;

[0011] The concentration of ethoxyphylline was 1.56-500 μM;

[0012] The concentration of thiocolchicoside was 1.56-500 μM.

[0013] Preferably, the product comprises any one of galamate, chloranilamide, ethophylline and thiocolchicoside.

[0014] Preferably, the product also includes SpCas9 protein.

[0015] Preferably, the dosage ratio of galactoside to SpCas9 is 0.25-1mmol:5U

[0016] Preferably, the dosage ratio of closanitamide to SpCas9 is 0.25-1mmol:5U

[0017] Preferably, the dosage ratio of ethoxyphylline or to SpCas9 is 0.25-1mmol:5U

[0018] Preferably, the dosage ratio of colchicine to SpCas9 is 0.25-1mmol:5U.

[0019] Preferably, the product comprises galamate, chloranilamide, ethoxyphylline, thiocolchicoside and SpCas9 protein.

[0020] Preferably, the total dosage of galamate, chloranilamide, ethoxyphylline and thiocolchicoside to SpCas9 is 0.25-1mmol:5U.

[0021] Preferably, galamonium iodide, chloranilamide, ethophylline, and thiocolchicoside are mixed in equal amounts.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] 1. The present invention provides the use of galabiodinium, chloranilamide, ethophylline, and thiocolchicoside in inhibiting the binding or cutting of SpCas9 to a substrate, so that the "anti-CRISPR-Cas9" gene editing system can be more effectively controlled, and the binding of SpCas9 to DNA can be destroyed, thereby interfering with SpCas9 in cutting DNA.

[0024] 2. Galanium iodide is a synthetic non-depolarizing muscle relaxant containing three quaternary ammonium groups. Its muscle relaxant effect is similar to that of tubocurarine, but it does not block ganglia and release histamine, but has a strong atropine-like effect, which can significantly relieve the tension of the vagus nerve, increase heart rate, slightly increase blood pressure, and increase cardiac output. Galanium iodide has not been reported to have an inhibitory effect on the binding or cleavage of SpCas9 with substrates.

[0025] Chlorhexidine is a salicylanilide antiparasitic chemical drug, mainly used to treat diseases caused by Fasciola hepatica infection in cattle and sheep, and also has good therapeutic effects on tapeworms and nematodes. Existing drugs have a low affinity for SpCas9, which means that the regulatory efficacy is not high and may not be able to perform high-level regulation in vivo, but the drugs provided in this application have been proven to be able to enter and regulate the human body under safe conditions.

[0026] Ethylphylline generally refers to acetylphylline tablets, which are a smooth muscle relaxant mainly used to treat diseases such as bronchial asthma, asthmatic bronchitis, and obstructive pulmonary emphysema. The main ingredient of acetylphylline tablets is acetylphylline, which is a white tablet. It is commonly used clinically to treat bronchospasm caused by diseases such as bronchial asthma, asthmatic bronchitis, and obstructive pulmonary emphysema, and symptoms such as wheezing, shortness of breath, chest tightness, and cough. In addition, acetylphylline tablets can also dilate coronary arteries, increase myocardial blood supply, and relieve angina pectoris. Some patients may experience adverse reactions such as palpitations, nausea, and vomiting after taking acetylphylline tablets. If the symptoms are mild, special treatment is generally not required, and they usually resolve on their own after stopping the medication. If the symptoms are severe, it is recommended that patients stop taking the medication immediately and seek medical treatment in a timely manner.

[0027] Thiocolchicoside is a potent competitive GABAA antagonist (IC 50 =145nM). Inhibits cerebral vasospasm after subarachnoid hemorrhage. Inhibits osteoclastogenesis induced by NF-κB receptor activator, breast cancer and multiple myeloma cells. Shows muscle relaxant and anti-inflammatory effects in vivo. Orally active.

[0028] Existing drugs have a low affinity for SpCas9, which means that the regulatory efficacy is not high and may not be able to achieve high-level regulation in vivo. However, the drugs provided in this application have been proven to be able to enter and regulate the human body under safe conditions and have a high affinity for SpCas9.

[0029] 3. According to the literature review in the early stage, the binding of galadium iodide, chloranil, ethophylline, and thiocolchicoside to SpCas9 has a significant effect on its ability to bind or cut substrates. The application of galadium iodide, chloranil, ethophylline, thiocolchicoside and their combination provided in this application in inhibiting the binding or cutting of SpCas9 to substrates can extend the clinical application of SpCas9 and increase the clinical medication window, so as to improve doctors' application methods of SpCas9 drugs and continuously adjust clinical medication plans. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The electrophoresis diagrams of galactoside (2471), chloranil (5017), ethoxyphylline (5029), and thiocolchicoside (5049) inhibiting CRISPR / Cas9 from cutting target DNA, respectively, and BRD0539 is a positive control;

[0031] Figure 2 This is the electrophoresis diagram of the dose-dependent inhibition of CRISPR / Cas9 cleavage of target DNA by galactamium iodide, and BRD0539 is the positive control;

[0032] Figure 3 This is a surface plasmon resonance (SPR) experimental result of the combination of galactarium iodide and SpCas9 complex; the lines in the figure are cycle 13 (500 μm), cycle 12 (100 μm), cycle 11 (50 μm), cycle 10 (25 μm), cycle 9 (12.5 μm), cycle 8 (6.25 μm), cycle 7 (3.12 μm) from top to bottom, among which cycles 7, 8, 9, 10, 11, and 12 overlap into one line;

[0033] Figure 4 The electrophoresis diagram shows that closanamide inhibits CRISPR / Cas9 from cutting target DNA in a dose-dependent manner, and BRD0539 is a positive control;

[0034] Figure 5 This is a surface plasmon resonance (SPR) experimental result of the binding of chloranilamide to the SpCas9 complex; the lines in the figure are cycle 13 (500 μm), cycle 12 (100 μm), cycle 11 (50 μm), cycle 10 (25 μm), cycle 9 (12.5 μm), and cycle 8 (6.25 μm) from top to bottom;

[0035] Figure 6 The electrophoresis diagram shows that the ethoxyphylline inhibits CRISPR / Cas9 from cutting target DNA in a dose-dependent manner, and BRD0539 is a positive control;

[0036] Figure 7This is a surface plasmon resonance (SPR) experimental result diagram of the binding of ethoxyphylline to the SpCas9 complex; the lines in the figure are cycle 6 (1.56 μm), cycle 7 (2.125 μm), cycle 10 (25 μm), cycle 8 (5.25 μm), cycle 9 (12.5 μm), and cycle 11 (50 μm) from top to bottom;

[0037] Figure 8 This is the electrophoresis diagram of thiocolchicoside dose-dependently inhibiting CRISPR / Cas9 from cleaving target DNA, and BRD0539 is the positive control;

[0038] Fig. 9 The figure is a surface plasmon resonance (SPR) experimental result of the combination of thiocolchicoside and SpCas9 complex; the lines in the figure are cycle 13 (500μm), cycle 12 (100μm), cycle 11 (50μm), cycle 10 (25μm), cycle 9 (12.5μm), cycle 8 (6.25μm), cycle 7 (3.125μm), cycle 6 (1.56μm) from top to bottom; cycle 15 is a repeated experiment of cycle 6, and the two lines overlap;

[0039] Fig.10 The electrophoresis diagrams show that positive compounds BRD0539 and BRD7586 inhibit CRISPR / Cas9 from cutting target DNA.

[0040] Fig.11 This is the electrophoresis diagram of the positive drug BRD7586 dose-dependently inhibiting CRISPR / Cas9 from cutting the target DNA;

[0041] Fig.12 This is a surface plasmon resonance (SPR) experimental result of BRD0539 binding to SpCas9 complex; the lines in the figure are cycle 13 (500μM), cycle 12 (100μM), cycle 11 (50μM), cycle 10 (25μM), cycle 9 (12.5μM), cycle 8 (6.25μM), and cycle 7 (3.125μM) from top to bottom.

[0042] Fig.13 This is a surface plasmon resonance (SPR) experimental result diagram of the binding of BRD7586 to the SpCas9 complex; the lines in the figure are cycle 9 (12.5μM), cycle 8 (6.25μM), cycle 7 (3.125μM), cycle 6 (1.56μM), cycle 5 (0.78μM), and cycle 4 (0.36μM) from top to bottom.

[0043] Fig.14This is the electrophoresis diagram of the combined use of galamate, chloranilamide, ethophylline, and thiocolchicoside to inhibit CRISPR / Cas9 from cutting the target DNA;

[0044] Fig.15 Flow cytometry of galantamine, chloranilamide, ethoxyphylline, and thiocolchicoside inhibiting CRISPR / Cas9 cleavage of target DNA (B2M gene) and inhibiting its protein expression in the cell system. (B) is the treatment group of DOX (doxycycline)-induced expression of SpCas9, transfection of control sgRNA, and addition of DMSO solvent, (C) is the treatment group of DOX-induced expression of SpCas9, transfection of sgRNA targeting B2M gene, and addition of DMSO solvent, (D) is the treatment group of DOX-induced expression of SpCas9, transfection of sgRNA targeting B2M gene, and addition of positive control compound 1 (BRD0539), (E) is the treatment group of DOX-induced expression of SpCas9, transfection of sgRNA targeting B2M gene, and addition of positive control compound 2 (BRD7586) (F) is the treatment group in which sgRNA targeting B2M gene was transfected under the premise of DOX-induced expression of SpCas9, and iodonium iodide (2471) was added; (G) is the treatment group in which sgRNA targeting B2M gene was transfected under the premise of DOX-induced expression of SpCas9, and chloranil (5017) was added; (H) is the treatment group in which sgRNA targeting B2M gene was transfected under the premise of DOX-induced expression of SpCas9, and ethoxyphylline (5029) was added; (I) is the treatment group in which sgRNA targeting B2M gene was transfected under the premise of DOX-induced expression of SpCas9, and thiocolchicoside (5049) was added.

[0045] Note: Figure 3 , Figure 5 , Figure 7 , Fig. 9 , Fig.12 and Fig.13 The digital symbols of Cycle in the figure indicate the detection curve of the coupling affinity between Cas9 protein and small molecule drugs under different drug concentration conditions. 2471 is Gallamine Triethiodide, 5017 is Oxyclozanide, 5029 is Etofylline, and 5049 is Thiocolchicoside.

[0046] The DNA is the target DNA cut by CRISPR / Cas9 in the kit (Yinmao Shengye PC-1400). DETAILED DESCRIPTION

[0047] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified.

[0048] Example 1

[0049] 1. Verification experiment of the inhibitory effect of compounds on CRISPR / Cas9 DNA cleavage

[0050] In order to verify the inhibitory effect of the drug on the DNA cutting of Cas9, we first carried out an enzyme cleavage reaction in a cell-free system, using the PC-1400 kit from Innovent Biologics and the method provided in the kit manual to perform an in vitro enzyme cleavage experiment. The enzyme cleavage efficiency was then verified by agarose gel electrophoresis, using the PCDNA and PC sgRNA in the kit.

[0051] First, use enzyme-free PCR tubes and enzyme-free pipette tips to conduct the experiment: add 5μL (1U / μL) of Cas9 protein, 5μL (1μg / μL) of PC sgRNA, 10μL (1μg / μL) of PC DNA, 1.2μL of small molecule compounds or solvents, and 2.4μL of 10×Cas9 Buffer to each sterile enzyme-free test tube, and then blow and mix. This process is carried out on ice. The specific groups are as follows:

[0052] A negative control group (solvent group) was set up: containing 1.2 μL of DMSO solvent, 5 μL of Cas9 protein (1 U / μL), 5 μL of PCsgRNA (1 μg / μL), 10 μL of PC DNA (1 μg / μL), and 2.4 μL of 10×Cas9 Buffer. The mixture was then blown and mixed. The whole process was carried out on ice.

[0053] Positive control group 1 (BRD0539): contains 1.2 μL of 1 mM BRD0539, 5 μL of Cas9 protein (1 U / μL), 5 μL of PC sgRNA (1 μg / μL), 10 μL of PC DNA (1 μg / μL), and 2.4 μL of 10×Cas9 Buffer. Then blow and mix well. The whole process was carried out on ice.

[0054] Positive control group 2 (BRD7586): contains 1.2 μL of 1 mM BRD7586, 5 μL (1 U / μL) of Cas9 protein, 5 μL (1 μg / μL) of PC sgRNA, 10 μL (1 μg / μL) of PC DNA, and 2.4 μL of 10×Cas9 Buffer. Then blow and mix well. The whole process is carried out on ice.

[0055] Target drug group: Add 1.2μL of the corresponding small molecule drug with a concentration of 1mM, 5μL of Cas9 protein (1U / μL), 5μL of PCsgRNA, 10μL of PC DNA, and 2.4μL of 10×Cas9 Buffer. Then blow and mix evenly. The whole process is carried out on ice. The small molecule drug is any one of galamonium iodide, chloranilamide, ethophylline, and thiocolchicoside.

[0056] Combined drug group (ALL): Four small molecule drugs with a concentration of 1mM were added, 0.3μL of each, Cas9 protein 5μL (1U / μL), PC sgRNA 5μL, PC DNA 10μL, 10×Cas9 Buffer 2.4μL. Then blow and mix well, and the whole process was carried out on ice. The small molecule combined drugs were galamonium iodide, chloranilamide, ethophylline, and thiocolchicoside mixed in equal volumes.

[0057] Use a metal bath at 37°C for 30 minutes, then treat at 85°C for 10 minutes to complete the in vitro enzyme digestion reaction. After the enzyme digestion reaction, the product was detected and 5 μL of TIANGEN was added to each group. TM Protein K (20 mg / mL), this step was mixed on ice, and incubated in a metal bath at 56°C overnight. Prepare 2% agarose gel (add 4 μL YeaRed Nucleic Acid Gel Stain CAT: 10202ES76 (Yeasen Yisheng Biology) to every 40 mL of agarose gel solution).

[0058] Take 10 μL of the reaction product for electrophoresis detection, and take 3 μL of Takara DL2000 marker. When performing agarose gel electrophoresis, the condition is a constant voltage of 150V for 30 minutes. After the electrophoresis is completed, color development is performed, and the position of the gel block is adjusted by white light. Then, when the white light is turned off, ultraviolet color development is performed with an exposure time of 500ms, and photos are taken for analysis. Lane 1D software is used for gel analysis, the photos are inverted, and the width is adaptively adjusted according to the lane width, and the lanes of all experimental groups, solvent groups, and PC groups are selected.

[0059] After lane adjustment, the bands were selected, the location of the residual DNA bands was selected, the selection box was controlled to be of the same size, the grayscale of the bands was read and the results were output to an Excel table, the band results were statistically analyzed in the Excel table, and the remaining amount of uncut bands and the remaining ratio of uncut bands were calculated respectively.

[0060] Calculation of cleavage efficiency and inhibition efficiency

[0061] (1) Cutting efficiency calculation formula: E = A1 / B1 × 100%;

[0062] Among them, E represents the cutting efficiency; A1 represents the gray value of the cutting product; B1 represents the gray value of the original DNA cutting product.

[0063] (2) The relative ratio of inhibition efficiency was calculated as follows: C = (F1-D1) / (G1-D1) × 100%;

[0064] Wherein, C represents the inhibition efficiency, F1 represents the gray value of the cleavage product of the experimental group, D1 represents the gray value of the cleavage product of DMSO, and G1 represents the gray value of the cleavage product of the positive control BRD0539 (BRD0539).

[0065] The results are shown in Table 1.

[0066] Table 1 Comparison results of cutting efficiency and inhibition efficiency

[0067]

[0068] The cleavage inhibition effects of positive drug BRD0539 and positive drug BRD7586 are shown in Fig.10 After treatment with the positive compounds BRD0539 and BRD7586, the gray value of the uncut DNA band was larger than that of the solvent group, indicating that the two positive control compounds did have the effect of inhibiting Cas9 from binding to or cutting target DNA.

[0069] The inhibitory cleavage effect of the target drug group can be found in Figure 1 .right Figure 1 The grayscale of the uncut DNA bands in each group was analyzed. The results showed that compared with the positive control drug BRD0539, the grayscale of the uncut DNA was stronger after treatment with the candidate compounds galamonium iodide (2471), chloranilamide (5017), ethophylline (5029) and thiocolchicoside (5049), indicating that pargyline hydrochloride, metadoxine and dimethyl fumarate have stronger inhibitory effects on Cas9 binding or cutting target DNA than the positive compounds.

[0070] The results of cleavage inhibition in the combined drug group are as follows Fig.14As shown, the ALL group displayed the electrophoresis results of uncut DNA after the combined use of galadinium iodide, chloranil, ethophylline and thiocolchicoside. It can be seen that the combined use of the four candidate compounds has more uncut DNA residues than any positive control compound, indicating that the combined use of galadinium iodide, chloranil, ethophylline and thiocolchicoside has a stronger inhibitory effect on Cas9 binding or cutting target DNA than the positive compound.

[0071] Example 2

[0072] Drug concentration gradient experiment

[0073] In order to verify that the candidate compounds have a dose-dependent effect on the inhibition of SpCas9, we performed an enzymatic cleavage reaction after gradient drug treatment in a cell-free system, using the PC-1400 kit from Innovent Biologics and the method provided in the kit manual to perform in vitro enzymatic cleavage experiments. The enzymatic cleavage efficiency was then verified by agarose gel electrophoresis. PC DNA and PC sgRNA in the kit were used here.

[0074] First, use enzyme-free PCR tubes and enzyme-free pipette tips to conduct the experiment: add 5μL (1U / μL) of Cas9 protein, 5μL (1μg / μL) of PC sgRNA, 10μL (1μg / μL) of PC DNA, 1.2μL of small molecule compounds or solvents, and 2.4μL of 10×Cas9 Buffer to each sterile enzyme-free test tube, then blow and mix well. The sample addition process is carried out on ice. The specific groups are as follows:

[0075] A negative control group was set up: containing 1.2 μL of DMSO solvent, 5 μL of Cas9 protein (1 U / μL), 5 μL of PC sgRNA (1 μg / μL), 10 μL of PC DNA (1 μg / μL), and 2.4 μL of 10×Cas9 Buffer. The mixture was then blown evenly, and the whole process was carried out on ice.

[0076] Positive control group 1 (BRD0539): contains 1.2 μL of 1 mM BRD0539, 5 μL of Cas9 protein (1 U / μL), 5 μL of PC sgRNA (1 μg / μL), 10 μL of PC DNA (1 μg / μL), and 2.4 μL of 10×Cas9 Buffer. Then blow and mix well. The whole process is carried out on ice.

[0077] Positive control group 2 (BRD7586): contains 1.2 μL of 1 mM BRD7586, 5 μL of Cas9 protein (1 U / μL), 5 μL of PC sgRNA (1 μg / μL), 10 μL of PC DNA (1 μg / μL), and 2.4 μL of 10×Cas9 Buffer. Then blow and mix well. The whole process is carried out on ice.

[0078] The target drug group is a reaction system in which 1.2 μL of corresponding small molecule drugs with concentrations of 1 mM, 750 μM, 500 μM, 250 μM, and 0 μM are added, 5 μL of Cas9 protein (1 U / μL), 5 μL of PC sgRNA (1 μg / μL), 10 μL of PC DNA (1 μg / μL), and 2.4 μL of 10×Cas9 Buffer are added. Then blow and mix evenly, and the whole process is carried out on ice. Among them, the small molecule drugs are galarium iodide, chloranilamide, ethoxyphylline, and thiocolchicoside; the corresponding concentrations of galarium iodide, chloranilamide, ethoxyphylline, and thiocolchicoside in the reaction system are 50 μM, 37.5 μM, 25 μM, 12.5 μM, and 0 μM, respectively.

[0079] Use a metal bath at 37°C for 30 minutes, then treat at 85°C for 10 minutes to complete the in vitro enzyme digestion reaction. After the enzyme digestion reaction, the product was detected and 5 μL of TIANGEN was added to each group. TM Protein K (20 mg / mL), this step was mixed on ice, and incubated in a metal bath at 56°C overnight. Prepare 2% agarose gel (add 4 μL YeaRed Nucleic Acid Gel Stain CAT: 10202ES76 (Yeasen Yisheng Biology) to every 40 mL of agarose gel solution).

[0080] Take 10 μL of the reaction product for electrophoresis detection, and take 3 μL of Takara DL2000 marker. When performing agarose gel electrophoresis, the condition is a constant voltage of 150V for 30 minutes. After the electrophoresis is completed, color development is performed, and the position of the gel block is adjusted by white light. Then, when the white light is turned off, ultraviolet color development is performed with an exposure time of 500ms, and photos are taken for analysis. Use Lane 1D software for gel analysis, invert the photos, and then adjust the width of the lanes adaptively according to the lane width, and select the lanes of all experimental groups, solvent groups, and positive control groups.

[0081] After lane adjustment, the bands were selected, the location of the residual DNA bands was selected, the selection box was controlled to be of the same size, the grayscale of the bands was read and the results were output to an Excel table, the band results were statistically analyzed in the Excel table, and the remaining amount of uncut bands and the remaining ratio of uncut bands were calculated respectively.

[0082] The results of the concentration gradient experiment of the positive drug BRD7586 are as follows Fig.11 As shown in the figure, the drug concentration in BRD0539 and BRD7586 is 50 μM, and the concentration gradient at the back shows that the inhibitory efficiency continues to increase with the increase of BRD7586 concentration, that is, the inhibitory effect is positively correlated with the concentration of BRD7586, showing dose dependence.

[0083] The results of the target drug group concentration gradient experiment are as follows Figure 2 , Figure 4 , Figure 6 and Figure 8 Shown

[0084] Specifically, Figure 2 It is shown that as the concentration of galactarium iodide (2471) increases, the amount of uncut DNA shows an upward trend, suggesting that the inhibitory effect of galactarium iodide on SpCas9 has a dose-dependent effect; Figure 4 It is shown that as the concentration of chloranil (5017) increases, the amount of uncut DNA shows an upward trend, indicating that chloranil has a dose-dependent effect on the inhibition of SpCas9; Figure 6 It is shown that as the concentration of ethoxyphylline (5029) increases, the amount of uncut DNA shows an upward trend, suggesting that the inhibitory effect of ethoxyphylline on SpCas9 has a dose-dependent effect; Figure 8 It is shown that with the increase of the concentration of thiocolchicoside (5049), the amount of uncut DNA shows an upward trend and remains stable after 25 μM, indicating that the inhibitory effect of thiocolchicoside on SpCas9 has a dose-dependent effect and reaches saturation at a lower concentration.

[0085] Example 3

[0086] Surface Plasmon Resonance (SPR) assay to detect affinity of Cas9 protein and candidate small molecule inhibitors

[0087] The instrument used for the SPR experiment was Biacore T200.

[0088] The binding test results of positive compound 1 (BRD0539) and positive compound 2 (BRD7586) with Cas9 protein are shown in Fig.12 and Fig.13 It is not difficult to find that at most concentrations, the SPR results of BRD0539 and BRD7586 are a straight line close to the X-axis, indicating that their binding force with SpCas9 is very weak.

[0089] The test results of the binding affinity between the target drug group and the Cas9 protein are as follows Figure 3, Figure 5 , Figure 7 and Fig. 9 As shown in the figure, the gradient represents that as the concentration of small molecules increases, their inhibitory ability to the CRISPR / Cas9 system continues to increase. Figure 3 It can be seen that the binding ability of the drug galactoside (2471) is the highest at 500 μM. Although it does not show a good gradient form, it is still better than the binding ability of BRD0539 and BRD7586. Figure 5 It can be seen that the affinity of the drug clomiphenecarboxamide (5017) shows an obvious binding gradient trend as the drug concentration changes; Figure 7 The affinity of ethoxyphylline (5029) did not change with the drug concentration, and did not show an obvious binding gradient trend, and remained at around 0. Fig. 9 The affinity of the traditional Chinese medicine thiocolchicoside (5049) is the largest at a drug concentration of 500 μM. Although it does not show a gradient trend, Fig.12 and Fig.13 Compared with BRD0539 and BRD7586, the affinity of positive control 1BRD0539 and positive control 2BRD7586 does not change with drug concentration, showing a straight line and in the range of 0, while the drug thiocolchicoside and drug cloranoxanide show a gradient form, which indicates that the affinity of drug thiocolchicoside and drug cloranoxanide to Cas9 protein is better than that of BRD0539 and BRD7586 (compared with Fig.12 and Fig.13 Compared with BRD0539 and BRD7586, the binding affinity of the drug ethoxyphylline and the drug galactoside to Cas9 is similar.

[0090] Figure 3 , Figure 5 , Figure 7 and Fig. 9 The results of SPR are the results of the drug binding to SpCas9 protein. The binding of the drug to SpCas9 can be seen from the figure. The binding of the drug ethoxyphylline and the drug galactoside to Cas9 is similar to the binding of the previously reported Cas9 inhibitors BRD0539 and BRD7586 ( Fig.12 , Fig.13 ), the binding force curves were maintained at around 0, but compared with positive drug 1BRD0539 and positive drug 2BRD7586, they showed stronger inhibition efficiency; the binding of drug thiocolchicoside and drug chloranilamide to Cas9 was stronger than that of the previously reported Cas9 inhibitor BRD0539 ( Fig.12 ) and BRD7586( Fig.13 ) expresses a stronger binding.

[0091] Example 4

[0092] Cell-level verification experiment of the inhibitory effect of compounds on CRISPR / Cas9 DNA cleavage

[0093] The experiment verified that the drug has an inhibitory effect on the DNA cutting effect of Cas9. A cell system experiment was conducted. HEK-293T cells induced by doxycycline to express Cas9 were used as working cells, transfected with SgRNA, and then the inhibitory efficiency of the drug was verified by flow cytometry.

[0094] There were blank group, solvent group (sgControl+solvent), negative control group (sgB2M+solvent), positive control group 1 (sgB2M+BRD0539), positive control group 2 (sgB2M+BRD7586) and drug group (sgB2M+candidate drug).

[0095] Preparation of lentivirus

[0096] (1) HEK-293T cell culture

[0097] HEK-293T cells were cultured in a 6 cm dish. When the cell density reached 70% to 80%, they could be used for transfection. New complete culture medium was replaced 2 hours before transfection.

[0098] Complete culture medium: DMEM (containing sodium pyruvate and glutamine), 10% fetal bovine serum (FBS), 1% antibiotics;

[0099] (2) Cell transfection

[0100] ①Use 1.5ml EP tube to prepare the following solutions:

[0101] Solution A: Add the following reagents in sequence and vortex to mix.

[0102] Opti-DMEM 250μL / dish

[0103] Lipo2000 10μL / dish

[0104] Solution B: Add the following reagents in sequence and vortex to mix.

[0105] Opti-DMEM 250μL / dish

[0106] Extracted pCW-Cas9 plasmid 4 μg / dish

[0107] psPAX2 plasmid 3 μg / dish

[0108] pMD2G plasmid 1 μg / dish

[0109] ② Add liquid A to liquid B drop by drop, mix well, and let stand at room temperature for 20 minutes;

[0110] ③ Add the suspension of solution A and solution B dropwise into the HEK-293T cell culture dish in step (1) for transfection, and culture at 5% CO2 and 37°C for 48 hours;

[0111] ④ Collect the virus supernatant and centrifuge at 2000rpm for 10 minutes, filter with a 0.45μm filter membrane, add the filtrate to a 50mL centrifuge tube (brand: ABC), centrifuge at 1000rpm for 10 minutes to obtain the lentivirus, and aliquot 1mL / tube for standby use or store at -80℃;

[0112] (3) Cell system construction:

[0113] HEK-293T cells were cultured in a 10 cm dish. When the cell density reached 50% to 60%, they could be used for infection. New complete culture medium was replaced 2 hours before transfection.

[0114] Using the lentivirus obtained in the previous step, the medium was changed (5 mL lentivirus + 5 mL DMEM complete medium) and cultured for 48 hours.

[0115] Infected HEK-293T cells were cultured in a culture dish. When the cells were close to 100% confluence, they were digested with trypsin for 2 minutes, mixed by pipetting, centrifuged at 800 rpm for 10 minutes, the supernatant was discarded, and the infected HEK-293T cells were suspended with complete culture medium, counted, and passaged to 6-well plates (1.0×10 6 cells / well), cultured for 24 hours, and when the cell density reached 60% to 70%, it could be used for drug screening (containing 2 μg / ml puromycin), and working cells HEK-293T-Cas cells were obtained after 48 hours of screening.

[0116] (4) Application of Cells at Work

[0117] Taking the solvent group (sgControl+solvent) as an example, the operation steps of other groups are the same except for the different sgRNA and drugs. (The sgRNA in positive control group 1, positive control group 2 and drug group is B2M-sgRNA (CCTCCATGATGCTTACATGT, recorded as SEQ ID NO.2))

[0118] Induce SpCas9 expression: The working cells were cultured at a rate of 1×10 6 Cells / well were plated in a 6-well plate, and the culture medium was replaced with 2 mL of DMEM complete medium (containing 4 μg / mL doxycycline (DOX)) after the cells adhered.

[0119] SgRNA transfection: DOX and 20 μL / well 10 mM compound were added, and sgRNA transfection was performed after 12 hours. 5 μg / well of Control-sgRNA (TTCAAGTCCGCCATGCCCGA, recorded as SEQ ID NO.1) was dissolved in 125 μL of serum-free and antibiotic-free DMEM culture medium with solution A, and 5 μL / well of solution B transfection reagent (InCellGene liponanofect) was dissolved in 125 μL of serum-free and antibiotic-free DMEM culture medium. After gently pipetting and mixing with a pipette, solution A was added dropwise to solution B, mixed, and allowed to stand at room temperature for 20 minutes. The suspension of the above solutions A and B was added dropwise to one well of a 6-well plate and cultured for 72 hours.

[0120] Collect cell samples: digest the cells with trypsin and resuspend them in 1× PBS. Count the cells and take 1×10 6 cells, washed three times with 1 mL of flow cytometry eluent, resuspended with 100 μL of flow cytometry eluent after each wash, and stained with 3 μL of B2M flow cytometry antibody (BiolegendAPC anti-humanβ2-microglobulin Antibody Clone: ​​A17082A) in a 4°C refrigerator away from light for 30 minutes. After staining, washed the cells again three times with flow cytometry eluent.

[0121] (5) Flow cytometry analysis:

[0122] After washing, the cells were resuspended in 1XPBS and flow cytometry was performed using Beckman Coulter Cytoflex CytExpert software. The blank group cells were used to select live cells for APC channel "gating", and the blank group cells were then used to analyze the cell samples of other groups.

[0123] Fig.15 The results of flow cytometry are shown. HEK-293T-Cas9 cells were used to set the gate for the APC cell channel. The numbers obtained after setting the gate represent the positive rate of B2M in the cells within the gate. The positive rate of B2M in the solvent group was 98.41% ( Fig.15 B), the positive rate of B2M obtained in the negative control group (sgB2M+solvent) was 43.55% ( Fig.15 C), the positive rate of B2M obtained in the positive control group (BRD0539) was 66.02% ( Fig.15 D), positive control group 2 (BRD7586) was 58.81% ( Fig.15 E), the positive rate of B2M obtained by the galactodonium iodide (2471) drug group was 64.55% ( Fig.15F), the positive rate of B2M in the closanitamide (5017) group was 49.94% ( Fig.15 G), the positive rate of B2M in the ethophylline (5029) group was 63.39% ( Fig.15 H), the positive rate of B2M in the thiocolchicoside (5049) group was 79.33% ( Fig.15 I).

[0124] The above results show that galamate, ethophylline, and thiocolchicoside all showed significantly better SpCas9 cleavage inhibitory activity than the positive compound BRD0539 and the positive compound BRD7586 at the cellular level; chloranilamide showed similar SpCas9 cleavage inhibitory activity to the positive compound BRD0539 and the positive compound BRD7586.

[0125] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0126] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0127] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. The use of galamonium iodide, chloranilamide, ethoxyphylline, and thiocolchicoside compounds in the preparation of products that inhibit SpCas9 from binding or cutting substrates, characterized in that: One or more of the above-mentioned galamate iodide, chloranilamide, ethoxyphylline and thiocolchicoside are used in combination; The concentration of galaminium iodide ranged from 1.56 to 500 μM; The concentration of closan was 1.56-500 μM; The concentration of ethoxyphylline was 1.56-500 μM; The concentration of thiocolchicoside was 1.56-500 μM.

2. The use according to claim 1, characterized in that: The product includes any one of galamate, chloranilamide, ethophylline and thiocolchicoside.

3. The use according to claim 2, characterized in that: The product also includes SpCas9 protein.

4. The use according to claim 3, characterized in that: The dosage ratio of iodine iodide, chloranilamide, ethoxyphylline, thiocolchicoside and SpCas9 is 0.25-1mmol:5U.

5. The use according to claim 1, characterized in that: The products include galamate, chloranilamide, ethoxyphylline, and thiocolchicoside.

6. The use according to claim 5, characterized in that: The product also includes SpCas9 protein.

7. The use according to claim 6, characterized in that: The total dosage ratio of iodine iodide, chloranilamide, ethoxyphylline, and thiocolchicoside to SpCas9 is 0.25-1mmol:5U.

8. The use according to claim 7, characterized in that: When inhibiting binding or cleavage, use the PC-1400 kit from ImmunoSynthetics.

9. The use according to claim 1, characterized in that: The reaction system for inhibiting binding or cleavage is 5 μL of Cas9 protein, 5 μL of PC sgRNA, 10 μL of PC DNA, 1.2 μL of drug or solvent, and 2.4 μL of 10×Cas9 Buffer.

10. The use according to claim 1, characterized in that: When inhibiting binding or cleavage, incubate at 37°C for 30 minutes and at 85°C for 10 minutes for enzyme cleavage.

Images