Application of Leclercia adcarboxatica

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to an application of Leclercia adcarboxcarboxy XK6, the strain is Leclercia adcarboxcarboxy XK6, the nucleotide sequence of 16S rDNA of the Leclercia adcarboxcarboxy XK6 is shown as SEQ ID NO: 1, and the Leclercia adcarboxcarboxy XK6 is used for degrading the content of nicotine in tobacco leaves and improving the content of part of aroma substances. The strain is separated from the surface of cinnabar tobacco and identified, and experiments prove that the strain shows excellent degradation efficiency within the nicotine concentration range of 1.0-5.0 g / L and shows the potential of efficiently degrading nicotine in tobacco leaves. In addition, the nicotine degradation capacity of the Leclercia adcarboxcarboxata in the tobacco leaves is determined, and a new thought is provided for improving the content of aroma substances in the tobacco leaves. By applying the strain, nicotine in tobacco leaves can be effectively degraded, meanwhile, the aroma characteristic of the tobacco leaves is improved, and a new thought is provided for development of low-nicotine high-aroma tobacco products.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to application of non-decarboxylation Luxenbergia. Background Art

[0002] In the tobacco industry, new flue-cured tobacco leaves need to be aged to improve their quality. Tobacco leaf aging is a process in which the environment, chemistry, enzymes and microorganisms work together, in which microbial factors act throughout. During the aging of tobacco leaves, the metabolic activities of microorganisms can consume proteins, cellulose and starch in tobacco leaves, thereby improving the quality of tobacco and ultimately meeting the quality requirements of cigarettes. Therefore, applying microorganisms to the aging process of tobacco leaves is an important way to improve the quality of tobacco leaves. Patent (CN201910175200.3) provides a method that can be used to artificially age flue-cured tobacco to improve the aroma of flue-cured tobacco, and can also be used as a fertilizer enhancer for tobacco planting, which has certain value. Patent (CN202210896326.1) significantly increases the content of volatile substances (especially caryophyllene) by transforming the gene encoding the transcription factor LaMYC7 into tobacco.

[0003] Cinnabar tobacco is a natural variation of fine tobacco varieties during their growth, and is a high-quality tobacco raw material for developing high-end Chinese cigarette brands. Cinnabar tobacco is famous for its low nicotine content and high content of nornicotine and myosamine, but its formation mechanism is still unclear, and there are a series of problems in the large-scale production of Cinnabar tobacco. Summary of the invention

[0004] The purpose of the present invention is to provide an application of non-decarboxylative Leclercia (Leclercia adecarboxylat), screened out a microorganism with high efficiency in degrading nicotine and producing aroma substances from cinnabar tobacco leaves, and further explored its application in the process of improving the flavor and quality of tobacco leaves, providing new ideas for the development of low-nicotine and high-aroma tobacco products.

[0005] To achieve the above objectives, this application is implemented through the following technical solutions: The invention discloses an application of non-decarboxylating Luxenbergia to degrade the nicotine content in tobacco leaves and increase the content of some aroma substances.

[0006] Furthermore, the strain is non-decarboxylative Luxenbergia XK6, and the nucleotide sequence of its 16S rDNA is shown in SEQ ID NO:1.

[0007] Furthermore, the strain was isolated from the surface of Kunming Shilin Zhusha No. 2 flue-cured tobacco.

[0008] Furthermore, the strain contains aldehyde oxidase activity, and the amino acid sequence of the aldehyde oxidase is shown in SEQ ID NO:2.

[0009] Further, it is used to degrade nicotine in the range of 1.0-3.0g / L.

[0010] Furthermore, after treatment with non-decarboxylating Luxenbergia, the total content of tobacco aroma substances, nornicotine, myosamine, cotinine and 2,3-cyclopentapyridine increased by 70%-100%.

[0011] Furthermore, the non-decarboxylation Luxenbergia bacteria is cultured in LB medium supplemented with 500 mg / L nicotine for 12 hours and then sprayed on the surface of common flue-cured tobacco to act.

[0012] Furthermore, the spraying amount of the non-decarboxylated Luxenbergia is 1%-10%.

[0013] Furthermore, after spraying the non-decarboxylating Luxenbergia, the mixture was fermented in a constant temperature and humidity environment for 12-120 h.

[0014] Furthermore, the temperature of the constant temperature and humidity environment is 20-50°C, and the humidity is 40-70%.

[0015] The beneficial effects of the present invention are: The highly efficient flavor-enhancing non-decarboxylating Luxenbergia obtained by the present invention is not only an excellent nicotine-degrading strain, but also has certain potential applications in improving the quality of flue-cured tobacco. The test results show that the aroma substance content of tobacco leaves treated with non-decarboxylating Luxenbergia is significantly improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a gel image of the extracted non-decarboxylation Luxembourg 16S rDNA.

[0017] Figure 2 Phylogenetic tree of non-decarboxylating Luxenbergia sp.

[0018] Figure 3 This is a graph showing the nicotine degradation ability of non-decarboxylating Luxenbergia strains. DETAILED DESCRIPTION

[0019] The technical solution of the present invention is described in detail below in conjunction with the accompanying drawings. The following embodiments are merely exemplary and can only be used to explain and illustrate the technical solution of the present invention, but cannot be interpreted as limiting the technical solution of the present invention.

[0020] The present application provides a strain that efficiently degrades nicotine and increases the content of aroma substances, the strain is non-decarboxylation Luxenbergia XK6, and the nucleotide sequence of its 16S rDNA is shown in SEQ ID NO: 1. The efficient aroma-enhancing strain is isolated from the surface of Kunming Shilin Zhusha No. 2 flue-cured tobacco. The efficient aroma-enhancing strain contains aldehyde oxidase activity, and the amino acid sequence of its aldehyde oxidase is shown in SEQ ID NO: 2.

[0021] The application of the high-efficiency flavor-enhancing strain in the present application in improving the quality of tobacco leaves, the high-efficiency flavor-enhancing strain is used in the tobacco leaf aging process to improve the quality of flue-cured tobacco.

[0022] The application of the high-efficiency flavor-enhancing strain in improving the quality of tobacco leaves comprises the following specific steps: (1) taking the strain out from -80°C and streaking it on an LB solid culture medium for recovery. After overnight culture, a single colony is picked and cultured in 5 mL LB liquid culture medium for 12-16 h; (2) inoculating the seed liquid into 50 mL LB liquid culture medium at a ratio of 1%, and culturing it at 37°C, 220RPM for 16 hours; (3) collecting the bacterial cells at 4°C, 6000 RPM, 10 min; (4) resuspending the bacterial cells with deionized water to prepare a bacterial suspension, and spraying it on about 100 g of tobacco leaves at a spraying amount of 1%-10%; (5) fermenting the bacterial cells at a temperature of 25-50°C and a humidity of 40-70%, and the fermentation time is 48-120 h. The fermentation product of the high-efficiency flavor-enhancing strain can metabolize nicotine in tobacco leaves into aroma substances, thereby improving the quality of tobacco leaves.

[0023] The above-mentioned high-efficiency flavor-enhancing strain Leclercia adecarboxylat is separated and screened by the following initial screening method: first weigh about 2 g of red sand tobacco leaves, place them in 10 mL of sterilized nicotine culture medium and ultrapure water, mix them thoroughly in an oscillator, and culture them in a shaker at 30°C and 37°C for 48 h. Then gradually dilute the culture solution to an appropriate concentration, and take five concentrations of bacterial solution, 10-1, 10-2, 10-3, 10-4, and 10-5, as the object of plating plate culture bacteria, and spread them on the plate culture medium, 3 plates for each gradient, and after plating, culture them in a constant temperature incubator at 30°C and 37°C for 1-2 days, and pick up full single colonies for further streaking separation and purification.

[0024] Luria-Bertani (LB) medium components: 10.0 g / L tryptone, 5.0 g / L yeast extract, 10.0 g / L sodium chloride, 16.0 g / L agar, sterilized by high pressure steam at 121 °C for 20 min.

[0025] Nicotine culture medium components: K2HPO4 13.3 g / L, KH2PO4 4.0 g / L, (NH4)2SO4 0.01 g / L, yeast powder 1.0 g / L, nicotine 0.5 g / L; trace element solution 10.00 mL (MgSO4•7H2O 1 g, MnSO4•H2O 0.40 g, CaCl2 0.15 g, CuCl2•2H2O 0.20 g, FeSO4•7H2O 0.02 g, dissolved to 100 mL with 0.10 mol / L HCL), dissolved in distilled water and sterilized at 121 °C under high pressure for 20 min.

[0026] Method for determining aldehyde oxidase activity: Pick a single colony from the plate and culture it in 5 mL LB liquid medium for 12-16 h to obtain seed liquid. Inoculate the seed liquid into 50 mL LB liquid medium at a ratio of 1% and culture it at 37 ℃, 220RPM for 16 hours. Centrifuge at 4 ℃, 6000 RPM for 10 min, then resuspend in PBS buffer (pH=7.0) and use an ultrasonic cell disruptor to disrupt the cells, and further centrifuge at 4 ℃ to collect the supernatant. Enzyme activity is defined as the amount of enzyme required to produce 1 mol of cotinine per minute as 1U. The reaction system is: take a certain amount of crude enzyme solution, add 100 mM 1-methyl-5-(3-pyridyl)pyrrolidin-2-ol, react at 30 ℃, 220 RPM for 1 h, and then detect the cotinine concentration.

[0027] The bacterial 16S rDNA was amplified using the universal primers for bacterial species identification: 27F: GAGAGTTTGATCCTGGCTCAG; 1492R: TACGGCTACCTTGTTACGAC for species identification, and it was found that the strain was non-decarboxylating Luxenbergia, and the 16S rDNA nucleotide sequence of the strain was shown in SEQ ID NO: 1.

[0028] The cell morphological characteristics and physiological and biochemical properties of non-decarboxylative Luxenbergia are: Gram-negative bacteria, short and thin in shape, simple in structure, mostly reproduced by binary fission, with a diameter between 0.5 and 5 μm, and the optimal growth temperature is 37 ℃.

[0029] Example 1 Screening and separation of microorganisms on the surface of cinnabar smoke: Cinnabar tobacco leaves naturally stored in Yunnan were cut into pieces under sterile conditions, about 2.0 g was weighed, and placed in 20 mL of sterilized nicotine culture medium. After being fully mixed in an oscillator, the mixture was cultured in a shaker at 37 °C and 200 RPM for 48 h. The culture solution was then diluted in a gradient, and five concentrations of bacterial suspensions, 10-1, 10-2, 10-3, 10-4, and 10-5, were taken as the objects of coating culture and spread on various nicotine plate culture media. Three plates were coated for each gradient, 0.1 mL of bacterial solution was added to each plate, and the plates were cultured in a constant temperature incubator at 30-37 °C for 2 days. Single colonies with full colonies were picked for re-streak isolation.

[0030] After preliminary screening, 26 strains with good growth were obtained from cinnabar tobacco. Subsequently, we further screened the 26 strains by measuring their nicotine degradation ability. The strains were picked into LB medium containing 2g / L nicotine, and the remaining nicotine in the medium was measured after culturing for 12 hours under the same conditions to calculate the nicotine degradation rate. The detection method of nicotine is high performance liquid chromatography detection, specifically: the chromatographic column is Agilent ZORBAX Eclipse Plus C18 (4.6×250mm, 5μm), UV detector, detection wavelength: 259nm. A: methanol; B: 1mM sulfuric acid; elution program is A:B=10:90 (V:V); elution temperature: 30℃; flow rate: 0.6mL / min; injection volume 10μL.

[0031] Example 2 Analysis of cell morphological characteristics and physiological and biochemical characteristics of non-decarboxylating Luxenbergia: The cell morphological characteristics and physiological and biochemical properties of non-decarboxylating Luxenbergia strains were analyzed by using microscopes and physiological and biochemical experiments. It was found that the colonies of non-decarboxylating Luxenbergia were moist, convex, shiny, smooth, with neat edges, non-sticky, easy to pick, with a diameter of 0.5-5 μm, and the optimal growth temperature was 37 ℃. According to the determination of physiological and biochemical characteristics, the bacteria were Gram-negative and could utilize a variety of sugars, such as dextrin, D-maltose, D-trehalose, D-cellobiose, gentiobiose, sucrose, D-turanose, stachyose, melibiose, β-formyl-D-glucoside, D-salicin, N-acetyl-D-glucosamine, N-acetyl-β-D-mannosamine, N-acetyl-D-galactosamine, N-acetylneuraminic acid, α-D-glucose, and D-mannose.

[0032] Example 3 Amplification and determination of 16S rDNA nucleotide sequence of non-decarboxylating Luxenbergia: TSINGKE Plant DNA Extraction Kit (Universal) was used. The specific steps were as follows: Place the Spin Column in the Collection Tube, add 250 μL Buffer BL, and centrifuge at 12,000 rpm / min for 1 min to activate the silica gel membrane; Take the sample dry tissue (no more than 20 mg), add liquid nitrogen and grind it thoroughly. After grinding, place in a 1.5 mL centrifuge tube, add 400 μL Buffer gP1, vortex for 1 min, and place in a 65℃ water bath for 10 to 30 min. During this period, the cells can be taken out and mixed by inversion to fully lyse; add 150 μL Buffer gP2, vortex for 1 min, and place in an ice bath for 5 min; centrifuge at 12,000 RPM for 5 min, and transfer the supernatant to a new centrifuge tube; add an equal volume of anhydrous ethanol to the supernatant, immediately vortex and mix thoroughly, transfer all the liquid to the Spin Column, centrifuge at 12,000 RPM for 30 s, and discard the waste liquid; add 500 μL Buffer Pw (anhydrous ethanol has been added before use) to the Spin Column, centrifuge at 12,000 RPM for 30 s, and discard the waste liquid; add 500 μL Wash Buffer (anhydrous ethanol has been added before use) to the Spin Column, centrifuge at 12,000 RPM for 30 s, and discard the waste liquid; repeat step 7; place the Spin Column Put it back into the Collection Tube, centrifuge at 12,000 RPM for 2 minutes, open the lid and dry for 1 minute; take out the Spin Column, put it in a clean centrifuge tube, add 50 ~ 100 μL TE Buffer (preheat TE Buffer at 65℃) to the center of the adsorption membrane, let it stand at 20 ~ 25℃ for 2 minutes, and centrifuge at 12,000 RPM for 2 minutes. The extracted DNA sample was diluted appropriately and used as a PCR template. The bacterial 16S rDNA was amplified by the universal primers for bacterial identification (27F: 5'-GAGAGTTTGATCCTGGCTCAG-3'; 1492S: 5'-TACGGCTACCTTGTTACGAC-3') for analysis and identification. Take 1 L of PCR product for verification on 1% agarose gel and send it to Qingke Biotechnology Co., Ltd. for sequencing ( Figure 1 Finally, the sequencing results were compared and analyzed in the NCBI database, and the results showed that the bacteria had a 99% similarity with Leclerciaadecarboxylata strain XK6 ( Figure 2 ), the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0033] Example 4 Non-decarboxylation Luxenbergia spraying and fermentation treatment on tobacco leaves: The non-decarboxylation Luxenbergia grown overnight on solid culture medium was selected and placed in 5 mL of LB medium containing 500 mg / L, and cultured at 37 °C and 220 RPM for 12-16 h to obtain seed solution, and then the seed solution was inoculated into 100 mL of the above culture medium at a 2% inoculation ratio (v / v), and continued to be cultured for 24 h to obtain fermentation broth, and the fermentation broth of the strain was centrifuged at 5000 RPM for 10 min, resuspended with an equal volume of sterile water and sprayed, and the same volume of sterile water was used for control experiments. Sprayed on the surface of 100 g of tobacco leaves at a volume / mass ratio of 5%, and fermented in an incubator at 25 °C and 40% relative humidity for 12 h, 24 h, 48 h, 72 h, 96 h, and 120 h, respectively. The nicotine degradation rate in tobacco leaves and the changes in the total content of nornicotine, myosamine, cotinine, and 2,3-cyclopentene pyridine were detected and calculated. The results showed that the nicotine content in tobacco decreased after being treated with non-decarboxylating Luxenbergia spp. The optimal spraying ratio was 5% and the fermentation time was 96 h. Figure 3 As shown in Figure 2, after being fermented by non-decarboxylating Luxenbergia, the nicotine content of tobacco leaves decreased, and the total content of aroma substances such as nornicotine, myosamine, cotinine and 2,3-cyclopentapyridine increased by 70%-100%, and the highest content could reach 100%.

[0034] Comparative Example 1 The specific implementation method is as in Example 4, except that the non-decarboxylated Luxenbergia was not added, and an equal volume of PBS buffer was used for spraying and fermentation, and the changes in the content of nicotine and some aroma substances in tobacco leaves were detected. The results showed that when the bacterial solution was replaced with PBS buffer, the fermentation treatment of tobacco leaves was not effective, and the nicotine and aroma substances inside did not change significantly. This shows that the non-decarboxylated Luxenbergia used in the invention can significantly reduce the nicotine content in tobacco leaves and increase some aroma substances, thereby improving the quality of tobacco leaves.

[0035] Comparative Example 2 Specific implementation method is as in Example 4, except that the non-decarboxylated Luxenberg culture solution in Example 4 was sprayed on the surface of 100 g of tobacco leaves at a volume / mass ratio of 1% and 10%, and the tobacco leaves were fermented under the same conditions, and the processing time and other parameters were the same as in Example 4. The results showed that when the spraying ratio was 1%, the non-decarboxylated Luxenberg could also degrade nicotine in tobacco leaves to a certain extent, but its nicotine degradation rate was only 36.7% of that in Example 4. Similarly, when the spraying ratio was 10%, the nicotine degradation rate was only 84.3% of that in Example 4. For the total content of aroma substances such as nornicotine, myosamine, cotinine and 2,3-cyclopentapyridine, after the tobacco leaves were fermented at spraying ratios of 1% and 10%, their total contents only reached 20.4% and 67.8% in Example 4. This indicates that although non-decarboxylative Luxenbergia can degrade the nicotine content in tobacco leaves and improve the quality of tobacco leaves, there is an optimal spraying amount. A larger spraying amount may further affect the microbial balance on the surface of tobacco leaves, resulting in unsatisfactory improvement effects.

[0036] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. An application of non-decarboxylation Luxenbergia, characterized in that: Used to degrade the nicotine content in tobacco leaves and increase the content of some aroma substances.

2. The use of non-decarboxylation Luxenbergia according to claim 1, characterized in that: The strain is non-decarboxylative Luxenbergia XK6, and the nucleotide sequence of its 16S rDNA is shown in SEQ ID NO:

1.

3. The use of non-decarboxylation Luxenbergia according to claim 2, characterized in that, The strain was isolated from the surface of Kunming Shilin Zhusha No. 2 flue-cured tobacco.

4. The use of non-decarboxylation Luxenbergia according to claim 2, characterized in that: The strain contains aldehyde oxidase activity, and the amino acid sequence of the aldehyde oxidase is shown in SEQ ID NO:

2.

5. The use of non-decarboxylation Luxenbergia according to claim 1, characterized in that: Used to degrade nicotine in the range of 1.0-3.0g / L.

6. The use of non-decarboxylation Luxenbergia according to claim 1, characterized in that: After treatment with non-decarboxylating Luxenbergia, the total content of tobacco aroma substances, nornicotine, myosamine, cotinine and 2,3-cyclopentapyridine increased by 70%-100%.

7. The use of non-decarboxylation Luxenbergia according to claim 1, characterized in that: The non-decarboxylation Luxenbergia bacteria is cultured in LB medium added with 500 mg / L nicotine for 12 hours and then sprayed on the surface of common flue-cured tobacco to act.

8. The use of non-decarboxylation Luxenbergia according to claim 7, characterized in that: The spraying rate of non-decarboxylated Luxembourg bacteria is 1%-10%.

9. The use of non-decarboxylation Luxenbergia according to claim 8, characterized in that: After spraying non-decarboxylative Luxenbergia, fermentation is carried out in a constant temperature and humidity environment for 12-120 hours.

10. The use of non-decarboxylation Luxenbergia according to claim 9, characterized in that: The temperature of the constant temperature and humidity environment is 20-50 ℃ and the humidity is 40-70%.

Images