GJB2 promoter sequence as well as vector and application thereof

Abstract

The invention discloses a GJB2 promoter sequence as well as a vector and application thereof. The promoter sequence is any one of the following nucleotide sequences: 1) a sequence SEQ ID NO.1 in a sequence table; and 2) a DNA sequence which has more than 85% of homology with the sequence SEQ ID NO.1 in the sequence table and has the same function with the sequence SEQ ID NO.1 in the sequence table. The sequence provided by the invention is operably linked to a target gene to drive the specific expression of the target gene in an inner ear supporting cell, plays an important role in otology research, particularly in inner ear gene therapy, can be used for treating subjects suffering from hearing loss or vestibular dysfunction or at risk of hearing loss or vestibular dysfunction, and can be used for treating the subjects suffering from hearing loss or vestibular dysfunction. Wide application prospects and clinical values are realized.

Description

Technical Field

[0001] The present invention belongs to the field of gene therapy in the medical field. More specifically, the present invention relates to a polynucleotide sequence of a specific promoter of inner ear supporting cells that is different from other reported polynucleotide sequences, as well as a vector comprising the polynucleotide sequence and its application. The polynucleotide sequence can be used to promote the expression of transgenes in inner ear supporting cells, such as cochlear supporting cells and / or vestibular supporting cells. A method for achieving transgene expression in supporting cells using the polynucleotide sequence and vector of the present invention, as well as verification of related safety are also disclosed. Background Art

[0002] Hearing loss is a disease caused by abnormalities in the auditory system. It is one of the most common sensory or functional defects in humans. The most common type of hearing loss is sensorineural hearing loss, which is caused by abnormalities in inner ear cells (such as cochlear hair cells and supporting cells) or nerve conduction pathways extending from the inner ear to the central brain. More than 150 genes, including OTOF, GJB2, STRC, TMC1, SLC26A4, ACTG1, CCDC50, etc., have been found to be associated with deafness, including autosomal recessive, autosomal dominant and X-linked genetic mutations. At the same time, factors that destroy the development and survival integrity of cochlear supporting cells, such as gene mutations, diseases or infections, ototoxic drugs, head trauma and aging, can also affect the development and survival integrity of vestibular cells, thereby causing vestibular dysfunction (such as vertigo, dizziness and imbalance).

[0003] Supporting cells are a very important cell type in the mammalian inner ear. They are morphologically distinct and have specific anatomical locations in the organ of Corti. Deiter cells provide structural support to the outer hair cells, which are located at the top of the cochlea and have direct connections with the Deiter cell layer. Pillar cells from the tunnel of Corti are located between the inner and outer hair cells. Hensen cells and Claudius cells are located on the sides of the outer hair cells. Structurally, the pillar cells and Deiters cells have a series of specialized scaffolding microfilaments called microtubule rods that provide strong structural support for the hair cells. The inner and outer pillar cells form the triangular tunnel of Corti, which is the main skeletal structure of the organ of Corti. On the apical surface of the sensory epithelium, the cell membranes of hair cells and supporting cells are connected together by tight junctions and adhesions to form the reticular plate. The tight junctions between hair cells and supporting cells on the reticular plate are essential for maintaining the structural integrity of the organ of Corti. In order to ensure the different ionic environments of the endolymph and perilymph, supporting cells not only provide a physical barrier but also play an active role in regulating ion homeostasis. The structural integrity and rigidity of the sensory epithelium in the organ of Corti depend on extracellular adhesion between supporting cells and the basement membrane. In addition, supporting cells have stem cell properties and can be induced to give rise to new hair cells.

[0004] In recent years, the development of gene therapy using AAV as a delivery vector has provided a new approach for the radical cure of hearing loss and vestibular dysfunction. However, there is still a lack of methods to specifically target supporting cells. Therefore, it is urgent to develop new therapies that target supporting cells to treat sensorineural hearing loss and vestibular dysfunction. Summary of the invention

[0005] At present, there is no method for efficiently and accurately delivering target genes to inner ear supporting cells using various viral / non-viral vectors. In order to solve the above problems, the present invention provides DNA sequences, compositions or methods for promoting the expression of target genes, such as genes that promote or improve supporting cell function or survival, in specific types of supporting cells.

[0006] The compositions and methods described herein relate to polynucleotide sequences that regulate transcription of transgenes in inner ear supporting cells, such as cochlear supporting cells and / or vestibular supporting cells.

[0007] The polynucleotide sequence of the present invention can be connected before the therapeutic transgene to regulate the specific expression of the transgene (or target gene). At the same time, the therapeutic system containing the polynucleotide sequence can be injected into the inner ear of the patient to prevent or treat hearing loss and / or vestibular dysfunction.

[0008] Alternatively, the promoter sequence of the present invention can be used to drive various gene therapy tools to be specifically expressed in supporting cells, and gene editing methods can be used to restore hearing loss and / or vestibular dysfunction caused by gene mutation or deletion.

[0009] The first technical solution provided by the present invention is a GJB2 promoter, the sequence of which is a sequence that supports cell-specific expression. Wherein: the promoter has one of the following nucleotide sequences:

[0010] 1) the nucleotide sequence of SEQ ID NO.1 (i.e., DNA sequence);

[0011] 2) A nucleotide sequence that has more than 85% homology (such as 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology) with the nucleotide sequence of SEQ ID NO.1 and has the same function.

[0012] Preferably, the above-mentioned GJB2 promoter comprises any of the following nucleotide sequences:

[0013] a) a nucleotide sequence of SEQ ID NO.1 in the sequence listing in which one or more nucleotides are substituted, deleted and / or added, and which can exhibit promoter activity;

[0014] b) a nucleotide sequence that hybridizes with the nucleotide sequence of SEQ ID NO. 1 in the sequence listing under stringent conditions and can exhibit promoter activity;

[0015] c) A nucleotide sequence having 85% or more homology with the nucleotide sequence of a) or b) and having promoter activity.

[0016] The GJB2 promoter is operably linked to a transgene and is capable of inducing transgene expression (or target gene expression) when introduced into supporting cells.

[0017] The present invention provides a second technical solution, which is a polynucleotide containing the promoter described in the first technical solution.

[0018] In some embodiments, the polynucleotide is a gene expression cassette comprising:

[0019] (1) The promoter described in the first technical solution;

[0020] (2) Target gene, which can encode the nucleotide sequence of protein or polypeptide;

[0021] (3) Regulatory elements.

[0022] In some embodiments, the gene of interest comprises nucleotides encoding a therapeutic protein.

[0023] Preferably, the target gene comprises nucleotides encoding a fluorescent protein, a functional protein or a therapeutic protein.

[0024] More preferably, the target gene comprises GFP fluorescent protein, GJB2 functional protein, and Cas9 therapeutic protein.

[0025] Preferably, the target gene is selected from one or more of: GJB2, WFS1, MYH14, SMPX, Lgr5, GFAP, Fgfr3, Tak1, PLP1, Bace2, Ceacam16, Fabp3, Clu, Rbp7, Mmp15, Sparc, Crhr1, Gdf6, Plxnb2, DCDC2, CEACAM16 and Mpzl2.

[0026] The protein encoded by the target gene is one or more of ZNF, TELEN, CRISPR-Cas and gene editing tool enzymes related to CRISPR-Cas.

[0027] Preferably, the gene editing tool enzyme associated with CRISPR-Cas is a base editor (BE) or a lead editor (PE).

[0028] Furthermore, the gene editing tool enzyme associated with CRISPR-Cas is an adenine single base editor, a cytosine single base editor or a lead editor.

[0029] The third technical solution provided by the present invention is a biological material carrier carrying the promoter described in the first technical solution or the polynucleotide described in the second technical solution.

[0030] Specifically, the biomaterial carrier comprises the promoter and target gene described in the first technical solution or the polynucleotide of the second technical solution, and an expression vector; wherein the promoter sequence is operably linked to the target gene, for example, operably linked before the target gene.

[0031] In some embodiments, the gene of interest comprises nucleotides encoding a therapeutic protein.

[0032] Preferably, the target gene comprises nucleotides encoding a fluorescent protein, a functional protein or a therapeutic protein.

[0033] More preferably, the target gene comprises GFP fluorescent protein, GJB2 functional protein, and Cas9 therapeutic protein.

[0034] Preferably, the transgene is selected from one or more of: GJB2, WFS1, MYH14, SMPX, Lgr5, GFAP, Fgfr3, Tak1, PLP1, Bace2, Ceacam16, Fabp3, Clu, Rbp7, Mmp15, Sparc, Crhr1, Gdf6, Plxnb2, DCDC2, CEACAM16 and Mpzl2.

[0035] The protein encoded by the transgene is one or more of ZNF, TELEN, CRISPR-Cas and gene editing tool enzymes related to CRISPR-Cas.

[0036] Preferably, the gene editing tool enzyme associated with CRISPR-Cas is a base editor (BE) or a lead editor (PE).

[0037] Furthermore, the gene editing tool enzyme associated with CRISPR-Cas is an adenine single base editor, a cytosine single base editor or a lead editor.

[0038] Preferably, the expression vector is a vector carrying AAV rep and cap genes and a helper virus vector, and the two are packaged into an AAV vector.

[0039] More preferably, the vector carrying AAV rep and cap genes includes at least one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, rh-AAV10, AAV10, AAV11, AAV12, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.eB, PHP.S, PHP.B, PHP.ie, AAV-DJ, AAV-ie and AAV-ie-K558R.

[0040] More preferably, the helper virus vector is an adenovirus or herpes virus helper virus vector, preferably a pHelper plasmid.

[0041] Preferably, the biological material is a virus, a transposon, a plasmid, a cosmid, a bacteriophage, an engineered bacterium, an artificial stain or a host cell.

[0042] Preferably, the viral vector is selected from one or more of an adeno-associated virus (AAV) vector, a lentiviral vector, a recombinant adeno-associated virus (rAAV) vector, a recombinant herpes simplex virus (rHSV) vector and an adenoviral vector.

[0043] Preferably, the transposon vector is selected from one or more of a PiggyBac (PB) transposon vector, a Sleeping Beauty (SB) transposon vector, a Frog Prince (FP) transposon vector, and a Tol2 transposon vector.

[0044] In some embodiments, the host cell is a cell line capable of viral replication and stable inheritance, including but not limited to Hela-S3, HEK-293, HEK-293T, HEK-293FT, A549 and Sf9 cells. Further, the host cell is HEK 293 or HEK-293T cell.

[0045] The fourth technical solution provided by the present invention is a composition, which contains the promoter described in the first technical solution, the polynucleotide described in the second technical solution, or the biomaterial carrier described in the third technical solution.

[0046] Preferably, the composition further comprises a pharmaceutically acceptable excipient.

[0047] The fifth technical solution provided by the present invention is a kit, which comprises the promoter described in the first technical solution, the polynucleotide described in the second technical solution, the biomaterial carrier described in the third technical solution, or the composition described in the fourth technical solution.

[0048] The sixth technical solution provided by the present invention is a method for increasing the expression of proteins in mammalian supporting cells in vitro, particularly a method for non-therapeutic applications, the method comprising contacting the mammalian supporting cells with the biomaterial carrier of the third technical solution, or the composition described in the fourth technical solution, or the kit described in the fifth technical solution.

[0049] In one embodiment, the protein is a therapeutic protein.

[0050] Preferably, the expression of the protein is specifically increased in supporting cells. Preferably, the expression of the protein is substantially not increased in inner ear cells that are not supporting cells.

[0051] Preferably, the mammalian Sertoli cells are human Sertoli cells, monkey Sertoli cells, pig Sertoli cells, mouse Sertoli cells, rat Sertoli cells or guinea pig Sertoli cells.

[0052] Further, the mammalian supporting cells are cochlear supporting cells; more preferably, the cochlear supporting cells are at least one of inner pillar cells (IPC), outer pillar cells (OPC), inner interdigital cells (IPhC), inner sulcus cells (ISC), outer sulcus cells (OSC), inner marginal cells (IBC), Claudius cells (CC), Hensen cells (HC), Deiters cells (DC) and Boettcher cells (BC).

[0053] The seventh technical solution provided by the present invention is the use of the promoter described in the first technical solution, or the polynucleotide described in the second technical solution, or the biomaterial carrier described in the third technical solution, or the composition described in the fourth technical solution, or the kit described in the fifth technical solution in the preparation of products for deafness diseases, hearing loss or hearing function abnormalities.

[0054] Preferably, the deafness disease or hearing impairment or hearing dysfunction is caused by hearing loss which may be caused by genetic factors, such as autosomal dominant hearing loss, autosomal recessive hearing loss, or X-linked hearing loss; at the same time, the hearing loss may also be acquired, such as hearing loss caused by noise, aging, disease, drugs, trauma and other factors.

[0055] Furthermore, the deafness disease or hearing loss or hearing dysfunction is caused by gene mutations in inner ear cells including supporting cells.

[0056] Furthermore, the deafness disease or hearing loss or hearing dysfunction is caused by a gene mutation including the GJB2 gene, and the mutation includes but is not limited to base substitution, frameshift mutation, deletion mutation, insertion mutation, etc.

[0057] In another aspect, the acquired hearing loss is noise-induced hearing loss, age-related hearing loss, ototoxic drug-induced hearing loss, disease or infection-related hearing loss, or head trauma-related hearing loss.

[0058] Preferably, the product is a medicine.

[0059] Furthermore, the drug can be in any dosage form, including but not limited to injection form and ointment form.

[0060] Furthermore, in the drug, the viral vector is the only active ingredient.

[0061] Furthermore, the drug may also contain common solvents, buffers, such as common drug carriers and adjuvants, including but not limited to: neutral salt buffer, acidic salt buffer, alkaline salt buffer, glucose, mannose, mannitol, protein, polypeptide and amino acid, antibiotics, chelating agents, adjuvants or preservatives. One or more.

[0062] The buffer may be a phosphate buffer, a Tris buffer, a 0.01% poloxamer PBS buffer solution or a HEPES buffer.

[0063] Furthermore, in the drug, the active ingredient may also be contained in other carriers, such as nanoparticles, liposomes and positive lipid particles.

[0064] Further, the drug is administered to one ear or both ears. Preferably, the drug is administered to one ear.

[0065] Furthermore, when administering to one ear, the administration method is cochlear injection, including but not limited to round window injection and semicircular canal injection of the cochlea.

[0066] Furthermore, a single or multiple administration for life, with a total dose of 1×10 9 -1×10 13 A viral genome.

[0067] The present invention also provides a method for treating or preventing hearing loss, which is achieved by administering an effective dose of the biomaterial carrier described in the third technical solution or the composition described in the fourth technical solution to a subject. The hearing loss may be caused by genetic factors, such as autosomal dominant hearing loss, autosomal recessive hearing loss, or X-linked hearing loss; at the same time, the hearing loss may also be acquired, such as hearing loss caused by noise, aging, disease, drugs, trauma and other factors.

[0068] The present invention also provides a method for treating or preventing vestibular dysfunction, which is achieved by administering an effective dose of the biomaterial carrier described in the third technical solution or the composition described in the fourth technical solution to a subject, wherein the vestibular dysfunction includes vertigo, dizziness or imbalance.

[0069] The eighth technical solution provided by the present invention is the use of the promoter described in the first technical solution, or the polynucleotide described in the second technical solution, or the biomaterial carrier described in the third technical solution, or the composition described in the fourth technical solution, or the kit described in the fifth technical solution in evaluating the effectiveness of drugs for inner ear cell-related diseases.

[0070] The ninth technical solution provided by the present invention is the use of the promoter described in the first technical solution, or the polynucleotide described in the second technical solution, or the biomaterial carrier described in the third technical solution, or the composition described in the fourth technical solution, or the kit described in the fifth technical solution in the preparation of a product that promotes the regeneration of mammalian hair cells and / or supporting cells.

[0071] The tenth technical solution provided by the present invention is the use of the promoter described in the first technical solution, or the polynucleotide described in the second technical solution, or the biomaterial carrier described in the third technical solution, or the composition described in the fourth technical solution, or the kit described in the fifth technical solution in the preparation of a product for alleviating damage to hair cells and / or supporting cells caused by ototoxic drugs.

[0072] The present invention provides an eleventh technical solution, which is a method for promoting hair cell regeneration in mammals in vitro, which is achieved by contacting the biomaterial carrier described in the third technical solution, or the composition described in the fourth technical solution, or the kit described in the fifth technical solution with mammalian hair cells. In some embodiments, the hair cells are cochlear hair cells; in other solutions, the hair cells are vestibular hair cells.

[0073] The twelfth technical solution provided by the present invention is a method for preventing or reducing hair cell damage or death caused by ototoxic drugs, which is achieved by contacting the biomaterial carrier described in the third technical solution, or the composition described in the fourth technical solution, or the kit described in the fifth technical solution with hair cells. In some embodiments, the ototoxic drugs include one or more of the following drugs: aminoglycosides (e.g., gentamicin, neomycin, streptomycin, tobramycin, kanamycin, vancomycin and amikacin, etc.), anti-tumor drugs (e.g., platinum chemotherapy drugs, such as cisplatin, carboplatin and oxaliplatin), ethacrynic acid, furosemide, salicylates (e.g., high-dose aspirin) and quinine. In some embodiments, the hair cells are cochlear hair cells, and in some schemes, the hair cells are vestibular hair cells.

[0074] The present invention also provides a method for treating tinnitus, which is achieved by administering an effective dose of the biomaterial carrier described in the third technical solution of the present invention, or the composition described in the fourth technical solution to a subject.

[0075] The thirteenth technical solution provided by the present invention is a method for preventing or reducing hair cell damage or death, which is achieved by contacting the biomaterial carrier described in the third technical solution, or the composition described in the fourth technical solution, or the kit described in the fifth technical solution with hair cells.

[0076] Further, in an embodiment of any of the aforementioned aspects, the method further comprises a step of assessing the subject's hearing, such as auditory brainstem response (ABR), electrocochleography (ECOG), etc., before administering the biomaterial carrier, composition or pharmaceutical preparation.

[0077] Further, in an embodiment of any of the foregoing aspects, the method further includes a step of evaluating the subject's vestibular function before administering the biomaterial carrier, composition or pharmaceutical preparation, such as electronystagmogram (ENG), videonystagmogram (VNG), posturography, rotary-chair testing, ECOG, vestibular evoked myogenic potentials (VEMP) or a specialized clinical balance test.

[0078] Further, in embodiments of any of the foregoing aspects, the biomaterial carrier, composition or pharmaceutical preparation may be administered topically (eg, to the inner ear, such as into the perilymph or endolymph, such as through the round window, lateral wall or semicircular canals).

[0079] Further, in any of the embodiments of the aforementioned aspects, the biomaterial carrier, composition or pharmaceutical preparation is administered in a certain amount to prevent or reduce hearing loss, prevent or reduce vestibular dysfunction, prevent or reduce tinnitus, improve hearing, improve vestibular function, improve supporting cell function, prevent or reduce supporting cell damage, loss or death, etc.

[0080] On the other hand, the present invention also provides a method for evaluating the effectiveness of drugs for inner ear cell-related diseases, which is achieved by administering an effective dose of the biomaterial carrier of the present invention, or the composition of the present invention, or the pharmaceutical preparation of the present invention to a subject, which can be regarded as one of the applications of the above-mentioned treatment / prevention method.

[0081] Beneficial effects:

[0082] The present invention provides a GJB2 promoter capable of specifically targeting inner ear supporting cells, and a vector and application thereof. The present invention utilizes the GJB2 promoter sequence specifically expressed in supporting cells to accurately regulate the expression range of the target gene, and can further improve the safety of gene therapy using viruses such as AAV as delivery vectors. It plays an important role in otology research, especially in inner ear gene therapy, and can be used to treat subjects with hearing loss or vestibular dysfunction or at risk thereof, thereby having great application potential in gene therapy for deafness associated with inner ear hair cells, and has broad application prospects and clinical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0083] Figure 1 Schematic diagram of the “specific promoter-transgene” expression cassette;

[0084] Figure 2 pAAV-GJB2 promoter-GFP plasmid map;

[0085] Figure 3 Map of GFP expression specifically in supporting cells after inner ear microinjection (slide);

[0086] Figure 4 Map of GFP expression specifically in supporting cells after inner ear microinjection (section);

[0087] Figure 5 After inner ear microinjection of pAAV-GJB2-GFP, both the injected ear and the contralateral ear maintained normal hearing, indicating that the GJB2 promoter has a very high safety. DETAILED DESCRIPTION

[0088] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described below are only used to explain the present invention and are not used to limit the present invention.

[0089] Definition

[0090] As used herein, "about" refers to a value within 10% above or below the stated value.

[0091] As used herein, "expression" refers to one or more of the following events:

[0092] (1) Generate RNA template from DNA sequence (through transcription);

[0093] (2) Processing of RNA transcripts (e.g., by splicing, editing, 5' end cap formation, or 3' end processing);

[0094] (3) translating RNA into polypeptides or proteins; and

[0095] (4) Post-translational modification of proteins or peptides.

[0096] As used herein, "supporting cell-specific expression" means that RNA transcripts or polypeptides are produced primarily in supporting cells (e.g., cochlear supporting cells and / or vestibular supporting cells) compared to other types of cells in the inner ear (hair cells, spiral ganglion neurons, glia, etc.). Supporting cell-specific expression of a transgene can be confirmed by comparing the expression (RNA or protein expression) of the gene of interest between various types of cells in the inner ear (supporting cells versus non-supporting cells) by any standard technique (e.g., quantitative RT-PCR, immunohistochemistry, Western blot, fluorescence detection of GFP, etc.). The expression of the gene of interest induced by a supporting cell-specific promoter is at least 50% greater (e.g., greater than 50%, 75%, 100%, 125%, 150%, 175%, 200% or more) in supporting cells than in at least 3 (e.g., 3, 4, 5, 6, 7, 8, 9, 10 or more) of the following inner ear cell types.

[0097] As used herein, "operably linked" means that a first molecule can be linked to a second molecule so that the former molecule affects the function of the latter molecule. The term "operably linked" includes the juxtaposition of two or more components (such as a promoter and another sequence element) so that both components function normally and allow the possibility that at least one component can mediate the function imposed on at least one of the other components.

[0098] As used herein, the term "plasmid" refers to an extrachromosomal circular double-stranded DNA molecule into which additional DNA segments can be attached. A plasmid is a vector, which is a nucleic acid molecule capable of transporting another nucleic acid to which it is attached. Some plasmids are capable of self-replication in the host cell into which they are transfected.

[0099] As used herein, "nucleic acid" and "polynucleotide" refer to a polymeric form of nucleosides of any length. Polynucleotides are generally composed of nucleosides naturally present in DNA or RNA (such as adenosine, thymidine, guanosine, cytidine, deoxyadenosine, deoxythymidine, deoxyguanosine and deoxycytidine) linked by phosphodiester bonds. The polynucleotides to which the present invention relates include single-stranded or double-stranded DNA or RNA. Furthermore, unless otherwise specified, the sequence direction of the polynucleotides given in the present invention is from 5' to 3'.

[0100] As used herein, "promoter" refers to a recognition site on DNA to which RNA polymerase binds. The polymerase drives transcription of the gene of interest.

[0101] As used herein, "percentage (%) of sequence identity" is defined as the percentage of nucleic acids or amino acids in a candidate sequence with a reference polynucleotide or polypeptide sequence after the sequences have been aligned and gaps introduced as necessary to achieve the maximum percentage of sequence identity. Alignment for determining the percentage of nucleic acid or amino acid sequence identity can be achieved in various ways within the capabilities of those skilled in the art, such as publicly available computer software such as BLAST, BLAST-2 or SnapGene, etc.

[0102] As used in the present invention, "transfection" refers to any of a variety of techniques commonly used to introduce exogenous DNA into prokaryotic or eukaryotic host cells, such as lipid transfection, puncture transfection, etc.

[0103] As used in the present invention, "patient" or "subject" refers to animals (e.g., mammals, such as humans), veterinary animals (e.g., cats, dogs, cattle, horses, sheep, pigs, etc.) and experimental animal models of diseases (e.g., mice, rats). Subjects can be subjects who have been diagnosed with hearing loss (e.g., sensorineural hearing loss) or vestibular dysfunction (e.g., dizziness, vertigo or imbalance), or subjects who are at risk of developing these conditions.

[0104] As used herein, "treatment" may include:

[0105] (1) preventing, delaying or reducing the incidence and / or likelihood of the development of at least one clinical or subclinical symptom in a person who is at risk of or susceptible to the condition, disorder or condition; or

[0106] (2) inhibiting the state, disorder or condition, i.e., preventing, reducing or delaying the development of at least one clinical or subclinical symptom of the disease or its recurrence; or

[0107] (3) Alleviate the disease and cause regression of a condition, disorder or disease or at least one clinical or subclinical symptom thereof.

[0108] The benefit to the subject is either statistically significant or at least noticeable to the patient or physician.

[0109] As used herein, the term "vector" includes biological material vectors, for example, DNA vectors, such as plasmids, cosmids or artificial chromosomes, RNA vectors, viruses or any other suitable replicons.

[0110] As used herein, the term "wild type" refers to the genotype with the highest frequency for a particular gene in a given organism.

[0111] The present invention provides an inner ear supporting cell specific promoter sequence (GJB2 promoter sequence) and its application, a vector containing the GJB2 promoter sequence, and the construction and application of the vector.

[0112] Described below are compositions and methods for specifically initiating gene expression in supporting cells (eg, cochlear supporting cells).

[0113] The present invention is characterized by a polynucleotide (ie, a nucleotide sequence) comprising the specific promoter, which is capable of specifically expressing a gene in cochlear supporting cells.

[0114] The invention also features biological material vectors comprising these promoter sequences operably linked to a polynucleotide encoding a polypeptide.

[0115] The compositions and methods described in the present invention can be used for polynucleotides that specifically express proteins in cochlear supporting cells, so the compositions described in the present invention can be administered to subjects (including mammalian subjects, such as humans) to treat conditions caused by dysfunction of supporting cells, such as hearing loss or tinnitus or vertigo.

[0116] In particular, the promoter is used to drive the overexpression of normal genes in supporting cells to restore hearing in hereditary deafness caused by gene mutation or deletion;

[0117] Alternatively, this promoter can be used to drive the specific expression of various gene therapy tools in supporting cells, and gene editing can be used to restore hearing due to hereditary deafness caused by gene mutation or deletion;

[0118] Or it can be used to specifically promote the transformation of supporting cells into hair cells to restore hearing due to hereditary deafness caused by gene mutation or deletion;

[0119] Or the application of the above-mentioned technology and method to prevent or treat acquired deafness.

[0120] The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0121] Unless otherwise specified, the materials and reagents used in the following examples were obtained from commercial sources.

[0122] Example 1: Generation of Support Cell-Specific Promoter Sequences

[0123] 1. Design of promoter sequence

[0124] It is known that the protein translated by the GJB2 gene is mainly expressed in the cochlear supporting cells. According to the sequence of the mouse GJB2 gene in NCBI (https: / / www.ncbi.nlm.nih.gov / gene / ), the conservative part of the non-coding sequence upstream of its translation region was analyzed to construct GJB2-1 (i.e., SEQ ID NO.1) and GJB2-2 (SEQ ID NO.2), and the two promoters selected the sequence 1-3628 bp upstream of the translation start site of the gene and the sequence 3600-7200 bp upstream of the translation start site, respectively.

[0125] Amplification primers were designed according to the SEQ ID NO.1 sequence, and appropriate homology arms were added in front of the primers according to the characteristics of the selected vector AAV plasmid and the target sequence GFP. The sequences of the upstream and downstream primers are as follows:

[0126] Upstream primer: CTGCGGCCGCACGCGTGGAGCTAGCAGTAGGGACGCGTGAGGTGCGA

[0127] Downstream primer:

[0128] GGCCTAGAGGATCCCCGGGGAATTCAATCGATGTTCGAATCCCAACTTGTCCTCTGGATG

[0129] GTTGGCA

[0130] Amplification primers were designed according to SEQ ID NO.2, and appropriate homology arms were added in front of the primers according to the characteristics of the selected vector and the target sequence. The sequences of the upstream and downstream primers are as follows:

[0131] Upstream primer: CTGCGGCCGCACGCGTGGAGCTAGCTTATTAACTATCCAGGGAGCCA

[0132] Downstream primer:

[0133] GGCCTAGAGGATCCCCGGGGAATTCAATCGATGTTCGAATCCCAACCCTCCTCGCACCTC

[0134] ACGCGTCCCTA

[0135] 2. Promoter GJB2 cloning

[0136] The genomic DNA of mouse C57BL / 6J strain was used as a template, and the GJB2 promoter fragment was amplified by PCR using upstream primers and downstream primers.

[0137] The amplification system is as follows:

[0138]

[0139] GJB2 promoter PCR procedure:

[0140]

[0141] After the PCR amplification product was confirmed by 0.8% agarose gel electrophoresis, the gel was cut to recover the target fragment, and the target fragment was sequenced for verification.

[0142] The sequencing results showed that the amplified sequence was the GJB2 promoter sequence, and its base sequence was shown in SEQ ID NO.1 and SEQ ID NO.2, thereby obtaining the GJB2-1 promoter.

[0143] Example 2: Construction of expression vector

[0144] 2.1. Construction of recombinant expression vector

[0145] The AAV plasmid containing green fluorescent protein (GFP) and other promoter CMV was cut off by using the Nhe1 and EcoR1 double enzyme digestion method according to the restriction sites near the original promoter sequence. Among them, the restriction endonuclease was purchased from NEB.

[0146] The enzyme digestion reaction system is as follows:

[0147]

[0148] The reaction system was incubated at 37°C for at least 2 hours, and the product was purified by gel electrophoresis.

[0149] The GJB2-1 promoter and the GJB2-2 promoter prepared in Example 1 were respectively linked to the plasmid backbone after enzyme digestion by homologous recombination. Figure 1 shown.

[0150] The ligation reaction system is as follows:

[0151]

[0152] The reaction system was incubated at 37°C for 1 hour and transformed into E. coli DH5α. After culturing at 37°C overnight, single clones were picked and shaken for 4 hours before being sent for sequencing. Then, the colonies with correct sequencing were expanded and plasmids were extracted to obtain pAAV-GJB21-GFP plasmids and pAAV-GJB22-GFP plasmids.

[0153] The constructed pAAV-GJB2-GFP plasmid map is as follows Figure 1 shown.

[0154] Example 3: Verification of specific promoter activity in vivo

[0155] 1. Virus preparation of recombinant expression vector:

[0156] [1] Prepare AAV capsid plasmid, pAAV-GJB2-GFP plasmid (pAAV-GJB21-GFP plasmid or pAAV-GJB22-GFP plasmid) and auxiliary plasmid of Example 2, and detect plasmid concentration

[0157] [2] Cultivate and expand HEK293T cells (15 cm dish). When the cell confluency reaches about 70%, use Lipo2000 or other transfection reagents to co-transfect the plasmid in step [1] into the cells, and continue culturing for 8 hours before changing the medium.

[0158] [3] Fresh culture medium was added during the culture intervals. After 96 hours of virus replication, the supernatant and cells were collected separately.

[0159] [4] The cells were repeatedly frozen and thawed in liquid nitrogen and 37°C warm bath to release the virus. The cells were centrifuged at 12,000 rpm / min for 10 min, the supernatant was collected, and mixed with the supernatant in (3).

[0160] [5] Nuclease was added to digest the nucleic acid, and PEG 8000 was added to mix to a final concentration of 5%, and the mixture was placed in a refrigerator at 4°C for more than 4 hours to precipitate.

[0161] [6] Wash the virus precipitate with 1× PBS and centrifuge at 12000 rpm / min for 10 min, repeating three times.

[0162] [7] Depending on the requirements of the vacuum ultracentrifuge and the loading capacity of the centrifuge tube, the virus was appropriately diluted with 1× PBS and then purified with iodixanol.

[0163] [8] Collect the virus and test the titer for later use.

[0164] The titer of the AAV-GJB2-GFP (AAV-GJB21-GFP or AAV-GJB22-GFP) finally obtained was 2E+13 GC / mL. In this example, AAV-CMV-GFP was used as a control group, and the CMV promoter was a pan promoter.

[0165] 3.2 In vivo detection of GJB2 promoter function

[0166] The constructed adeno-associated virus AAV-GJB2-GFP was microinjected into wild-type C57BL / 6 newborn mice (P0-2). Specifically, the drug was injected into the right cochlea through the round window membrane. Each mouse was given a single dose of 2×10 10The number of viral genomes (administering 2 μl of AAV-GJB2-GFP with a titer of 2E+13 GC / mL).

[0167] Two weeks after administration, mice were killed, cochlear tissue was peeled off, fixed with 4% paraformaldehyde at room temperature for 2 hours, and decalcified with 10% EDTA solution at room temperature for 4-6 hours. Before staining, permeabilize and block overnight with a mixture of 1% Triton X-100 PBS buffer and 10% donkey serum at 4°C. Incubate overnight at 4°C with anti-MYO7A, SOX2, GJB2, and GJB6 antibodies, and wash three times with 1% Triton X-100 PBS for 10 minutes each. Then incubate with the corresponding fluorescent secondary antibody at room temperature for 2 hours, stain the nucleus with DAPI at room temperature for 5 minutes, wash three times with 0.1% Triton X-100 PBS for 10 minutes each, and prepare the slices.

[0168] Finally, images were obtained using confocal fluorescence microscopy.

[0169] The results are as follows:

[0170] When using a pan-promoter, AAV-CMV-GFP expresses GFP in many cell types within the cochlea, including inner hair cells, outer hair cells, spiral ganglion neurons, and supporting cells. When using the supporting cell-specific promoter of the present invention, AAV-GJB2-GFP expresses GFP only in supporting cells (e.g., Figure 3 ).

[0172] In addition, further staining of sections showed that GFP was specifically expressed in inner ear supporting cells (such as Figure 4 shown).

[0173] In addition, in order to verify the safety of the GJB2 promoter sequence of the present invention, after microinjection of pAAV-GJB2-GFP into the inner ear of wild-type newborn mice (P0-2), compared with mice of the same age and strain without intervention, the injected ear and the contralateral ear maintained normal hearing, indicating that the GJB2 promoter sequence has a very high safety (e.g. Figure 5 shown).

[0174] Example 4: Administration of a composition comprising a biomaterial carrier containing a GJB2 promoter to a subject with sensorineural hearing loss

[0175] According to the methods disclosed herein, a physician skilled in the art can treat a patient, such as a human patient, with sensorineural hearing loss to improve or restore hearing.

[0176] To this end, a physician skilled in the art can administer to a human patient a composition comprising an AAV vector (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, rh-AAV10, AAV10, AAV11, AAV12, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.eB, PHP.S, PHP.B, PHP.ie, AAV-DJ, AAV-ie, and AAV-ie-K558R) containing a polynucleotide comprising the polynucleotide sequence of SEQ ID NO: 1 or a functional part or derivative thereof having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or higher sequence identity), is operably linked to a transgene encoding a therapeutic protein, and the polynucleotide operably linked to a transgene encoding a therapeutic protein can be GJB2, WFS1, MYH14, SMPX, LGR5, GFAP, FGFR3, TAK1, PLP1, BACE2, CEACAM16, FABP3, CLU, RBP7, MMP15, SPARC, CRHR1, GDF6, PLXNB2, DCDC2, CEACAM16 or MPZL2.

[0177] Compositions comprising AAV vectors can be administered to a patient by topical administration to the inner ear (eg, injection into the perilymph) to treat sensorineural hearing loss.

[0178] After the composition is administered to the patient, a skilled practitioner in the art can evaluate the expression of the therapeutic protein encoded by the transgene and the improvement of the patient's hearing function by a variety of methods. For example, a physician can monitor the patient's hearing by performing standard tests (such as audiometry, ABR, electrocochlear osmography (ECOG) and otoacoustic emissions) after administering the composition. Compared with the hearing test results before administering the composition, it is found that the patient shows an improvement in hearing in one or more tests after administering the composition, which indicates that the patient has a good response to treatment. Subsequent doses can be determined and administered as needed.

[0179] The above results indicate that the GJB2 promoter sequence of SEQ ID NO.1 of the present invention can specifically transcribe the expression of the target protein in the inner ear supporting cells.

[0180] In order to further improve the safety of gene therapy for supporting cell-related hereditary deafness, in view of the massive expression of GJB2 gene in supporting cells and the high incidence of GJB2 gene-related deafness patients, the present invention intends to construct an inner ear supporting cell-specific GJB2 promoter sequence.

[0181] The present invention designs two promoter sequences, SEQ ID NO.1 and SEQ ID NO.2, among which only SEQ ID NO.1 is effective, while the promoter of SEQ ID NO.2 is ineffective.

Claims

1. A GJB2 promoter, characterized in that The promoter has one of the following nucleotide sequences: 1) the nucleotide sequence shown in SEQ ID NO.1; 2) A nucleotide sequence having more than 85% homology with the nucleotide sequence shown in SEQ ID NO.1 and having the same function.

2. The GJB2 promoter according to claim 1, characterized in that Contains any of the following nucleotide sequences: a) a nucleotide sequence of SEQ ID NO.1 in which one or more nucleotides are substituted, deleted and / or added, and which exhibits promoter activity; b) a nucleotide sequence that hybridizes with the nucleotide sequence of SEQ ID NO. 1 under stringent conditions and exhibits promoter activity; c) a nucleotide sequence having 85% or more homology with the nucleotide sequence of a) or b) and having promoter activity.

3. A polynucleotide comprising the promoter according to claim 1 or 2.

4. The polynucleotide according to claim 3, characterized in that The polynucleotide is a gene expression cassette, and the gene expression cassette comprises: (1) The promoter according to claim 1 or 2; (2) Target gene, which can encode the nucleotide sequence of protein or polypeptide; (3) Regulatory elements.

5. The polynucleotide according to claim 4, characterized in that The target gene is a gene encoding a fluorescent protein, a gene encoding a functional protein, or a gene encoding a therapeutic protein.

6. The polynucleotide according to claim 5, characterized in that The target gene is selected from one or more of the following genes: GJB2, WFS1, MYH14, SMPX, Lgr5, GFAP, Fgfr3, Tak1, PLP1, Bace2, Ceacam16, Fabp3, Clu, Rbp7, Mmp15, Sparc, Crhr1, Gdf6, Plxnb2, DCDC2, CEACAM16 and Mpzl2; the protein encoded by the target gene is one or more of ZNF, TELEN, CRISPR-Cas and gene editing tool enzymes related to CRISPR-Cas.

7. A biomaterial carrier carrying the promoter according to claim 1 or 2 or the polynucleotide according to any one of claims 3 to 6.

8. The biomaterial carrier according to claim 7, characterized in that: The biological material is a virus, a transposon, a plasmid, a clay, a phage, an engineered bacterium, an artificial chromosome or a host cell.

9. The biomaterial carrier according to claim 8, characterized in that: The viral vector is an AAV vector, which is formed by packaging a vector carrying an AAV rep or AAV cap gene and a helper viral vector; The vector carrying the AAV rep or AAV cap gene includes at least one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, rh-AAV10, AAV10, AAV11, AAV12, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.eB, PHP.S, PHP.B, PHP.ie, AAV-DJ, AAV-ie and AAV-ie-K558R; The helper virus vector is an adenovirus or herpes virus helper virus vector.

10. The biomaterial carrier according to claim 8, characterized in that: The host cell is a Hela-S3 cell, a HEK-293 cell, a HEK-293T cell, a HEK-293FT cell, an A549 cell or a Sf9 cell.

11. A composition, characterized in that The composition comprises the biomaterial carrier according to any one of claims 7 to 10.

12. A kit, characterized in that: The kit comprises the biomaterial carrier according to any one of claims 7 to 10, or the composition according to claim 11.

13. Use of the promoter according to claim 1 or 2, or the polynucleotide according to any one of claims 3 to 6, or the biomaterial carrier according to any one of claims 7 to 10, or the composition according to claim 11, or the kit according to claim 12 in evaluating the effectiveness of drugs for inner ear cell-related diseases.

14. Use of the promoter according to claim 1 or 2, or the polynucleotide according to any one of claims 3 to 6, or the biomaterial carrier according to any one of claims 7 to 10, or the composition according to claim 11, or the kit according to claim 12 in the preparation of a drug for treating and / or alleviating deafness, hearing loss or hearing dysfunction.

15. Use of the promoter according to claim 1 or 2, or the polynucleotide according to any one of claims 3 to 6, or the biomaterial carrier according to any one of claims 7 to 10, or the composition according to claim 11, or the kit according to claim 12 in the preparation of a product for promoting the regeneration of mammalian hair cells and / or supporting cells.

16. Use of the promoter according to claim 1 or 2, or the polynucleotide according to any one of claims 3 to 6, or the biomaterial carrier according to any one of claims 7 to 10, or the composition according to claim 11, or the kit according to claim 12 in the preparation of a product for alleviating damage to hair cells and / or supporting cells caused by ototoxic drugs.

17. A method for increasing protein expression in mammalian supporting cells in vitro, characterized in that: The method comprises contacting mammalian supporting cells with the biomaterial carrier according to any one of claims 7 to 10, or the composition according to claim 11, or the kit according to claim 12.

18. A method for promoting the regeneration of mammalian hair cells and / or supporting cells in vitro, characterized in that: The biomaterial carrier according to any one of claims 7 to 10, or the composition according to claim 11, or the kit according to claim 12 is contacted with mammalian hair cells and / or supporting cells.

19. A method for alleviating hair cell and / or supporting cell damage caused by ototoxic drugs in vitro, characterized in that: The biomaterial carrier according to any one of claims 7 to 10, or the composition according to claim 11, or the kit according to claim 12 is contacted with hair cells and / or supporting cells.

Images