Bacillus velezensis BVFA21, and composition, fermentation method and application thereof

Abstract

The invention discloses bacillus velezensis BVFA21 as well as a composition, a fermentation method and application thereof, the strain is preserved in the China Center for Type Culture Collection with the preservation number of CCTCC NO: M2024623, and the preservation date is April 3, 2024. The bacterial strain has an antagonistic effect on Fusarium proliferatum, and the application method is as follows: a sterile fermentation broth of the bacterial strain BVFA21 is sprayed on the Bacillus velezensis BVFA21 and a fermentation product of the Bacillus velezensis BVFA21 on crop fruits, and metabolites of the Bacillus velezensis BVFA21 can effectively control the occurrence of plum diseases and reduce the possibility that plums are infected by various pathogenic fungi. Therefore, the strain has a wide application prospect in the field of biological prevention and control of plant diseases, and also has an extremely high development value in the aspect of development of biological prevention and control agents.

Description

Technical Field

[0001] The invention belongs to the technical field related to biological agriculture, and in particular relates to a new strain and its composition, a fermentation method, and the use thereof in biological control of plant diseases. Background Art

[0002] The existence of plant pathogenic fungi has seriously affected the healthy development of the agricultural industry. Plant pathogenic fungi refer to fungi that can parasitize plants and cause diseases. So far, more than 8,000 plant pathogenic fungi have been recorded, accounting for 80% of the total number of plant diseases, and the number of plant diseases caused by fungi has exceeded 30,000. Globally, plant pathogenic fungi will cause the yield of important crops such as grains, vegetables, and fruit trees to decrease by 10% to 30% every year, causing economic losses of hundreds of billions of dollars to global agriculture.

[0003] At present, various chemical fungicides and other chemical control methods are commonly and widely used in agriculture to reduce the impact of plant pathogenic fungi on agricultural production. Chemical control methods occupy an important position in agricultural production, with the advantages of quick effect, good prevention effect, and convenient operation. However, long-term excessive use of chemical fungicides will lead to the gradual emergence of the "3R" problems of pesticide residues, rampant pests, and biological resistance.

[0004] Most chemical pesticides are difficult to degrade in a short period of time after application, and will accumulate in large quantities in agricultural products and soil, which will not only pollute the environment but also affect human health. Long-term and irrational use of pesticides will accelerate the development of drug resistance in plant pathogenic fungi, resulting in the need to increase the amount of pesticides used in subsequent prevention and control, entering a vicious cycle until the prevention effect is greatly reduced and the disease becomes rampant again.

[0005] With the improvement of living standards, people are paying more and more attention to the quality and safety of agricultural products. Environmental friendliness, no residue, safety and high efficiency have become people's new requirements for pesticides. Microbial pesticides are favored by current new pesticide researchers because of their advantages such as no pollution, no residue, low prevention and control costs, and low resistance.

[0006] Among the numerous biocontrol microorganisms, Bacillus plays an important role. Its live bacteria and / or sterile fermentation liquid have highly effective antagonistic effects on a variety of plant pathogens, and are widely distributed and highly resistant to stress. Therefore, it is of great significance to find suitable Bacillus strains and extract highly effective and stable antibacterial components from their fermentation products for the prevention and control of plant pathogenic fungi. Summary of the invention

[0007] The present invention aims to provide Bacillus Velez subtilis BVFA21, its composition, fermentation method and use, especially use of the sterile fermentation liquid of Bacillus Velez subtilis BVFA21 in preventing and controlling crop diseases caused by Fusarium proliferatum.

[0008] According to the first main aspect of the present invention, a new strain of Bacillus velezensis BVFA21 is provided, which is deposited in the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China, postal code: 430072, telephone: 027-68754052) with the deposit number CCTCC NO: M2024623, the deposit date is: April 3, 2024, and the classification name is: Bacillus velezensis BvFA21.

[0009] Its 16S rDNA sequence is shown in Seq ID No.1.

[0010] According to a second main aspect of the present invention, there is provided a composition comprising the aforementioned Bacillus Velezii BVFA21 or a fermentation product or metabolite thereof.

[0011] As a preferred embodiment, in the aforementioned composition, the fermentation product or metabolite comprises a sterile fermentation broth containing p-methoxybenzoic acid.

[0012] According to a third main aspect of the present invention, there is provided a fermentation method for causing the aforementioned Bacillus Velez subtilis BVFA21 to produce p-methoxybenzoic acid, the method comprising the following steps:

[0013] S1, inoculating the Bacillus Velezii BVFA21 into NB medium, culturing for 36 hours under the conditions of temperature of 35° C., pH of 7.2, and a shaking speed of 180 rpm to prepare a seed solution;

[0014] S2, will grow to OD 600 The seed liquid of Bacillus Velezii BVFA21 with a concentration of 0.6 to 0.8 was inoculated into fresh YSB medium and fermented for 72 hours under the culture conditions of temperature of 37°C, pH of 7.2 and shaking speed of 200 rpm;

[0015] S3, collecting the fermentation broth and centrifuging it in a high-speed centrifuge at 4000 rpm for 30 min, filtering the supernatant twice with a 0.22 μm microporous filter membrane to obtain a sterile fermentation broth containing p-methoxybenzoic acid.

[0016] As a preferred embodiment, in the above method, the YSB medium comprises: 20.0 g sucrose, 20.0 g yeast extract, 15 g beef extract, 0.06 g MgSO4·7H2O, 0.009 g FeSO4·7H2O, 1000 mL distilled water, pH 7.2, and the inoculation amount of the Bacillus Velezii BVFA21 seed solution in the YSB medium is 3%.

[0017] According to the fourth main aspect of the present invention, there is provided a use of the aforementioned Bacillus Velezii BVFA21, which includes use in inhibiting pathogens, use in inhibiting crop diseases caused by pathogens, use in preparing pathogen inhibitors and use in preparing crop disease inhibitors caused by pathogens.

[0018] As a preferred embodiment, the aforementioned use is achieved by the antagonistic effect of the sterile fermentation broth containing p-methoxybenzoic acid prepared by the Bacillus Velez subtilis BVFA21 on Fusarium proliferatum.

[0019] As a preferred embodiment, in the aforementioned use, the use comprises spraying the sterile fermentation liquid of Bacillus Velez subtilis BVFA21 on crop fruits; the crop is plum.

[0020] As a preferred embodiment, in the aforementioned use, the use comprises spraying and / or root irrigation on the aerial parts of plants with the Bacillus Velez subtilis BVFA21, the fermentation product of the Bacillus Velez subtilis BVFA21, the metabolites of the Bacillus Velez subtilis BVFA21, the microbial agent prepared from the Bacillus Velez subtilis BVFA21 or its fermentation product or metabolites, and the disease inhibitor prepared from the Bacillus Velez subtilis BVFA21 or its fermentation product or metabolites, or any combination thereof.

[0021] Advantages and beneficial effects of the present invention:

[0022] The technical solution of the present invention screened and obtained Bacillus Velez subtilis BVFA21 for the first time. Experiments have shown that Bacillus Velez subtilis BVFA21, fermentation products of Bacillus Velez subtilis BVFA21, and p-methoxybenzoic acid, a metabolite of Bacillus Velez subtilis BVFA21, can effectively control the occurrence of plum diseases and reduce the possibility of plants being infected by pathogenic fungi. This shows that the strain has broad application prospects in the field of biological control of plant diseases and also has extremely high development value in the development of biological control agents. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, without paying creative labor, other drawings obtained based on these drawings still belong to the scope of the present invention.

[0024] Figure 1 The colony morphology of Bacillus Velezii BVFA21 in one embodiment of the present invention is shown (A: colony morphology on NA plate; B: partial view of colony morphology on NA plate; C: Gram staining);

[0025] Figure 2 The phylogenetic tree of 16sRNA (A) and gyrA (B) of Bacillus Velezii BVFA21 in one embodiment of the present invention is shown;

[0026] Figure 3 The growth curve of Bacillus Velezii BVFA21 in one embodiment of the present invention is shown;

[0027] Figure 4 The figure shows the inhibitory effect of Bacillus Velezii BVFA21 on plant pathogenic fungi in one embodiment of the present invention;

[0028] Figure 5 The figure shows the inhibitory effect of the aseptic fermentation liquid of Bacillus Velez subtilis BVFA21 on plant pathogenic fungi in one embodiment of the present invention;

[0029] Figure 6 The figures show the inhibitory effect of the crude liquid of Bacillus Velez subtilis BVFA21 on plant pathogenic fungi in one embodiment of the present invention (A: CK; B: 400 μg / mL; C: 200 μg / mL);

[0030] Figure 7 Shows Figure 6 Schematic diagram of the inhibitory rate of 200ug / ml and 400ug / ml active crude extracts of the medium strain BVFA21 against F. proliferatum;

[0031] Figure 8 shows a sample positive ion base peak diagram (BPC) in one embodiment of the present invention;

[0032] Fig. 9 shows a sample negative ion base peak diagram (BPC) in one embodiment of the present invention;

[0033] Fig.10The indoor toxicity test of p-methoxybenzoic acid against Fusarium solani in one embodiment of the present invention is shown (A: CK; B: 25 μg / mL; C: 50 μg / mL; D 100 μg / mL; E: 200 μg / mL; F: 400 μg / mL);

[0034] Fig.11 The indoor in vivo protective effect of the metabolite of Bacillus Velezii BVFA21 on anisic acid in one embodiment of the present invention is shown. DETAILED DESCRIPTION

[0035] The preferred embodiments of the present invention will be described in detail below in conjunction with the accompanying drawings so that the purpose, features and advantages of the present invention can be more clearly understood. It should be understood that the embodiments shown in the accompanying drawings are not intended to limit the scope of the present invention, but are only intended to illustrate the essential spirit of the technical solution of the present invention.

[0036] In the following description, certain specific details are set forth for the purpose of illustrating the various disclosed embodiments to provide a thorough understanding of the various disclosed embodiments. However, those skilled in the relevant art will recognize that the embodiments may be practiced without one or more of these specific details. In other cases, well-known devices, structures, and techniques associated with the present application may not be shown or described in detail to avoid unnecessarily obscuring the description of the embodiments.

[0037] References throughout the specification to "one embodiment" or "an embodiment" indicate that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of "in one embodiment" or "in an embodiment" in various places throughout the specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any manner in one or more embodiments.

[0038] The present invention provides a strain of Bacillus velez BVFA21 and a method and application thereof for producing a highly effective antibacterial substance p-methoxybenzoic acid, as shown in the attached Figure 1-9 As shown, the Bacillus Velez strain BVFA21 described in the present invention has been deposited in the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China, postal code: 430072, telephone: 027-68754052) on April 3, 2024, with the deposit number: CCTCC NO: M2024623.

[0039] Embodiment 1:

[0040] The plants involved in this embodiment are as follows:

[0041] (1) Plum.

[0042] The plant pathogenic fungi involved in the present invention are as follows:

[0043] (1) Fusarium proliferatum.

[0044] The culture medium and solution involved in the present invention are as follows:

[0045] NA medium: beef extract 5 g / L, peptone 10 g / L, NaCl 5 g / L, agar powder 20 g / L, sterile water 1000 mL.

[0046] LB: 5.0g yeast extract, 10.0g tryptone, 5.0g NaCl, 1000ml distilled water

[0047] PDA medium: 200 g potatoes, 20 g glucose, 17 g agar powder, 1000 mL sterile water.

[0048] YSB medium: sucrose 20.0 g, yeast extract 20.0 g, beef extract 15 g, MgSO4·7H2O 0.06 g, FeSO4·7H2O 0.009 g, and distilled water 1000 mL.

[0049] 1. Isolation of biocontrol strains

[0050] Test materials: From May to July 2023, 6 healthy fruits of disease-resistant or disease-tolerant plants were collected from a plum orchard with severe fruit spot disease in Duiwo Village, Zhenning Buyi and Miao Autonomous County, Anshun City, Guizhou Province (888.4 meters above sea level, 25.7847°N, 105.8968E), packed into sampling bags, numbered and sorted, and stored at 4°C for separation. (1) Isolation of endophytes in healthy plum fruits:

[0051] a. In a sterile operating table, clean the collected healthy honey plum fruits with sterile water and place them on sterile newspapers to dry. After drying, soak the plum fruits in 75% alcohol for 1 minute, rinse with sterile water 3-5 times, and then soak in 4% sodium hypochlorite for 4 minutes. Repeat the washing with sterile water at least three times to ensure that the sodium hypochlorite is rinsed clean and dried;

[0052] b. Remove the skin of the surface-sterilized plum fruit with a sterile knife and cut into 0.5-1 cm2 tissue blocks. Add 2-3 or more plum fruit tissue blocks to each 1.5 ml sterile centrifuge tube with sterile grinding beads, add 1 ml of sterile water, and place in a cryo-grinder at 60 Hz for 2 min;

[0053] c. After grinding, place in a constant temperature shaker at 37°C and 180r / min for 2h, dilute with sterile water to 10-2, 10-3, 10-4 and other different dilution multiples of plum fruit tissue suspension, then take 100μL of plum fruit tissue suspension and spread it on NA medium plate, culture in a constant temperature incubator at 28°C for 2-3d, take 100μL of sterile water used for the last washing of plum fruit and spread it on NA medium plate to check whether the surface disinfection is thorough;

[0054] d. Pick single colonies of different morphologies and purify them multiple times to obtain purified strains and number them. Inoculate the purified strains into NA slant medium and culture them at 28℃ for 24 hours and store them at 4℃ for future use. At the same time, inoculate the purified strains into LB liquid medium and culture them at 28℃ in a constant temperature shaker at 200r / min for 24 hours. Use 25% glycerol to preserve the bacterial solution and store it in a -80℃ refrigerator. 2. Identification of strains

[0055] (1) Identification of physiological and biochemical characteristics

[0056] Morphological observation and physiological and biochemical identification were determined according to the Manual of Common Bacterial System Identification. BVFA21 was drawn on the NA medium plate, such as Figure 1 The bacteria can grow in large quantities when cultured at 30℃~37℃ for 12h. The colonies are opaque milky white protrusions with dry and rough surfaces, irregularly rounded edges with wrinkles, and are sticky. When picked up, they form filaments ( Figure 1 ).

[0057] (2) Molecular identification

[0058] Total DNA of BVFA21 was extracted using a bacterial DNA extraction kit, and the 16S rDNA sequence was amplified using bacterial 16S universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACG ACTT-3'). The gyrA conserved gene was amplified using specific primers gyrA-F (5'-CAGTCAGGAAATG CGTACGTCCTT-3') and gyrA-R (5'-CAAGGTAATGCTCCAGGCATTGCT-3').

[0059] The amplified PCR products were detected by agarose gel electrophoresis, and the PCR products with a single band were sent to a sequencing company for sequencing. The sequencing results were compared using BLAST in the NCBI database, and the strain sequences with higher homology were selected. The maximum likelihood method (ML) of MEGA 7.0 software was combined with the 16S rDNA and gyrA sequences of BVFA21 to construct its multi-gene phylogenetic tree.

[0060] 3. Determination of BVFA21 growth curve

[0061] (1) Preparation of seed solution: Use a sterile inoculation loop to pick up the activated BVFA21 strain and inoculate it into a conical flask containing 100 ml of LB medium. Cultivate in a shaking incubator at 180 r / min and 28°C for 24 h to obtain BVFA21 seed fermentation solution.

[0062] (2) Growth curve determination: Inoculate the above 1% seed solution in a 1L conical flask containing 500ml of LB medium, culture at 180r / min and 28°C, repeat the treatment 3 times, take the fermentation liquid at 0h, 1h, 2h, 3h, 4h, 5h, 6h, 8h, 10h, 12h, 14h, 16h, 18h, 20h, 22h, 24h, 32h, 36h, 48h respectively, measure the absorbance at 600nm wavelength, and draw the growth curve of strain BVFA21. The results show that under the above culture conditions, the growth curve of BVFA21 is "S" type ( Figure 3 ), from the growth curve, we can see that 0-8h is the adjustment period, the strain BVFA21 grows slowly, 10-36h is the logarithmic growth period, the bacteria multiply rapidly and in large quantities; 36-48h the biomass of the strain tends to be stable, but is also slowly increasing, reaching the maximum absorbance of 1.2419 at 36h, and entering the decay period after 48h, the death rate is higher than the reproduction rate.

[0063] 4. Determination of the antibacterial activity of BVFA21 against Fusarium solani

[0064] Activate Fusarium spp. on PDA medium, punch out the fungus cakes with a 6 mm puncher, inoculate them in the center of a new PDA plate, and soak 1×10 8 5mm circular filter paper with CFU / mL BVFA21 bacterial suspension was evenly placed 20mm away from each pathogenic fungus cake. The treatment was repeated 3 times for pathogenic fungi. A plate without filter paper and inoculated with pathogenic fungi in the center was used as a control. The culture dish was inverted and cultured in a 28℃ incubator for 5 days to observe the growth of pathogens. The inhibition rate was calculated according to the following formula:

[0065] Inhibition rate (%) = (pathogen diameter in control group - pathogen diameter in treatment group) / pathogen diameter in control group

[0066] ×100%

[0067] The experimental results showed that BVFA21 had strong inhibitory activity against Fusarium solani ( Figure 4 ), the inhibition rate is: 73.92%.

[0068] 5. Inhibitory effect of BVFA21 sterile fermentation broth on Fusarium spp.

[0069] The strain BVFA21 was inoculated with 1% seed solution in YSB medium, with a rotation speed of 200r / min, a fermentation temperature of 37°C, and a fermentation time of 3d. The above BVFA21 fermentation broth was centrifuged at 4000rpm / min for 30min, and the supernatant was taken. The supernatant was filtered with a sterile organic phase microporous filter membrane (0.22μm) to obtain the sterile fermentation broth of the antagonistic strain BVFA21. The antibacterial activity of 10% and 20% sterile fermentation filtrates of the biocontrol strain BVFA21 against F. proliferatum was measured by the mycelium growth rate method. The bacterial cakes of the pathogenic fungi were punched out with a 5mm puncher and inoculated in the center of the PDA plate containing the sterile fermentation broth. The same volume of sterile water was added as a control and repeated three times. The culture dish was inverted in an incubator at 28°C for 5 days to observe the growth of the pathogen. The inhibition rate was calculated according to the following formula:

[0070] Inhibition rate (%) = (pathogen diameter in control group - pathogen diameter in treatment group) / pathogen diameter in control group

[0071] ×100%

[0072] The experimental results showed that the sterile fermentation broth of BVFA21 also had strong inhibitory activity against Fusarium solani ( Figure 5 ), under the optimal fermentation conditions, the inhibition rates of 10% and 20% BVFA21 sterile filtrate against F. proliferatum were 71.89% and 82.75%, respectively.

[0073] 6. The inhibitory effect of concentrated sterile fermentation broth of BVFA21 on several plant pathogenic fungi.

[0074] According to the above method, 1L of BVFA21 fermentation broth under the optimal fermentation conditions was obtained, and the BVFA21 fermentation broth was centrifuged at 4000 rpm / min for 30 min in a 50 ml sterile centrifuge tube to obtain the supernatant.

[0075] The collected supernatant was extracted with ethyl acetate. The extraction process was as follows: an equal volume of ethyl acetate was added to mix it thoroughly with the supernatant, and then allowed to stand, and the extract was collected after separation with a separatory funnel, and the extraction was repeated 3 times, and the extracts were combined each time; the rotary evaporator was set at 50°C, and the weight of the rotary evaporation collection bottle was weighed before rotary evaporation, and then the collection bottle after the extract was evaporated was weighed to obtain the weight of the extract and an appropriate amount of methanol was added for extraction to obtain an active crude extract.

[0076] 1L of BVFA21 fermentation broth was extracted with ethyl acetate. After the extractants were combined and the solvent was evaporated, we obtained 0.89g of ethyl acetate crude extract, which was dissolved in 1ml of methanol.

[0077] The mycelial growth rate method was used to determine the antibacterial effect of 200ug / ml and 400ug / ml active crude extracts on F. proliferatum. Figure 6 The inhibition rate was calculated according to the following formula:

[0078] Inhibition rate (%) = (pathogen diameter in control group - pathogen diameter in treatment group) / pathogen diameter in control group

[0079] ×100%

[0080] The experimental results showed that the sterile fermentation broth after inactivation and concentration of BVFA21 still had antibacterial activity. Compared with the antibacterial activity of untreated sterile fermentation broth, the lower concentration of concentrated sterile fermentation broth showed better antibacterial activity. The 200ug / ml and 400ug / ml active crude extracts of 1mL / L concentrated sterile fermentation broth strain BVFA21 had an antibacterial rate of 54.36% and 71.68% against F. proliferatum, respectively. Figure 7 ).

[0081] 7. Identification of antibacterial metabolites of BVFA21.

[0082] Liquid chromatography-tandem mass spectrometry (LC-MS / MS) was used to analyze and identify the metabolic organic compounds produced by the fermentation broth of the BVFA21 strain. The positive and negative base peak ion chromatograms of the samples obtained by LC-MS / MS detection (such as Figure 8 , Fig. 9 The experiment was completed by e-test biological company, and Fanrui Yunzhi Technology (Zhengzhou) Co., Ltd. performed non-target metabolomics detection. The specific method is as follows:

[0083] (1) Sample collection: The seed liquid prepared from the BVFA21 strain was inoculated into a 250-ml conical flask containing 100 ml YSB at an inoculum size of 3%. The fermentation liquid was shaken in a constant temperature shaker at 32°C and 200 r / min for 3 days to obtain the fermentation liquid. The fermentation liquid was centrifuged at 4000 rpm for 30 min to obtain the supernatant, which was then filtered through a 0.22 μm microporous filter membrane and placed in a sterile 10-ml centrifuge tube and quickly frozen with liquid nitrogen.

[0084] (2) Metabolite extraction: Metabolite extraction was performed according to the experimental method of Demurtas et al. (2021). The experimental samples were thawed at 4°C, and the samples were vortexed for 1 min to mix evenly. An appropriate amount of sample was accurately transferred to a 2 mL centrifuge tube. 400 μL of methanol solution was added and vortexed for 1 min. The sample was centrifuged at 12,000 rpm and 4°C for 10 min. All the supernatant was transferred to a new 2 mL centrifuge tube and concentrated to dryness. 150 μL of 2-chloro-L-phenylalanine (4 ppm) solution prepared with 80% methanol water was accurately added to re-dissolve the sample. The supernatant was filtered through a 0.22 μm membrane and the filtrate was added to the detection bottle for LC-MS detection.

[0085] (3) Chromatographic conditions (Zelena et al., 2009): Thermo Vanquish ultra-high performance liquid chromatography system, using HSST3 (2.1×100 mm, 1.8 μm) (Waters, Milford, MA, USA) column, flow rate of 0.3 mL / min, column temperature of 40°C, injection volume of 2 μL. Positive ion mode, mobile phase of 0.1% formic acid acetonitrile (B2) and 0.1% formic acid water (A2), gradient elution program: 0-1 min, 8% B2; 1-8 min, 8%-98% B2; 8-10 min, 98% B2; 10-10.1 min, 98%-8% B2; 10.1-12 min, 8% B2. In negative ion mode, the mobile phase was acetonitrile (B3) and 5 mM ammonium formate water (A3), and the gradient elution program was: 0-1 min, 8% B3; 1-8 min, 8%-98% B3; 8-10 min, 98% B3; 10-10.1 min, 98%-8% B3; 10.1-12 min, 8% B3.

[0086] (4) Mass spectrometry conditions (Want et al., 2013): ThermoQ Exactive Focus mass spectrometer (Thermo Fisher Scientific, USA), electrospray ion source (ESI), data acquisition in positive and negative ion modes. The positive ion spray voltage was 3.50 kV, the negative ion spray voltage was -2.50 kV, the sheath gas was 40 arb, and the auxiliary gas was 10 arb. The capillary temperature was 325 °C, the first-level full scan was performed at a resolution of 70,000, the first-level ion scan range was m / z 100-1000, and HCD was used for secondary fragmentation, the collision energy was 30 eV, the second-level resolution was 7500, and the first three ions of the acquisition signal were fragmented. At the same time, dynamic exclusion was used to remove unnecessary MS / MS information.

[0087] (5) Data preprocessing: The original mass spectrometry file was converted into mzXML file format using the MSConvert tool in the Proteowizard software (v3.0.8789) (Rasmussen et al., 2022). The RXCMS software package was used for peak detection, peak filtering, and peak alignment (Navarro-Reig et al., 2015) to obtain a quantitative list of substances. The parameters were set as bw = 2, ppm = 15, peakwidth = c (5, 30), mzwid = 0.015, mzdiff = 0.01, and method = "centWave". The total peak area normalization method was used to achieve data correction and eliminate systematic errors.

[0088] (6) Base peak chromatogram: The components separated by chromatography continuously enter the mass spectrometer, and the mass spectrometer is continuously scanned for data collection. Each scan obtains a mass spectrum. The ions with the largest intensity in each mass spectrum are selected and continuously depicted, with ion intensity as the vertical axis and time as the horizontal axis. The resulting spectrum is the base peak chromatogram (BPC).

[0089] (7) Substance identification: Human Metabolome Database (http: / / www.hmdb.ca), massbank (http: / / www.massbank.jp / ), LipidMaps (http: / / www.lipidmaps.org), mzclound (https: / / www.mzcloud.org), KEGG (https: / / www.genome.jp / kegg / ) and the metabolite standard database built by Fanrui Yunzhi Technology (Zhengzhou) Co., Ltd. were used for retrieval and comparison (search database). The molecular weight, adduct ion and other information of the metabolite were determined by the mass-to-charge ratio of the parent ion in the primary mass spectrum to predict the molecular formula, and then compared and matched with the database to achieve the primary qualitative identification of the metabolite. At the same time, the metabolites containing secondary spectra in the quantitative list were compared and matched with the fragment ions and other information of each secondary spectrum in the database to achieve the secondary qualitative identification of the metabolite.

[0090] 8. In vivo control effect of BVFA21 metabolites on plum pathogens

[0091] Disinfect healthy plum fruits with consistent fruit shape in 70% ethanol for about 40s to 60s, then take them out, wash them with sterile water, and dry them naturally. Take a bacterial cake with a diameter of 8mm and inoculate it on the surface of undamaged plums. BVFA21 has protective and therapeutic effects on plum fruits. The protective effect is to spray 5mlEC25, EC50, EC75 24h before inoculating the bacteria. The therapeutic effect is to inoculate the bacteria 24h before spraying the BVFA21 metabolite p-methoxybenzoic acid with a concentration of EC25, EC50, EC75. The specific method is as follows:

[0092] Protective effect: Spray 5 ml of p-methoxybenzoic acid with concentrations of EC25, EC50, and EC75 evenly on the surface of the plum fruit, place it on the bottle cap, and put sterile cotton soaked in sterile water in the bottle cap to keep it moist. Mark it and put it in a transparent plastic box, seal it, and place it in a 28℃ artificial climate box. After 24 hours, inoculate 8mm pathogenic bacteria blocks on the plum fruit, put the inoculated plum fruit back into the plastic box, and culture and observe it in the artificial climate box.

[0093] Treatment effect: Inoculate 8mm pathogenic bacteria on plum fruit, place the inoculated fruit with the stalk facing downward on a bottle cap filled with moisturizing cotton, seal it in a transparent plastic box, and place it in an artificial climate box at 28℃. After 24 hours, spray 5mL of p-methoxybenzoic acid with concentrations of EC25, EC50, and EC75 on each plum fruit until the surface of the fruit is soaked.

[0094] After the liquid treatment, the plum fruits were placed in a transparent plastic box and continued to be cultured in an artificial climate chamber. Five fruits were treated for each treatment, and the treatment was repeated three times. After 7 days, the diameter of the lesions was measured using the cross method, and the average value was taken to calculate the control effect. The calculation formula is as follows:

[0095]

[0096] 9. Indoor toxicity test of BVFA21 p-methoxybenzoic acid against Fusarium solani

[0097] In a sterile operating table, twenty commercial compounds were dissolved in N, N-dimethylformamide to prepare a 100,000 μg / mL stock solution, and then the stock solution was mixed with PDA culture medium in a certain proportion to make the final effective concentration of 25, 50, 100, 200, and 400 μg mL-1. After mixing, pour the plate and cool for use. Inoculate the F. proliferatum 5mm cake in the center of the culture medium and culture it in a 5℃ constant temperature incubator in the dark for 5 days. After the culture is completed, the colony diameter (mm) is measured by the cross method, and the inhibition rate is calculated. The formula is as shown in (5-1), and each treatment is repeated 3 times. Select the active substance with the best inhibition effect, reduce the concentration gradient of the agent, repeat the above test to calculate the inhibition rate, and conduct subsequent tests.

[0098]

[0099] like Fig.10 As shown, as the concentration of p-methoxybenzoic acid increases, the inhibitory effect becomes more obvious. The regression equation is: y=0.3132+2.1854x, the correlation coefficient is 0.9856, and the 95% confidence interval is 102.0075-190.7397. The test is highly reliable. Its EC50 is 139.49μg / mL.

[0100] Fig.11 The results show that p-methoxybenzoic acid has a therapeutic and protective effect on plum fruits infected with F. proliferatum. The lesion control rate under the protective effect was higher than that under the therapeutic effect 7 days after inoculation. The lesion control rates of p-methoxybenzoic acid at concentrations of EC25, EC50, and EC75 were 26.27%, 47.27%, and 57.49%, respectively; the lesion control rates of the therapeutic effect were 18.36%, 40.60%, and 51.64%, respectively. The above results show that the biocontrol strain BVFA21 has a good control effect on the lesions of plum fruits infected with F. proliferatum, and its main mode of action is protective.

[0101] 10. Sequence Listing:

[0102] Seq No.1 16S rDNA sequence and gyrA sequence of Bacillus velezini BVFA21

[0103] SEQUENCE LISTING

[0104] <110> Guizhou University

[0105] <120> A strain of Bacillus velez BVFA21 and a method and application thereof for producing highly effective antibacterial substances

[0106] <130> 2023

[0107] <160> 1

[0108] <170> PatentIn version 3.5

[0109] <210> 1

[0110] <211> 1407

[0111] <212> DNA

[0112] <213> Bacillus velezensis

[0113] <400> 1(16S rDNA)

[0114] >

[0115]

[0116] <210> 2

[0117] <211> 2460

[0118] <212> DNA

[0119] <213> Bacillus velezensis

[0120] <400> 2(gyrA)

[0121] >YBJK2-1(gyrA)

[0122] TGAAGTAAGAGGCATGAGCGTTATCGTATCCCGGGCGCTTCCGGATGTGCGTGACGGTCTGAAGCCGGTTCACAGGCGGATTTTGTACGCAATGAATGATTTAGGCATGACCAGTGACAAACCATATAAAAAATCTGCCCGTATCGTCGGTGAAGTTATCGGTAAGTACCACCCGCACGGTGACTCAGCGGTTTACGAATCAATGGTCAGAATGGCGCAGGATTTTAACTACCGCTACATGCTTGTTGACGGACACGGCAACTTCGGTTCGGTTGACGGCGACTCAGCGGCCGCGATGCGTTACACAGAAGCGAGAATGTCAAAAATCGCAATGGAAATCCTCCGGGACATTACGAAAGATACGATTGATTATCAAGATAACTATGACGGCGCAGAAAGAGAACCTGTCGTCATGCCTTCGAGATTTCCGAATCTGCTCGTAAACGGAGCTGCCGGTATTGCGGTCGGAATGGCGACAAATATTCCTCCGCATCAGCTTGGGGAAGTCATTGAAGGCGTGCTTGCCGTAAGTGAGAATCCTGAGATTACAAACCAGGAGCTGATGGAATACATCCCGGGCCCGGATTTTCCGACTGCAGGTCAGATTTTGGGCCGGAGCGGCATCCGCAAGGCATATGAATCCGGACGGGGATCCATTACGATCCGGGCTAAGGCTGAAATCGAAGAGACATCATCGGGAAAAGAAAGAATTATTGTCACAGAACTTCCTTATCAGGTGAACAAAGCGAGATTAATTGAAAAAATCGCAGATCTTGTCCGGGACAAAAAAATCGAAGGAATTACCGATCTGCGTGACGAATCCGACCGTAACGGAATGAGAATCGTCATTGAGATCCGCCGTGACGCCAATGCTCACGTCATTTTGAATAACCTGTACAAACAAACGGCCCTGCAGACGTCTTTCGGAATCAACCTGCTGGCGCTCGTGACGGACAGCCGAAGACAGCCTGCCCC 976

[0123] Conclusion: The biocontrol bacteria BVFA21 isolated from the rhizosphere soil of plum in the present invention has good inhibitory activity against various pathogenic fungi on various crops such as kiwi, passion fruit, tobacco, rice, plum, etc. The strain is identified as Bacillus velezensis by morphology and molecular biology.

[0124] In addition, a stable and efficient antibacterial active substance, p-methoxybenzoic acid, was detected in the metabolites of strain BVFA21. At low concentrations, it also has good antibacterial activity against Botrytis cinerea, Phomopsis spp., Colletotrichum spp., Rhizoctonia solani, Pyricularia grisea, and Sclerotinia spp. of American Australian type. In vivo experiments showed that p-methoxybenzoic acid had therapeutic and protective effects on plum fruits infected with F. proliferatum. The lesion control rate under the protective effect was higher than that under the therapeutic effect 7 days after inoculation. The control rates of p-methoxybenzoic acid at the concentrations of EC25, EC50, and EC75 on lesions were 26.27%, 47.27%, and 57.49%, respectively; and the control rates of p-methoxybenzoic acid at the therapeutic effect were 18.36%, 40.60%, and 51.64%, respectively. This indicates that the biocontrol strain Bacillus velezensis BVFA21 has good application value and commercial development potential in the biological control of agricultural diseases.

[0125] The technical solution of the present invention screened and obtained Bacillus Velez subtilis BVFA21 for the first time. Experiments have shown that Bacillus Velez subtilis BVFA21, fermentation products of Bacillus Velez subtilis BVFA21, and p-methoxybenzoic acid, a metabolite of Bacillus Velez subtilis BVFA21, can effectively control the occurrence of various plant diseases and reduce the possibility of plants being infected by various pathogenic fungi. This shows that the strain has broad application prospects in the field of biological control of plant diseases and also has extremely high development value in the development of biological control agents.

[0126] The matters not described in detail in the present invention are all known technologies to those skilled in the art.

[0127] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. Bacillus velezensis BVFA21, which is deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO:M2024623, and the deposit date is April 3, 2024.

2. The Bacillus Velezii BVFA21 according to claim 1, characterized in that Its 16S rDNA sequence is shown in Seq ID No.

1.

3. A composition comprising the Bacillus Velezii BVFA21 or a fermentation product or metabolite thereof according to claim 1.

4. The composition according to claim 3, characterized in that The fermentation product or metabolite comprises a sterile fermentation broth containing p-methoxybenzoic acid.

5. A fermentation method for promoting the Bacillus Velez subtilis BVFA21 as claimed in claim 1 to produce p-methoxybenzoic acid, characterized in that: The following steps are involved: S1, inoculating the Bacillus Velezii BVFA21 into YSB medium, culturing for 72 hours at a temperature of 37° C., a pH of 7.2, and a shaking speed of 180 rpm to prepare a seed solution; S2, will grow to OD 600 The seed liquid of Bacillus Velezii BVFA21 with a concentration of 1.4 to 1.5 was inoculated into fresh YSB medium and fermented for 72 hours under the culture conditions of temperature of 37°C, pH of 7.2 and shaking speed of 200 rpm; S3, collecting the fermentation broth and centrifuging it in a high-speed centrifuge at 4000 rpm for 30 min, filtering the supernatant twice with a 0.22 μm microporous filter membrane to obtain a sterile fermentation broth containing p-methoxybenzoic acid.

6. The fermentation method for producing p-methoxybenzoic acid by Bacillus Velez subtilis BVFA21 according to claim 5, characterized in that: The YSB culture medium comprises: 20.0 g sucrose, 20.0 g yeast extract, 15 g beef extract, 0.06 g MgSO4·7H2O, 0.009 g FeSO4·7H2O, 1000 mL distilled water, and a pH of 7.

2. The inoculation amount of the Bacillus Velezii BVFA21 seed solution in the YSB culture medium is 1%.

7. A use of Bacillus Velezii BVFA21 according to claim 1, characterized in that: The uses include application in inhibiting pathogens, application in inhibiting crop diseases caused by pathogens, application in preparing pathogen inhibitors and application in preparing crop disease inhibitors caused by pathogens.

8. The use of Bacillus Velez subtilis BVFA21 according to claim 7, characterized in that: The invention is achieved by the antagonistic effect of the sterile fermentation liquid containing p-methoxybenzoic acid prepared by the Bacillus Velez BVFA21 on Fusarium proliferatum.

9. The use of Bacillus Velez subtilis BVFA21 according to claim 7, characterized in that: The use comprises spraying the sterile fermentation liquid of Bacillus Velez subtilis BVFA21 on the fruit of the crop; the crop is plum.

10. The use of Bacillus Velez subtilis BVFA21 according to claim 7, characterized in that: The use includes spraying the Bacillus Velez subtilis BVFA21, the fermentation product of the Bacillus Velez subtilis BVFA21, the metabolite of the Bacillus Velez subtilis BVFA21, the microbial agent prepared from the Bacillus Velez subtilis BVFA21 or its fermentation product or metabolite, and the disease inhibitor prepared from the Bacillus Velez subtilis BVFA21 or its fermentation product or metabolite, or any combination thereof, on the aerial parts of the plants.

Images