Use of PWWP3B in preparation of diagnostic products and therapeutic drugs for testicular premature aging or oligoasthenospermia

Abstract

The application provides application of PWWP3B in preparation of a diagnostic product and a therapeutic drug for testicular premature failure or oligoasthenospermia, and finds that the occurrence of testicular premature failure or oligoasthenospermia is related to abnormal PWWP3B gene or abnormal expression level of a PWWP3B gene coding protein. Therefore, testicular premature failure or oligoasthenospermia can be definitely diagnosed by detecting the PWWP3B gene sequence or the PWWP3B protein expression level. Meanwhile, it is found that a mutation pathogenic gene related to testicular premature failure or oligoasthenospermia contains 7 mutation sites, and based on the above 7 mutation points, a corresponding AAV carrier is constructed for treatment, and the effectiveness of a gene therapy drug for a specific genetic mutation is confirmed.

Description

Technical Field

[0001] This invention relates to the field of biomedical detection technology, and in particular to the application of PWWP3B in the preparation of diagnostic products and therapeutic drugs for premature testicular failure or oligoasthenospermia. Background Technology

[0002] In modern society, the trend of later marriage and childbearing is evident, and the decline in male fertility with age is receiving increasing attention. The core of male fertility lies in a healthy spermatogenesis process. Premature aging of the testes severely affects sperm production and function, especially in middle-aged and older men, manifesting as spermatogenesis disorders, sperm abnormalities, and dysfunction of Sertoli cells, ultimately potentially leading to infertility. Studies have shown that with age, men generally experience a decline in testosterone levels and semen quality, increasing concern about the reproductive health of middle-aged and older men.

[0003] Therefore, it is necessary to develop a diagnostic reagent and a treatment drug related to premature testicular failure or oligospermia and asthenospermia. Summary of the Invention

[0004] The purpose of this invention is to provide the application of PWWP3B (SDX) in the preparation of a diagnostic kit for premature testicular failure (PNF) or oligoasthenospermia. This invention discovers that the occurrence of PNF or oligoasthenospermia is associated with abnormalities in the SDX gene or abnormal expression levels of the SDX gene-encoded protein. Premature testicular failure or oligoasthenospermia can be definitively diagnosed by detecting the SDX gene sequence or SDX protein expression level, which is of significant importance in improving male infertility. Simultaneously, the invention also describes the use of adeno-associated virus (AAV) vectors for the treatment of male infertility caused by abnormalities in the SDX gene and / or protein, as well as the application of AAV viral vectors, direct supplementation of SDX protein, or the use of mRNA and other drugs that increase SDX protein expression to treat PNF and oligoasthenospermia. These findings are of significant importance in improving PNF and oligoasthenospermia.

[0005] The present invention adopts the following technical solution: In a first aspect of the invention, the use of SDX in the preparation of a test kit for premature testicular failure or oligoasthenospermia is provided, the use including: detecting SDX gene abnormalities and / or abnormal SDX protein expression levels.

[0006] Furthermore, the SDX gene abnormality includes at least one of the following abnormalities: mutations in the promoter or enhancer sequence of the gene, or single or multiple base deletions, insertions, or substitutions in the gene coding sequence.

[0007] Furthermore, the abnormal SDX protein expression level includes at least one of the following abnormalities: reduced SDX protein expression, premature termination or absence of SDX protein expression, and deletion, insertion, or substitution of amino acids in important functional domains of the SDX protein.

[0008] Furthermore, the test kit for premature testicular failure or oligoasthenospermia includes an SDX gene detection kit and / or an SDX protein expression level detection kit.

[0009] Furthermore, the SDX gene detection kit includes whole genome sequencing detection reagents.

[0010] Furthermore, the SDX protein expression level detection kit includes an antibody that specifically binds to the SDX protein.

[0011] In a second aspect of the invention, an antibody that specifically binds to the SDX protein is provided for use in the preparation of a test kit for premature testicular failure or oligoasthenospermia.

[0012] In a third aspect of the invention, a mutated pathogenic gene associated with premature testicular failure or oligoasthenospermia is provided, wherein the mutated pathogenic gene, compared with the nucleotide sequence of the SDX gene as shown in SEQ ID NO: 1, has the following seven mutation sites: S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G).

[0013] In a fourth aspect of the invention, the use of reagents for detecting the mutated pathogenic genes associated with premature testicular failure or oligoasthenospermia is provided in the preparation of diagnostic products for premature testicular failure or oligoasthenospermia.

[0014] In a fifth aspect of the invention, the use of the SDX overexpression vector in the preparation of a medicament for treating premature testicular failure or oligoasthenospermia is provided.

[0015] Furthermore, the SDX overexpression vector includes an adeno-associated virus vector.

[0016] The application of substances that promote SDX expression in the preparation of drugs for treating premature testicular failure or oligoasthenospermia. Specifically, this includes, but is not limited to: designing and synthesizing mRNA containing the correct coding sequence based on the SDX gene sequence, and injecting the packaged mRNA into the testes of mice to promote SDX expression.

[0017] In a sixth aspect of the present invention, a method for constructing an SDX gene-related point mutation mouse model is provided, the method comprising: The gRNAs with nucleotide sequences shown in SEQ ID NO.6-SEQ ID NO.7, SEQ ID NO.11-SEQ ID NO.12, SEQ ID NO.13-SEQ ID NO.14, SEQ ID NO.15-SEQ ID NO.16, SEQ ID NO.17-SEQ ID NO.18, SEQ ID NO.19-SEQ ID NO.20, and SEQ ID NO.21-SEQ ID NO.22 were transcribed into mRNA in vitro to obtain well-transcribed sgRNAs. Obtain active Cas9 mRNA; Target donors with nucleotide sequences as shown in SEQ ID NO.2-SEQ ID NO.5 were obtained respectively; The transcribed sgRNA, Cas9 mRNA and the target donor were mixed and microinjected into mouse zygotes to obtain F0 generation mice; Select F0 generation positive mice from the F0 generation genotype identification results and mate them with wild-type mice to obtain F1 generation mice with stable genotypes. After screening, point mutation mouse models are obtained.

[0018] Furthermore, in the aforementioned technical solution, the transcribed sgRNA corresponds one-to-one with the target donor. Specifically, this includes: Option 1: gRNAs with nucleotide sequences as shown in SEQ ID NO.6-SEQ ID NO.7 were transcribed into mRNAs in vitro to obtain well-transcribed sgRNAs. Obtain active Cas9 mRNA; Target donors with nucleotide sequences as shown in SEQ ID NO.2 were obtained respectively; The transcribed sgRNA, Cas9 mRNA and the target donor were mixed and microinjected into mouse zygotes to obtain F0 generation mice; F0 generation positive mice from the F0 generation genotype identification results were selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes. After screening, the S219P (T655C) point mutation mouse model was obtained.

[0019] Option 2: The gRNAs with nucleotide sequences as shown in SEQ ID NO.11-SEQ ID NO.12 were transcribed into mRNAs in vitro to obtain well-transcribed sgRNAs. Obtain active Cas9 mRNA; Target donors with nucleotide sequences as shown in SEQ ID NO.3 were obtained respectively; The transcribed sgRNA, Cas9 mRNA and the target donor were mixed and microinjected into mouse zygotes to obtain F0 generation mice; F0 generation positive mice from the F0 generation genotype identification results were selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes. After screening, the E257K (G769A) point mutation mouse model was obtained.

[0020] Option 3: The gRNAs with nucleotide sequences as shown in SEQ ID NO.13-SEQ ID NO.14 were transcribed into mRNAs in vitro to obtain well-transcribed sgRNAs. Obtain active Cas9 mRNA; Target donors with nucleotide sequences as shown in SEQ ID NO.4 were obtained respectively; The transcribed sgRNA, Cas9 mRNA and the target donor were mixed and microinjected into mouse zygotes to obtain F0 generation mice; F0 generation positive mice from the F0 generation genotype identification results were selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes. After screening, the R549W (C1645T) point mutation mouse model was obtained.

[0021] Option 4: The gRNAs with nucleotide sequences as shown in SEQ ID NO.15-SEQ ID NO.16 were transcribed into mRNAs in vitro to obtain well-transcribed sgRNAs. Obtain active Cas9 mRNA; Target donors with nucleotide sequences as shown in SEQ ID NO.5 were obtained respectively; The transcribed sgRNA, Cas9 mRNA and the target donor were mixed and microinjected into mouse zygotes to obtain F0 generation mice; F0 generation positive mice from the F0 generation genotype identification results were selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes. After screening, the R549Q (G1646A) point mutation mouse model was obtained.

[0022] Option 5: gRNAs with nucleotide sequences as shown in SEQ ID NO.17-SEQ ID NO.18 were transcribed into mRNAs in vitro to obtain well-transcribed sgRNAs. Obtain active Cas9 mRNA; Target donors with nucleotide sequences as shown in SEQ ID NO.6 were obtained respectively; The transcribed sgRNA, Cas9 mRNA and the target donor were mixed and microinjected into mouse zygotes to obtain F0 generation mice; F0 generation positive mice from the F0 generation genotype identification results were selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes. After screening, the P594H (C1781A) point mutation mouse model was obtained.

[0023] Option 6: gRNAs with nucleotide sequences as shown in SEQ ID NO.19-SEQ ID NO.20 were transcribed into mRNAs in vitro to obtain well-transcribed sgRNAs. Obtain active Cas9 mRNA; Target donors with nucleotide sequences as shown in SEQ ID NO.7 were obtained respectively; The transcribed sgRNA, Cas9 mRNA and the target donor were mixed and microinjected into mouse zygotes to obtain F0 generation mice; F0 generation positive mice from the F0 generation genotype identification results were selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes. After screening, the C647F (G1940T) point mutation mouse model was obtained.

[0024] Option 7: gRNAs with nucleotide sequences as shown in SEQ ID NO.21-SEQ ID NO.22 were transcribed into mRNAs in vitro to obtain well-transcribed sgRNAs. Obtain active Cas9 mRNA; Target donors with nucleotide sequences as shown in SEQ ID NO.5 were obtained respectively; The transcribed sgRNA, Cas9 mRNA and the target donor were mixed and microinjected into mouse zygotes to obtain F0 generation mice; F0 generation positive mice from the F0 generation genotype identification results were selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes. After screening, the Q622E (C1864G) point mutation mouse model was obtained.

[0025] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages: This invention relates to the application of SDX in the preparation of a diagnostic kit for premature testicular failure (PTF) or oligoasthenospermia. The invention discovers that the occurrence of PTF or oligoasthenospermia is associated with abnormalities in the SDX gene or abnormal expression levels of the SDX-encoded protein. Therefore, detecting the SDX gene sequence or SDX protein expression level can definitively diagnose PTF or oligoasthenospermia, which is of significant importance in improving male infertility. Furthermore, compared with existing technologies, this invention, through unique molecular markers and gene therapy strategies, can more accurately diagnose and effectively treat PTF and oligoasthenospermia. In particular, animal model studies of this invention show that gene therapy mediated by AAV vectors can significantly restore damaged seminiferous tubule function and improve fertility. In addition, this invention provides theoretical and technical solutions for clinical applications, offering a new treatment method for preserving and restoring fertility in middle-aged and elderly men. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1 To analyze SDX point mutation sites in patients through whole-genome sequencing and to construct an SDX point mutation mouse model; Figure 1 A screened a patient database and conducted whole-genome sequencing analysis, which revealed seven non-synonymous point mutation sites. Furthermore, no other non-synonymous mutations were found in the other genomes of these patients. Figure 1 As shown in Figure B, seven point mutations—S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G)—all lead to smaller testes, abnormal seminiferous tubules, incomplete spermatogenesis, and oligoasthenospermia in mice.

[0028] Figure 2 Seven point mutations—S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G)—were treated with a full-length SDX adeno-associated virus. The AAV viral vector was injected into the seminiferous tubules of mice with these seven point mutations. After several months of treatment, some recovery of the seminiferous tubules and an increase in sperm count were observed.

[0029] Figure 3To construct a mouse model with SDX gene deficiency; Figure 3 A represents a mouse with smaller testes due to SDX gene deficiency. Figure 3 B is a tissue section of the testis that shows abnormalities in the seminiferous tubules. Figure 3 C represents the proportion of abnormal seminiferous tubules, which is 50%.

[0030] Figure 4 The results showed an increase in senescence-associated β-galactosidase-positive cells in SDX gene-deficient mice, and upregulation of senescence-secreting phenotype-related genes (Ccl24, Vegfc, Tnfrsf1b, Cxcl1, Ptges, Spon1, Mmp2, Tnfrsf1a, Il15, Timp2, Bmp6, Mmp14, Cd9, Axl, Ppara, Prkab1, Prkag1, Est2). Figure 4 A represents an increase in β-galactosidase-positive cells in SDX gene knockout mice. Figure 4 B represents a genetically defective mouse where some supporting cells show β-galactosidase positivity. Figure 4 B) Figure 4 C represents the transcriptome sequencing results of RNA extracted from mouse testes.

[0031] Figure 5 The results are from treating mice with premature testicular failure using adeno-associated virus vector (AAV). Figure 5 A represents differences in testicular morphology. Figure 5 B shows the results of tissue sections of the testis and epididymis. Figure 5 C represents the detection of SDX expression in the testes of mice infected with AAV. Figure 5 D represents the birth status of mice after AAV virus treatment.

[0032] Figure 6 To treat premature testicular failure by increasing SDX protein expression in the testes using mRNA drugs. Figure 6 Differences in SDX expression between experimental group A mice (SDX-deficient mice injected with lipid nanoparticles containing SDX mRNA) and control group (SDX-deficient mice injected with lipid nanoparticles without SDX mRNA); Figure 6 Comparison of testicular size between experimental group B mice and control group mice. Detailed Implementation

[0033] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0034] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0035] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing them from the market or by existing methods.

[0036] The technical solution of this application embodiment is to solve the above-mentioned technical problems, and the general idea is as follows: In exploring the role of genetic factors (gene mutations) in causing male sexual development disorders (DSD), the inventors of this application conducted a sex differentiation-related proteomics study on the model animal C57 / 6J male mice. They discovered that abnormal SDX in mouse mice can lead to premature testicular failure or oligoasthenospermia in male mice.

[0037] By comparing the protein sequences of the SDX gene in humans and mice, we found that the SDX protein sequence is highly conserved in both mice and humans, and the protein localization pattern is completely consistent. Therefore, the function of SDX in humans should be consistent with that in mice.

[0038] Subsequently, through experiments, it was discovered for the first time that the occurrence of premature testicular failure or oligoasthenospermia is related to abnormalities in the SDX gene or abnormal expression levels of the protein encoded by the SDX gene.

[0039] Therefore, detecting the SDX gene sequence or SDX protein expression level can clearly identify premature testicular failure or oligospermia, which is of great significance in improving male infertility.

[0040] The SDX gene abnormalities can be detected through whole-genome sequencing, and the expression level of the SDX gene-encoded protein can be detected using antibodies that specifically bind to the SDX protein. Therefore, a test kit for premature testicular failure or oligospermia / asthenospermia can be prepared.

[0041] Sequencing results revealed that the SDX point mutation patients included the following point mutation sites for diagnosing premature testicular failure and oligoasthenospermia: S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G).

[0042] The patient has at least one of the seven mutations, such as having all seven mutations or one or more of the seven mutations, and then an overexpression vector is prepared to treat the mutation.

[0043] It should be noted that the human gene SDX (MUM1L1; PWWP3B) in this invention is located on chromosome Xq22.3, NC_000023.11 (106168278..106208961), containing 6 exons. Currently, two transcripts have been confirmed (NM_001171020.2; NM_152423.5), but both encode the same protein, exhibiting a high expression profile in the reproductive system. The structure and function of the SDX gene and its encoded protein still require further investigation. The sequence of the human gene SDX and the effective coding sequence of human SDX are also provided. The protein sequence encoded by the human SDX gene can be found in patent CN113604554B; The application of SDX in this application in the preparation of a test kit for premature testicular failure or oligoasthenospermia will be described in detail below with reference to examples and experimental data.

[0044] Example 1: Discovery of mutated pathogenic genes associated with premature testicular failure or oligoasthenospermia 1. Obtaining biological samples Male patient: No family history of degenerative diseases. Clinical phenotype: abnormal spermatogenesis that worsens with age, low sperm count in semen analysis, etc., ultimately diagnosed as premature testicular failure or oligoasthenospermia.

[0045] 2. DNA extraction Peripheral blood mononuclear cells were extracted, and DNA was extracted using a DNA separation kit (Blood DNA Kit V2, #CW2553).

[0046] 3. Construct the library and sequence it. Genomic DNA was randomly fragmented and cut into 180-280 bp fragments using a Covaris shredder. Libraries were prepared using a Biouptor UCD-200 (Diagenode), a KAPA library preparation kit (Kapa Biosystems, #KR0453), and the SureSelect XT2 target enrichment system (Agilent). DNA library sequencing was performed using the Illumina NovaSeq platform, and downstream analysis was performed using Illumina Sequence Control Software (SCS). Variations were preserved only when the read depth was greater than or equal to 10. High-quality reads were aligned to the USCS Human Genome Project (build 37.1 version hg19) using the Burrows-Wheeler alignment tool.

[0047] Genomic analysis toolkit (GATK) and ANNOVAR (version: 2016-05-11 10:54:48-0700) were used for variant recall and annotation. C9ORF72 repeat amplification screening was performed on all subjects using standard repeat primer PCR. Variant frequencies were initially determined in gnomeAD and Exome Aggregation Consotium (ExAC) to remove common single nucleotide polymorphisms (SNPs). Only nonsynonymous, splice, and frameshift variants with a small allele frequency (MAF) <0.5% or not present in population databases were selected for further evaluation.

[0048] 4. Patient Screening and Gene Mutation Confirmation: In the infertile patient population, we successfully identified 7 point mutations related to the SDX gene ( Figure 1 A) We obtained the mutation sites of patients with oligoasthenospermia through whole-genome sequencing and found non-synonymous mutations in the SDX-encoded protein region, while no non-synonymous mutations were found in other locations of the genome; these mutation sites are located at S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G).

[0049] Example 2: Construction of a point mutation knock-in mouse model In Example 1, we successfully identified seven point mutations associated with the SDX gene in the infertile patient population, located at S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G).

[0050] Through conservation analysis, these mutations were used to construct a point mutation knock-in mouse model, and their corresponding locations were confirmed in the mouse model, providing precise targets for subsequent gene therapy.

[0051] 1. The gRNAs were designed as shown in Table 1.

[0052] Table 1

[0053] 2. Microinjection of gRNA: Preparation of RNA First, the gRNA sequence was ligated into the PT7-4G plasmid vector with the T7 promoter. After the plasmid was sequenced and verified to be correct, the T7 promoter and gRNA nucleotide sequence were amplified using universal amplification primers. Finally, the PCR product was used as a template for in vitro transcription to obtain microinjection RNAs of gRNA1 and gRNA2. Furthermore, the reaction conditions during its preparation were 65°C for 5 minutes, and the RNA electrophoresis diagram showed that the gRNA was successfully transcribed at the required concentration.

[0054] 3. Preparation of Donor's microinjection RNA; Synthesized nucleotide sequences as shown in SEQ ID NO. 2~8, where SEQ ID NO. 2~8 represent the Donor sequences of S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G), respectively.

[0055] 4. In vitro transcription of samples: The Cas9 expression plasmid (Addgene No. 44758) was linearized by AgeI restriction enzyme digestion, purified by phenol-chloroform extraction, and dissolved in nuclease-free water as a template for in vitro transcription; Cas9 mRNA was synthesized in vitro using T7 RNA polymerase according to the T7 Ultra Kit (Ambion, AM1345).

[0056] 5. Preparation of F0 generation mice; Microinjection of Cas9 / sgRNA and donor: Transcribed Cas9 mRNA, sgRNA and purified donor fragment were mixed and the concentrations were adjusted to 20 ng / μl of Cas9 mRNA, 10 ng / μl of sgRNA (gRNA1:gRNA2=1:1) and 50 ng / μl of donor fragment. The mixture was microinjected into the pronucleus and cytoplasm of C57BL / 6 mouse zygotes using a TE2000U microinjector. The zygotes were then transferred to the uterus of pseudopregnant C57BL / 6 mice and the F0 generation mice were awaited to be born.

[0057] 6. Genotyping of F0 generation mice: This invention uses the Cas9 / gRNA injection method to construct gene knock-in mice. Due to the rapid cleavage rate in the early embryonic stage, the resulting F0 generation mice are chimeras. Therefore, the F0 genotype obtained by identifying the tail of the F0 generation mice is for reference only and does not necessarily represent a heritable gene mutation. The heritable genotype needs to be determined after testing the tail of the F1 generation mice.

[0058] F0 mice were obtained through microinjection of fertilized eggs and embryo transfer. PCR and sequencing confirmed the presence of the following homologous recombination-positive F0 generation mice.

[0059] 7. Preparation of F1 generation mice; F1 generation mice with stable genotypes were obtained by mating positive mice from the tail genotype identification results of F0 generation mice with C57BL / 6J wild-type mice.

[0060] DNA was extracted from the tails of F1 generation mice that tested positive by PCR and sequenced. The sequencing results indicated that the model was successfully constructed.

[0061] 8. Phenotypic characteristics of point mutant mouse models The results are as follows Figure 1 As shown, the testes of SDX point mutant mice are smaller, and abnormalities in seminiferous tubules were found in testicular tissue sections; SDX point mutant mice exhibit obvious symptoms of premature testicular aging and oligospermia.

[0062] Example 3: Targeted therapy strategy for specific gene mutations 1. Construction and application of viral vectors: The corresponding AAV vector was constructed and its titer was determined. The specific construction method is as follows; pAAV-CMV SDX: Insert the gene fragment with the sequence shown in SEQ ID NO.1 into the EcoRI / BamHI site of the pAAV-CMV vector.

[0063] 2. Co-transfection 12-16 h before transfection, HEK293T cells were divided into 15 cm plates containing 25 mL of DMEM intact medium at a ratio of 1:3. When cell confluence reaches 70-80%, transfect plasmids into each 15 cm culture dish. Add 40 µg of DNA mixture (pAAV-CMV SDX: pAAV2 / 8-RC: pHelper in a 1:1:1 molar ratio). Add 1.5 mL of pre-warmed serum-free DMEM to each dish. Then add 120 µL of PEI (PEI:DNA mass ratio of 3:1) and vortex for 1 minute. Incubate at room temperature for 15 minutes, then drop the mixture into each culture dish. After 12 h of transfection, wash the cells once with PBS and incubate with 25 mL of complete DMEM medium. 3. Virus collection Cells were harvested 72 hours after transfection. Using a serum pipette, approximately 20 mL of culture medium was removed from the culture dish and transferred to a 50 mL centrifuge tube. 3-5 mL of culture medium should be retained in the culture dish along with the cells. HEK293T cells transfected per 15 cm² plate were scraped using a cell scraper, and the cell suspension was collected and transferred to a 50 mL centrifuge tube. The culture medium and cell suspension were rotated at 3900 rpm for 15 minutes at 4°C to induce cell spheroidization.

[0064] The supernatant was processed as follows: filtered through a 0.22µm PES membrane; the virus in the supernatant was concentrated using a Centricon Plus-70 (100kDa) at 3900 rpm at 4°C. The concentrated virus was then transferred to a new centrifuge tube.

[0065] The cell particles were processed as follows: Each cell particle was resuspended in AAV lysis buffer (500 µL AAV lysis buffer per plate) and combined into 50 mL centrifuge tubes. Cells were lysed by four freeze-thaw cycles (-80°C / 37°C), then allowed to return to 37°C. Benzoenzyme (250 U / µL) was added at 1 µL per 5 mL of cell suspension. The mixture was thoroughly mixed and incubated at 37°C for 1 hour, mixing every 15 minutes. The mixture was then centrifuged at 3900 rpm for 15 minutes at 4°C. The viral supernatant was filtered sequentially through 0.45 µm and 0.22 µm filters. The virus in the supernatant was concentrated using a Centricon Plus-70 (100 kDa) at 3900 rpm at 4°C. The concentrated virus was then mixed. The mixture can be stored overnight at 4°C or for extended periods at -80°C.

[0066] 4. Take 20µL of virus sample for DNA extraction, perform Q-PCR reaction, and measure virus titer.

[0067] Design Q-PCR primers, with the primer sequences as follows: Q-PCR primer1: ATGGCATCCCAAGCCAAGAGAGTA; Q-PCR primer2:AAAATGCCCAAGAGGTGGTCCTCT; Prepare 1× 10 10 A standard curve was generated by preparing a plasmid stock solution of molecules / µL. The standard curve plasmid was then continuously diluted 6 times to obtain two copies. The purified AAV sample was treated with benzo[a]ase / deoxyribonuclease I to eliminate any contaminating plasmid DNA carried over from the production process (deoxyribonuclease cannot penetrate viral particles); DNA was diluted 10, 100, and 1000 times and added to qPCR plates according to the 2X Universal SYBR Green Fast qPCR Mix (Abclonal, RM21203) system. Viral titers were then calculated.

[0068] Run the following procedure using SYBR on a Q-PCR instrument (QuantStudio6 Real-Time Quantitative PCR System): Table 2

[0069] 5. Subsequently, through minimally invasive surgery, these full-length SDX viral vectors were injected into the seminiferous tubules of mice with seven point mutations: S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G) for treatment.

[0070] Detailed evaluation of treatment efficacy: After several months of treatment, detailed histological analysis showed that HE staining of the testes of these point-mutated mice revealed restoration of seminiferous tubules and sperm production. Figure 2 ).

[0071] 6. Expanded Applications of Treatment Strategies: After identifying SDX point mutation sites through targeted sequencing, full-length SDX can be packaged into AAV viral vectors and injected into the seminiferous tubules of patients, aiming to treat all cases of premature testicular failure and oligoasthenospermia caused by SDX gene point mutations. This strategy demonstrates the enormous potential of gene therapy in the fields of precision medicine and the treatment of hereditary diseases.

[0072] This embodiment not only demonstrates the feasibility of gene therapy strategies targeting specific genetic mutations, but also showcases the significant potential of this strategy in treating hereditary infertility. In the future, this technology is expected to be further optimized and may be expanded to a wider range of genetic disease treatments.

[0073] Example 4: Construction of an SDX gene-deficient mouse model 1. Methods: Using CRISPR / Cas9 technology, gene knockout of target genes was performed based on the principle of homologous recombination. The specific process is as follows: guide RNA (gRNA) was designed and transcribed in vitro.

[0074] gRNA1:ACCCCCACATATGATCCTCA; gRNA2: CCATTTGATGACCTATTCAA; Cas9 and gRNA were simultaneously injected into mouse zygotes. Guided by gRNA, the Cas9 protein bound to the target site, causing a double-strand break (DSB), forcing the cell to initiate emergency repair. Under normal conditions, cells tend to repair the broken double strand using non-homologous DNA end joining (NHEJ), resulting in a deletion mutation in the target gene, thus achieving gene knockout.

[0075] 2. Isolate and observe SDX gene-deficient mice. Dissect the C57BL / 6J model mice and observe their testes. The results are as follows Figure 3 As shown in Figure A, the testes of SDX gene-deficient mice are smaller, and abnormalities in the seminiferous tubules were found in testicular tissue sections. Figure 3 B), abnormal seminiferous tubules account for about 50% ( Figure 3 C) The number of sperm in mice is reduced, and the decrease becomes more pronounced with age. Male mice become infertile after nine months. Considering the conservation of the SDX gene in humans and mice, it is speculated that the function of SDX in humans should be consistent with that in mice. SDX knockout mice exhibit obvious symptoms of premature testicular failure and oligospermia, and lose their fertility at nine months after birth.

[0076] 3. In SDX gene-deficient mice, there was an increase in age-related β-galactosidase-positive cells, and genes related to the aging secretion phenotype were upregulated. An increase in β-galactosidase-positive cells was observed in SDX gene knockout mice using a β-galactosidase kit (Beyotime C0602). Figure 4 A), β-galactosidase antibody (Cell Signaling Technology, 14B7) detection revealed that some supporting cells in gene-deficient mice were positive for β-galactosidase. Figure 4 B), transcriptome sequencing of RNA extracted from mouse testes revealed that knockout mice showed upregulation of genes associated with aging secretion phenotypes (Ccl24, Vegfc, Tnfrsf1b, Cxcl1, Ptges, Spon1, Mmp2, Tnfrsf1a, Il15, Timp2, Bmp6, Mmp14, Cd9, Axl, Ppara, Prkab1, Prkag1, Est2). Figure 4 C).

[0077] Example 5: Treatment of premature testicular failure mice with adeno-associated virus vector (AAV) 1. After constructing the overexpression vector, co-transfect the virus and then collect it. Take 20µL of virus sample for DNA extraction, perform Q-PCR, and measure the viral titer.

[0078] 2. Inject the virus into the testes of SDX knockout mice. The specific procedure is as follows: Prepare high-pressure surgical instruments in advance; anesthetize mice with 50-100 uL of 2% sodium pentobarbital solution via intraperitoneal injection (adjust the anesthetic volume according to mouse size); place the anesthetized mouse on the operating table and disinfect the abdomen with alcohol; cut the skin layer about 1 cm above the genitals, then cut the muscle layer, and use clean forceps to remove adipose tissue to expose the testis; aspirate about 15 uL of virus and add it to a pre-drawn injection needle, insert the needle into the seminiferous tubules at the junction of the testis and epididymis, press the injection pump button to inject the virus, and inject a total viral load of 1 × 10⁻⁶. 11 Molecules; SDX virus was injected into one testis and EGFP virus was injected into the other as a control; the injection needle was removed, the position of the mouse testis and epididymis was adjusted and placed into the abdominal cavity, and then pushed into the scrotum to reposition; the mouse wound was sutured with a suture needle, first suturing the muscle layer and then the skin layer; the mouse was removed and placed on a warm blanket to wait for the mouse to wake up before being put back into the cage.

[0079] Mice injected with the virus were fed for two months. After two months, the mice were dissected to observe the morphology of the testes and the epididymal tissue sections. The expression of SDX protein was observed by immunofluorescence staining.

[0080] 6. Results Analysis Mice were euthanized by cervical dislocation, their weight was measured and recorded; the mice were dissected, and their testes and epididymis were removed, with the testes weighed; the testes of mice treated with AAV-SDX weighed 0.0588g. Figure 5 A, right side), the testis weight of mice in the control group AAV-EGFP was 0.167g ( Figure 5 (A, left side); the size of the testicles was significantly restored after treatment. Following AAV-SDX treatment, testicular sections in mice showed abnormal lumens in only 8.96% of cases, while all lumens in the control group were abnormal. Epididymal tissue sections revealed sperm in the epididymal lumens of mice that underwent SDX replacement, while the control group showed no sperm. Figure 5 B); By detecting whether SDX was expressed in the testes of AAV-infected mice, we also found, through immunofluorescence staining, that SDX was expressed in Sertoli cells of the seminiferous tubules of knockout mice. Figure 5 C). The treated male mice were mated with wild-type female mice. After one month of natural mating, the female mice became pregnant and gave birth to 8 mice. Figure 5 D).

[0081] The above results indicate that AAV-SDX treatment of SDX-deficient mice can restore testicular size, normalize spermatogenesis, and improve spermatogenesis, enabling them to produce offspring through natural mating or in vitro fertilization, thus improving the mice's reproductive capacity.

[0082] Example 6: Treatment of premature testicular failure by increasing SDX protein expression in the testes using mRNA drugs. 1. mRNA Synthesis: Modified mRNAs with a 5' cap structure (Cap 1) and a 3' poly(A) tail were synthesized using in vitro transcription to improve their stability and translation efficiency. The mRNAs were purified by high-performance liquid chromatography (HPLC) or rapid liquid chromatography (FPLC).

[0083] 2. The synthesized mRNA is encapsulated in lipid nanoparticles (LNPs) to promote its stability and efficient delivery in vivo.

[0084] 3. Testicular injection in mice: An experimental group and a control group were set up. The experimental group was injected with LNPs containing SDX mRNA into SDX-deficient mice, while the control group was injected with blank LNPs without mRNA into SDX-deficient mice. The drugs were administered via local injection in the testes or via tail vein injection, twice a week for 4 weeks.

[0085] 4. Western blot was used to detect the mRNA and protein expression levels of the SDX gene in testicular tissue.

[0086] 5. Testes of mice in the experimental group and the control group were collected for observation.

[0087] By treating SDX-deficient mice with synthetic mRNA drugs, we found SDX expression in the experimental group mice under Western blot analysis, while no SDX expression was observed in the control group. Figure 6 A). The testicular size of the mice in the experimental group recovered to some extent, while the testicular size of the control group remained unchanged. Figure 6 B).

[0088] Example 7: Application of detecting SDX gene sequence in the genome in the preparation of a testicular premature failure or oligoasthenospermia detection kit 1. Materials Peripheral blood of 200 μL was collected from patients with premature testicular failure and oligoasthenospermia.

[0089] 2. Extracting genome from blood tissue The blood gene extraction kit (brand: TIANGEN, catalog number: DP304) was used. The specific procedures were performed according to the instructions, and the main steps are as follows: (1) Processing blood samples (no processing is required when the blood sample is 200uL).

[0090] (2) Add 20 μL of Proteinase K solution and mix well. Add 200 μL of buffer GB, mix thoroughly by inverting, and incubate at 70°C for 10 minutes. The solution should become clear. Briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0091] (3) Add 200 μL of anhydrous ethanol and shake thoroughly for 15 seconds (s). At this time, flocculent precipitate may appear. Briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0092] (4) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (place the adsorption column in the collection tube), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0093] (5) Add 500 μL of buffer GD to the adsorption column CB3 (please check whether anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 into the collection tube.

[0094] (6) Add 600 μL of washing solution PW to the adsorption column CB3 (please check whether anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 into the collection tube.

[0095] (7) Repeat step (6).

[0096] (8) Place the adsorption column CB3 back into the collection tube, centrifuge at 12,000 rpm for 2 minutes, and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to thoroughly dry any residual rinsing liquid in the adsorption material.

[0097] (9) Transfer the adsorption column CB3 into a clean centrifuge tube, add 50-200 μl of elution buffer TE to the middle of the adsorption membrane, place at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 2 minutes, and collect the solution into the centrifuge tube.

[0098] (10) Store the DNA solution at -20°C or -80°C.

[0099] 3. The obtained peripheral blood genomic DNA solution from the patient was sent to a sequencing company for whole-genome sequencing.

[0100] 4. Analyze the SDX gene sequence in the genome. (1) The SDX gene exon sequence has no mutations, which confirms that the patient's premature testicular failure is not related to the SDX gene. Other gene mutations need to be analyzed or other causes need to be considered.

[0101] (2) Mutations in the promoter or enhancer sequence of the SDX gene: If a mutation occurs in the bases of the promoter or enhancer sequence of the SDX gene, and the expression of the encoded protein remains unchanged, it can be determined that the patient's premature testicular failure is not related to the SDX gene; if a mutation occurs in the bases of the promoter or enhancer sequence of the SDX gene, and the expression level of the SDX protein is significantly reduced, it can be determined that the patient's premature testicular failure is related to the SDX gene.

[0102] (3) The SDX gene coding sequence contains base deletions or insertions: If a base is deleted or inserted in a non-3-fold order in the exon sequence of the SDX gene, the encoded protein will definitely be affected. Therefore, premature testicular failure in patients is associated with SDX. If a deletion or insertion occurs at an integer multiple of 3, it can lead to the deletion or insertion of additional amino acid residues in the encoded protein. Furthermore, if the alteration occurs in an important functional domain, it can lead to a decrease in SDX activity. Further determination of the encoded protein sequence is required, and specific protein expression and functional verification should be consulted.

[0103] (4) Base substitutions exist in the coding sequence of the SDX gene: If a synonymous mutation occurs in the exon sequence of the SDX gene (the base substitution does not change the type of encoded amino acid), the final encoded protein remains unchanged. Therefore, premature testicular failure and oligoasthenospermia are not related to the SDX gene. If nonsense mutations occur in the exon sequence of the SDX gene (base substitutions leading to premature termination of protein translation), it will ultimately affect the activity and function of the SDX protein. Therefore, premature testicular failure and oligoasthenospermia are related to the SDX gene. During whole-genome sequencing analysis, it is also necessary to analyze other reported genomic sequences related to premature testicular failure patients. If the patient has mutations in other reported related genes, polygenic variation leading to the above diseases can be considered.

[0104] Example 8: Application of detecting SDX-encoded protein expression levels in the preparation of a testicular premature aging or oligoasthenospermia detection kit 1. Obtain the organization Reproductive organ tissues from premature testicular failure and oligospermia are obtained through tissue biopsy (requiring professional medical personnel).

[0105] 2. Preparation of protein samples (1) Add 100 μL of RIPA lysis buffer (brand: Beyotime, catalog number: P0013K) and add 1x protease inhibitor Cocktail (brand: Roche, catalog number: 11836145001) to lyse the tissue. Grind on ice, sonicate after grinding, and lyse by tumbling on a shaker at 4°C for 60 minutes. Then centrifuge at 12000g at 4°C for 10 minutes and collect the supernatant.

[0106] (2) Protein concentration was determined by BCA method (brand: Beyotime, item number: P0012).

[0107] (3) Add 5x SDS-PAGE protein loading buffer (brand: Abclonal, catalog number: RM00001), mix, boil in water for 10-15 minutes, and then cool on ice.

[0108] 3. Western blot reaction (1) Install the glue generator according to the instruction manual and prepare 5% stacking glue and 10% separating glue respectively.

[0109] (2) Sample loading: The amount of protein loaded is 10~100ng.

[0110] (3) Electrophoresis: After loading the sample, connect the power supply to the electrophoresis apparatus, ensuring that the positive and negative electrodes are connected correctly. Set appropriate electrophoresis parameters. The stacking gel electrophoresis parameter is a constant voltage of 60V. When the sample enters the separating gel, the electrophoresis voltage can be adjusted to 120V. When the bromophenol blue electrophoresis reaches the bottom of the gel, stop the electrophoresis and turn off the power supply to the electrophoresis apparatus.

[0111] (4) Transfer: Remove the gel from the glass plate and place a porous pad, a filter paper, gel, PVDF membrane, three filter papers, and a porous pad ("sandwich" structure) on the clamp plate in sequence. Place the transferred membrane in the transfer tank and transfer the membrane at a constant current of 250mA for 90 minutes.

[0112] (5) Blocking: Remove the membrane from the "sandwich" structure, place it in a suitable antibody incubation tank, add 5% skim milk / TBST Buffer (mass / volume) and block at room temperature for 1 hour.

[0113] (6) Primary antibody incubation: Rabbit anti-human SDX polyclonal antibody prepared in the laboratory and diluted with 3% bovine serum albumin (BSA) / TBST Buffer (mass / volume) at a dilution ratio of 1:100~1:200; GAPDH mouse monoclonal antibody (brand: Protein Tech, catalog number: 60004-1-Ig) was diluted at a dilution ratio of 1:50000. Primary antibody incubation was performed overnight at 4°C.

[0114] (7) Washing: After the primary antibody incubation is complete, add TBST Buffer and wash 4 times, 5 min each time.

[0115] (8) Secondary antibody incubation: The secondary antibody HRP Goat Anti-Rabbit IgG (H+L) (brand: Abclonal, catalog number: AS014) was diluted with TBST Buffer at a ratio of 1:5000. Incubate at room temperature for 1 hour.

[0116] (9) Washing: After the secondary antibody incubation is completed, add TBST Buffer and wash 4 times, 5 min each time.

[0117] (10) Development: ECL developer (brand: Thermo Fisher Scientific, item number: 1863094), after mixing solutions A and B in the dark, drop it onto the PVDF film for digital development.

[0118] 4. Data Calculation Protein quantification was performed using the BCA method. GAPDH (whose content varies little across different cells and is unaffected by changes in the target protein) was used as an internal reference protein for relative quantification of SDX protein (the ratio of SDX protein to the internal reference protein was used as the quantification value). A control group (normal testes) was also included. The developed images of different samples were processed to grayscale, and the grayscale values ​​or grayscale areas were calculated.

[0119] 5. Results Analysis (1) There was no difference between the detection group and the control group (location, content): This indicates that the expression level of SDX protein in patients with premature testicular failure and oligoasthenospermia is no different from that in normal people. At the same time, if the gene sequence is correct, the possibility that SDX abnormality leads to premature testicular failure and oligoasthenospermia can be further ruled out.

[0120] (2) The position of the SDX protein band in the detection group changed: combined with the SDX gene sequence information, it indicates that the SDX protein terminated prematurely, or that the stop codon was lost due to the insertion of bases and a new sequence was added; it can be judged that the possibility of premature testicular failure and oligoasthenospermia is due to SDX mutation.

[0121] (3) Increased SDX protein content in the test group: This suggests that the activity of SDX protein is reduced. Combined with SDX gene sequence information (functional domain mutation) and protein interaction experiments (decreased protein binding), it can increase the possibility of diagnosing SDX-induced premature testicular failure and oligoasthenospermia.

[0122] 6. Tissue fixation and dehydration The tissue obtained by puncture was fixed with 4% PFA / PBS (mass / volume) at 4°C for 2 hours, and then dehydrated with 30% Sucrose / PBS (mass / volume) at 4°C overnight.

[0123] 7. Tissue embedding and sectioning The dehydrated tissue was embedded at -80°C using NEG-50 (Thermo Fisher Scientific), and then frozen sectioned.

[0124] 8. Immunofluorescence of frozen sections Sealing: Use a water-blocking pen to draw a circle around the tissue on the slide, completely cover the sample with 10% goat serum / TBS Buffer (volume / volume), place the slide in a humidified chamber and incubate at room temperature for 1 hour.

[0125] Primary antibody incubation: Remove the blocking solution and directly add the primary antibody working solution (laboratory-made rabbit anti-human SDX polyclonal antibody, dilution ratio: 1:50) prepared in 10% goat serum / TBS Buffer (volume / volume) to the sample. The sample must be completely covered, and the slide should be placed in a humidified chamber and incubated overnight at room temperature. Wash once with TBST buffer for 5 minutes; wash three times with TBS buffer for 5 minutes each time. Secondary antibody incubation: Add the fluorescent secondary antibody working solution - Alexa Fluor 488-conjugated Goat anti-Rabbit IgG (H+L) (brand: Abclonal, catalog number: AS053) prepared in 10% goat serum / TBS Buffer (volume / volume) to the sample. The sample must be completely covered, protected from light, and incubated at room temperature for 1 hour. Wash once with TBST buffer for 5 minutes; wash three times with TBS buffer for 5 minutes each time. Nucleus staining: Add a DAPI-containing fluorescence attenuation mounting medium to the sample, then cover with a coverslip and observe and acquire images under a fluorescence microscope.

[0126] 9. Results Analysis The SDX protein fluorescence signal disappeared in the detection group: Combined with SDX gene sequence information and Western blot results, it indicates that SDX protein expression is absent or prematurely terminated, further proving that SDX abnormalities are the cause of premature testicular failure and oligoasthenospermia. The SDX protein fluorescence signal in the detection group was consistent with that in the control group: There were no mutations in the SDX gene exon sequence, and Western blot results showed that the size and content of SDX protein in the detection group were not different from those in the control group, further ruling out the possibility of SDX abnormalities in premature testicular failure and oligoasthenospermia.

[0127] If the SDX gene exon sequence shows a fold deletion or insertion of 3, and Western blot results show a change in the position of the SDX protein band in the test group, the activity of abnormally expressed SDX may be affected. Premature testicular failure and oligoasthenospermia may be associated with SDX abnormalities, requiring further determination of the encoding protein sequence, specifically in conjunction with protein function verification. A weakened fluorescence signal of SDX protein in the test group: Combining SDX genome sequencing sequence variation information with SDX expression level analysis in Western blot experiments can improve the likelihood of SDX causing premature testicular failure and oligoasthenospermia.

[0128] Finally, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims and their equivalents, this invention is also intended to include these modifications and variations.

Claims

1. The application of reagents for detecting mutated pathogenic genes associated with premature testicular failure or oligoasthenospermia in the preparation of diagnostic products for premature testicular failure or oligoasthenospermia, characterized in that, Compared with the gene PWWP3B with nucleotide sequence as shown in SEQ ID NO: 24, the mutated pathogenic gene has at least one of the following seven mutation sites: T655C, G769A, C1645T, G1646A, C1781A, G1940T, and C1864G.

2. A method for constructing a mouse model of PWWP3B gene-related point mutation, characterized in that, The method includes: The gRNAs with nucleotide sequences shown in SEQ ID NO.9-SEQ ID NO.10, SEQ ID NO.11-SEQ ID NO.12, SEQ ID NO.13-SEQ ID NO.14, SEQ ID NO.15-SEQ ID NO.16, SEQ ID NO.17-SEQ ID NO.18, SEQ ID NO.19-SEQ ID NO.20, and SEQ ID NO.21-SEQ ID NO.22 were transcribed into mRNA in vitro to obtain well-transcribed sgRNA. Obtain active Cas9 mRNA; Target donors with nucleotide sequences as shown in SEQ ID NO.2-SEQ ID NO.8 were obtained respectively; The transcribed sgRNA, Cas9 mRNA and corresponding target donors were mixed and microinjected into mouse zygotes to obtain F0 generation mice; Select F0 generation positive mice from the F0 generation genotype identification results and mate them with wild-type mice to obtain F1 generation mice with stable genotypes. After screening, point mutation mouse models are obtained.

Images