Application of circular RNA CircSPRED2 in preparation of preparation for detecting and treating platinum resistance of human ovarian cancer

Abstract

The invention discloses an application of circular RNA (Ribonucleic Acid) CircSPRED2 in preparation of a preparation for detecting and treating platinum resistance of human ovarian cancer. Researches show that the circular RNA CircSPRED2 is highly expressed in ovarian cancer platinum drug-resistant tissues and cells, and the highly expressed circular RNA CircSPRED2 promotes platinum drug resistance of ovarian cancer cells and has the potential of serving as an ovarian cancer platinum drug-resistant molecular marker and a target spot. Therefore, a short hairpin RNA expression vector for RNA interference is designed and applied to silence the expression of the circular RNA CircSPRED2, so that the anti-tumor biological preparation for improving the sensitivity of ovarian cancer cells to platinum chemotherapeutic drugs is provided, and the application prospect is good.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to application of circular RNA CircSPRED2 in preparing a platinum-resistance detection reagent and a therapeutic preparation for human ovarian cancer. Background Art

[0002] Ovarian cancer (OC) is one of the most common gynecological malignancies. Due to the lack of obvious early symptoms and the lack of effective screening methods, most patients are in the advanced stage when they seek medical treatment. For patients with advanced ovarian cancer, the main treatment option at this stage is still surgery combined with chemotherapy based on paclitaxel and platinum drugs, but up to 70% of patients in stages III-IV relapse within three years, showing reduced responsiveness to platinum drugs. In order to improve the survival time and quality of life of patients with platinum-resistant recurrent ovarian cancer, finding new platinum-resistant targets is an urgent clinical need.

[0003] Circular RNA (circRNA) is a type of covalently closed single-stranded circular transcript, which is produced by reverse splicing of precursor RNA (pre-RNA), has no 5' cap or 3' poly (A) tail, and is highly stable and conservative. With the widespread application of high-throughput sequencing technology, the abnormal expression of circRNA in tumor tissues has gradually attracted attention. It is reported that circRNA is widely involved in the regulation of ovarian cancer cell proliferation, invasion and metastasis, and chemotherapy resistance, and has the potential to serve as a new resistance indicator and therapeutic target.

[0004] The present study shows that circular RNA CircSPRED2 is highly expressed in platinum-resistant tissues and cells of ovarian cancer, and highly expressed circular RNA CircSPRED2 promotes platinum resistance in ovarian cancer cells, and has the potential to be used as a molecular marker and target for platinum resistance in ovarian cancer. Therefore, we designed and applied a short hairpin RNA expression vector for RNA interference to silence the expression of circular RNA CircSPRED2, thereby increasing the sensitivity of ovarian cancer cells to platinum chemotherapy drugs as an anti-tumor biological agent. Summary of the invention

[0005] The first object of the present invention is to provide an application of a reagent for detecting circular RNA CircSPRED2 in the preparation of a preparation for detecting platinum resistance in human ovarian cancer. The sequence of the circular RNA CircSPRED2 is as follows, see SEQ ID NO: 1.

[0006] TGACAGCTATATTGTGCGTGTCAAGGCTGTGGTTATGACCAGAGATGACTCCAGCGGGGGATGGTTCCCACAGGAAGGAGGCGGGATCAGTCGCGTCGGGGTCTGTAAGGTCATGCACCCCGAAGGCAATGGACGAAGCGGCTTTCTCATCCATGGTGAACGACAGAAAGACAAACTGGTGGTATTGGAATGCTATGTAAGAAAGGACTTGGTCTACACCAA AGCCAATCCAACGTTTCACTGGAAGGTCGATAATAGGAAGTTTGGACTTACTTTCCAAAGCCCTGCTGATGCCCGAGCCTTTGACAGGGGAGTAAGGAAAGCAATCGAAGACCTTATAGAAGGTTCAACAACGTCATCTTCCACCATCCATAATGAAGCTGAGCTTGGCGATGATGACGTTTTTACA.

[0007] The human ovarian cancer platinum resistance detection preparation comprises a reagent for detecting the expression amount of circular RNA CircSPRED2 in human ovarian cancer tissues or cells.

[0008] The reagents for detecting the expression of circular RNA CircSPRED2 in human ovarian cancer tissues and cells include, but are not limited to, real-time fluorescence quantitative PCR detection reagents; preferably, the real-time fluorescence quantitative PCR detection reagents include specific primers for real-time fluorescence quantitative PCR:

[0009] Circular RNA CircSPRED2 forward primer: 5'-TTTCCAAAGCCCTGCTGATG-3', see SEQ NO: 2;

[0010] Circular RNA CircSPRED2 reverse primer: 5'-ATAGCTGTCATGTAAAAACGTCAT-3' see SEQ NO: 3.

[0011] But not limited to the above specific primers

[0012] The real-time fluorescence quantitative PCR detection reagent also includes:

[0013] Specific primers for internal reference GAPDH:

[0014] Forward primer: 5'-AACGGATTTGGTCGTATTGG-3'; see SEQ NO: 4;

[0015] Reverse primer: 5'-TTGATTTTGGAGGGATCTCG-3'; see SEQ NO:5.

[0016] But not limited to the above specific internal reference controls

[0017] The second object of the present invention is to provide a human ovarian cancer platinum resistance detection kit, comprising a real-time fluorescence quantitative PCR detection reagent for the expression of circular RNA CircSPRED2 in human ovarian cancer tissue, preferably the real-time fluorescence quantitative PCR detection reagent for the expression of circular RNA CircSPRED2 in human ovarian cancer tissue includes specific primers for real-time fluorescence quantitative PCR:

[0018] Circular RNA CircSPRED2 forward primer: 5'-TTTCCAAAGCCCTGCTGATG-3', see SEQ NO: 2;

[0019] Circular RNA CircSPRED2 reverse primer: 5'-ATAGCTGTCATGTAAAAACGTCAT-3', see SEQ NO: 3.

[0020] But not limited to the above specific primers

[0021] Specific primers for internal reference GAPDH:

[0022] Forward primer: 5'-AACGGATTTGGTCGTATTGG-3'; see SEQ NO: 4;

[0023] Reverse primer: 5'-TTGATTTTGGAGGGATCTCG-3'; see SEQ NO:5.

[0024] But not limited to the above specific internal reference controls

[0025] The kit also includes: (1) reagents for extracting total RNA from ovarian cancer tissue, including Trizol reagent, chloroform, isopropanol, 75% ethanol, and enzyme-free water; (2) reagents for reverse transcribing circular RNA CircSPRED2 and internal reference GAPDH into cDNA using total RNA as a template, including reverse transcription buffer, dNTP, RNase inhibitor, MMLV reverse transcriptase, and random primers; (3) reagents for real-time quantitative PCR of cDNA, including circular RNA CircSPRED2 specific primers, internal reference GAPDH primers, real-time fluorescent quantitative SYBR dye, and enzyme-free water.

[0026] The method for using the above-mentioned detection preparation is as follows: (1) collecting tumor tissue from ovarian cancer patients and extracting total RNA; (2) using total RNA as a template to reverse transcribe circular RNA CircSPRED2 and GAPHD into cDNA; (3) using circular RNA CircSPRED2 specific primers and internal reference GAPDH primers to perform real-time fluorescence quantitative PCR amplification to obtain relative expression levels. The higher the multiple, the higher the degree of platinum resistance of ovarian cancer patients.

[0027] The third object of the present invention is to provide a method for using circular RNA CircSPRED2 in preparing a therapeutic preparation for platinum-resistant human ovarian cancer. The sequence of the circular RNA CircSPRED2 is shown in SEQ NO: 1.

[0028] The preparation for treating platinum-resistant human ovarian cancer includes a preparation for enhancing the chemotherapy sensitivity of platinum-resistant human ovarian cancer.

[0029] The platinum-resistant therapeutic preparation for human ovarian cancer includes a preparation that inhibits the expression of circular RNA CircSPRED2;

[0030] A preferred agent for inhibiting the expression of circular RNA CircSPRED2 is a short hairpin RNA expression vector for RNA interference designed for circular RNA CircSPRED2.

[0031] More preferably, the interference target sequence required for preparing the short hairpin RNA expression vector for RNA interference is as follows:

[0032] 5′-GACGTTTTTACATGACAGC-3′.

[0033] The most preferred method is to design an oligonucleotide single strand and its reverse complementary sequence capable of forming a hairpin structure for the interference target sequence, and form a DNA double strand with sticky ends having restriction enzyme cutting sites at both ends after annealing. The oligonucleotide single strand and its reverse complementary sequence capable of forming a hairpin structure are specifically as follows:

[0034] sh-CircSPRED2

[0035] 5'-CCGGTGACGTTTTTACATGACAGCTTCAAGAGAGCTGTCATGTAAAAACGTCT TTTTG-3'

[0036] 5'-AATTCAAAAAGACGTTTTTACATGACAGCTCTCTTGAAGCTGTCATGTAAAAA CGTCA-3'

[0037] The fourth object of the present invention is to provide a preparation for treating platinum-resistant human ovarian cancer, including a preparation for inhibiting the expression of circular RNA CircSPRED2.

[0038] The preparation for inhibiting the expression of circular RNA CircSPRED2 is a short hairpin RNA expression vector for RNA interference designed for the circular RNA CircSPRED2;

[0039] Preferably, the interference target sequence required for preparing the short hairpin RNA expression vector for RNA interference is as follows:

[0040] 5′-GACGTTTTTACATGACAGC-3′.

[0041] Further preferred: for the interference target sequence and the vector, a single-stranded oligonucleotide and its reverse complementary sequence that can form a hairpin structure are designed, and after annealing, a double-stranded DNA with sticky ends with restriction enzyme cutting sites at both ends is formed. The specific sequence is as follows:

[0042] sh-CircSPRED2

[0043] 5'-CCGGTGACGTTTTTACATGACAGCTTCAAGAGAGCTGTCATGTAAAAACGTCT TTTTG-3'

[0044] 5'-AATTCAAAAAGACGTTTTTACATGACAGCTCTCTTGAAGCTGTCATGTAAAAA CGTCA-3'

[0045] The blank vector for inhibiting the expression of circular RNA CircSPRED2 includes but is not limited to the pLKO.1puro (purchased from Addgene) vector.

[0046] Previous studies have shown that the applicant collected tumor tissue samples from patients with platinum-resistant and platinum-sensitive ovarian cancer, extracted total RNA from each tumor tissue sample, and analyzed the expression of circular RNA CircSPRED2 by real-time fluorescence quantitative PCR after reverse transcription. It was found that circular RNA CircSPRED2 was highly expressed in tumor tissues of patients with platinum-resistant ovarian cancer, which is consistent with the trend of previous high-throughput sequencing. Based on this, the applicant proposed to use circular RNA CircSPRED2 to prepare a marker detection reagent for platinum resistance in human ovarian cancer, and further provide a cost-effective and easy-to-apply human ovarian cancer platinum resistance detection kit.

[0047] In addition, the present invention also finds that by inhibiting the expression of circular RNA CircSPRED2, the sensitivity of human ovarian cancer cells to platinum drugs can be improved, thereby providing a preparation for enhancing the sensitivity of human ovarian cancer cells to platinum drugs for chemotherapy.

[0048] The detection reagent of the present invention can be used to detect the expression level of circular RNA CircSPRED2 in human ovarian cancer tissue samples, providing a molecular marker of CircRNA for predicting the efficacy of platinum drugs for human ovarian cancer patients, and also providing a preparation for enhancing the chemotherapy sensitivity of human ovarian cancer to platinum drugs, which has far-reaching practical significance and promotion. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 It is a heat map analysis for high-throughput sequencing;

[0050] Figure 2 To analyze the differential expression of circular RNA CircSPRED2 in tumor tissues of platinum-sensitive and platinum-resistant human ovarian cancer patients by real-time fluorescence quantitative PCR;

[0051] Figure 3 Real-time fluorescence quantitative PCR was used to analyze the differential expression of circular RNA CircSPRED2 in human ovarian cancer cells and induced ovarian cancer platinum-resistant cells;

[0052] Figure 4 The RNA expression level of CircSPRED2 in A2780 and OVCAR3 cells after infection with circular RNA CircSPRED2 inhibitor;

[0053] Figure 5 Cell viability of A2780 and OVCAR3 cells treated with different concentrations of cisplatin and carboplatin after stable infection of A2780 and OVCAR3 cells with circular RNA CircSPRED2 inhibitors;

[0054] Figure 6 The apoptosis rate of A2780 and OVCAR3 cells treated with cisplatin and carboplatin after stable infection of circular RNA CircSPRED2 inhibitor;

[0055] Figure 7 This is the result of real-time fluorescence quantitative PCR analysis to detect the expression correlation between circular RNA CircSPRED2 and its parental gene SPRED2. DETAILED DESCRIPTION

[0056] The following examples are intended to further illustrate the present invention, but are not intended to limit the present invention.

[0057] High-throughput sequencing was used to analyze the expression of circular RNA in platinum-resistant and platinum-sensitive ovarian cancer tumor tissues. The heat map analysis of the results is shown in Figure 1 The top 20 circular RNAs that were significantly upregulated or downregulated in platinum-resistant ovarian cancer tissues included hsa_circ_0007961, the circular RNA CircSPRED2.

[0058] Example 1

[0059] In the previous research work, the applicant collected 8 tumor tissue samples from patients with platinum-resistant and platinum-sensitive ovarian cancer, extracted total RNA from each tumor tissue sample, and analyzed the expression of circular RNA CircSPRED2 by real-time fluorescence quantitative PCR after reverse transcription. It was found that the expression of circular RNA CircSPRED2 in tumor tissues of platinum-resistant patients was higher than that in platinum-sensitive patients, and there was a statistical difference, which was consistent with the trend of previous high-throughput sequencing. Based on this, the applicant proposed to use CircSPRED2 to prepare a marker detection reagent for platinum resistance in human ovarian cancer.

[0060] Example 2 Detection of circular RNA CircSPRED2 in human ovarian cancer cells and induced ovarian cancer platinum-resistant cells

[0061] (1) Collect human ovarian cancer parental cells and induced platinum-resistant ovarian cancer cells, and extract total RNA: remove all the culture medium in the culture plate, add 1 ml Trizol, place horizontally on ice for 5 minutes, allow the lysate to be evenly distributed on the cell surface, and then blow the cells with a pipette to make the cells fall off; transfer the cell lysate to a centrifuge tube, add 200 μL chloroform, cover the centrifuge tube tightly, oscillate up and down for 15 seconds, let it stand on ice for 5 minutes, and centrifuge at 13000g at 4℃ for 15 minutes. Take out the centrifuge tube, and the sample is divided into three layers: a light-colored supernatant aqueous phase, a middle white layer, and a pink lower organic phase. Carefully aspirate the light-colored supernatant aqueous phase and transfer it to another centrifuge tube, add an equal volume of isopropanol, mix gently, let it stand at -20℃ for 30 minutes, and then centrifuge at 13000g at 4℃ for 15 minutes. White RNA precipitate can be seen at the bottom of the tube. Carefully remove the supernatant, slowly add 1 mL of 75% ethanol along the wall of the tube, and mix gently. Centrifuge at 7500g, 4℃ for 5 minutes, and carefully remove the supernatant. Dry the precipitate at room temperature for 2-5 minutes, add 30-50μL of enzyme-free water to dissolve the RNA precipitate, and detect the concentration and quality of RNA with a spectrophotometer. The OD260 / 280 ratio should be between 1.8-2.0, and store at -80℃.

[0062] (2) Using total RNA as a template, circular RNA CircSPRED2 and internal reference GAPDH were reverse transcribed into cDNA;

[0063] Random primers (100 μM) 1 μL

[0064] Total RNA 1μg

[0065] Enzyme-free water Total 12μL

[0066] Reverse transcription step 1: 65°C, 5 minutes

[0067]

[0068] Reverse transcription second step program: 25°C, 5 minutes; 42°C, 60 minutes; 72°C, 5 minutes.

[0069] (3) Real-time fluorescence quantitative PCR using circular RNA CircSPRED2 specific primers and internal reference GAPDH primers:

[0070] The circular RNA CircSPRED2 specific primer and internal reference GAPDH primer DNA sequences were synthesized by Shanghai Bioengineering Company.

[0071] First, dilute the reverse transcription product 5 times and mix well. The 20 μL reaction system is as follows:

[0072]

[0073] The real-time fluorescence quantitative PCR reaction was performed at 95°C for 30 seconds; 40 cycles of 95°C for 5 seconds; 65°C for 30 seconds; 72°C for 30 seconds; and 65-95°C, increasing by 0.5°C every 0.05 seconds.

[0074] Specific primers for fluorescent quantitative PCR:

[0075] CircRNA CircSPRED2 forward primer: 5'-TTTCCAAAGCCCTGCTGATG-3'

[0076] CircRNA CircSPRED2 reverse primer: 5'-ATAGCTGTCATGTAAAAACGTCAT-3'

[0077] Specific primers for internal reference GAPDH:

[0078] 5'-AACGGATTTGGTCGTATTGG-3'

[0079] 5'-TTGATTTTGGAGGGATCTCG-3'

[0080] But not limited to the above specific internal reference controls

[0081] (4) Expression determination: The experimental data were analyzed by relative quantitative analysis method, GAPDH was used as the internal reference gene, and the data were analyzed by GraphPad Prism. The circular RNA CircSPRED2 was successfully induced to be significantly upregulated in platinum-resistant ovarian cancer cells, and the difference was statistically significant (p<0.05).

[0082] Example 3

[0083] Based on the circular RNA CircSPRED2, a preparation was prepared to interfere with its expression and promote the enhanced sensitivity of ovarian cancer cells to platinum-based chemotherapy drugs.

[0084] The preparation is a short hairpin RNA expression vector designed for CircRNACircSPRED2 and used for RNA interference.

[0085] The interference targets required for preparing the short hairpin RNA expression vector for RNA interference are as follows:

[0086] 5'-GACGTTTTTACATGACAGC-3',

[0087] According to the target sequence and vector, a single-stranded oligonucleotide and its reverse complementary sequence that can form a hairpin structure are designed. After annealing, they form a double-stranded DNA with sticky ends with restriction enzyme cutting sites at both ends. The specific sequence is as follows:

[0088] sh-CircSPRED2

[0089] 5'-CCGGTGACGTTTTTACATGACAGCTTCAAGAGAGCTGTCATGTAAAAACGTCT TTTTG-3'

[0090] 5'-AATTCAAAAAGACGTTTTTACATGACAGCTCTCTTGAAGCTGTCATGTAAAAA CGTCA-3'

[0091] The preparation method of the short hairpin RNA expression vector for RNA interference is as follows:

[0092] (1) Design of shRNA

[0093] First, we searched for shRNA targets based on the sequence of circular RNA CircSPRED2. The target sequences are as follows:

[0094] 5'-GACGTTTTTACATGACAGC-3',

[0095] A widely used scramble sequence without any target in the human genome was used as a negative control, and its sequence is as follows:

[0096] scramble RNA 5'-GCTGCAGTGTCTACTAAGT-3

[0097] (2) Based on the target sequence and scramble sequence, as well as the pLKO.1puro vector, a single-stranded oligonucleotide and its reverse complementary sequence that can form a hairpin structure are designed. After annealing, they can form a double-stranded DNA with sticky ends with restriction enzyme cutting sites at both ends. The specific sequences are as follows:

[0098] sh-CircSPRED2

[0099] 5'-CCGGTGACGTTTTTACATGACAGCTTCAAGAGAGCTGTCATGTAAAAAC GTCTTTTTG-3'

[0100] 5'-AATTCAAAAAGACGTTTTTACATGACAGCTCTCTTGAAGCTGTCATGTAA AAACGTCA-3'

[0101] (3) Construction of shRNA vector

[0102] Chemically synthesize the above shRNA and the four single-stranded oligo sequences of the control. Dissolve the synthesized oligo in oligoannealing buffer to 20 μL, take 10 μL of each complementary single strand, and then heat the oligo mixture at 95°C in a PCR instrument for 5 minutes, and then cool it naturally to room temperature to form double-stranded oligo fragments:

[0103] The pLKO.1puro plasmid was double-digested with AgeI and EcoRI to recover a 7.0 kb vector fragment. The DNA at the annealed sticky ends and the vector recovered by enzyme digestion were mixed in a 3:1 ratio. The DNA was ligated with T4 ligase at 25 degrees for 1 hour, and the cells were transformed into DH5α competent cells. Single clones were selected, shaken, and sequenced to determine whether the target fragment was accurately inserted.

[0104] The present invention provides for the first time an RNA interference inhibitor with potential and prospects for ovarian cancer gene therapy, which has far-reaching significance and promotion.

[0105] Example 4

[0106] Construction of ovarian cancer cell line with stable knockdown of circular RNA CircSPRED2

[0107] A2780 and OVCAR3 cells are from the ATCC cell bank in the United States. The DMEM high glucose, 1640 medium and fetal bovine serum used in cell culture and the trypsin used for cell digestion are all products of Shanghai Yuanpei.

[0108] (1) Specific steps

[0109] 1) Use an endotoxin-free plasmid extraction kit to extract the virus packaging plasmids pSPAX2, pMD2.G; pLKO.1-puro blank control plasmid and the target plasmid, respectively, determine the concentration, and store them in a -80°C refrigerator for later use.

[0110] 2) One day in advance, select 293T cells in good condition and digest them to 10cm 2 Make sure the cell density reaches about 80% for lentiviral packaging the next day.

[0111] 3) Take 7.5 μg of pSPAX2 and pMD2.G respectively, and 10 μg of blank control plasmid or target plasmid, add them to 3 ml of serum-free culture medium, and take 100 μL of PEI and add it to 3 ml of serum-free culture medium, mix them respectively, and incubate at room temperature for 5 minutes.

[0112] 4) Add the culture medium containing PEI to the other tube, mix well, and incubate at room temperature for 20 minutes.

[0113] 5) 293T cells were washed twice with D-hanks and then added to the incubated mixture. After 6-8 hours, the culture medium was replaced with complete medium.

[0114] 6) After 48 hours, the supernatant was collected and centrifuged at 1000 rpm for 10 min. The supernatant was filtered using a 0.45 μM filter to obtain the virus stock solution, which was then divided and stored in a -80°C refrigerator for later use.

[0115] 7) One day in advance, select A2780 and OVCAR3 cells in good condition, digest and seed them into 6-well plates to ensure that the cell density reaches about 40% when infected with lentivirus the next day.

[0116] 8) Discard the original cell culture medium, add 1 ml of complete culture medium, 1 ml of virus stock solution and 2 μL of polybrene reagent to each well, mix well, put into the cell culture incubator, and replace with normal complete culture medium 24 hours after infection.

[0117] 9) After the cells are fully grown, replace them with complete medium containing puro, screen and kill for 72 hours, select surviving cells to continue growing, and extract RNA to detect knockdown efficiency after they are fully grown.

[0118] 10) Real-time quantitative PCR was used to detect the effect of shRNA interfering with the expression of circular RNA CircSPRED2.

[0119] Total RNA was extracted from infected A2780 and OVCAR3 cells, and 2 μg of RNA was reverse transcribed into cDNA for real-time quantitative PCR. After the reaction, the amplification curve and melting curve of real-time quantitative PCR were confirmed. The expression intensity of each gene was calculated according to the CT value (threshold cycle values) and the internal reference gene was normalized, and the P value was calculated using the group t-test.

[0120] (2) Results

[0121] 1) Effect of shRNA interference on circular RNA CircSPRED2 expression

[0122] After shRNA vector infection of A2780 and OVCAR3 cells, the expression level of circular RNA CircSPRED2 was significantly downregulated ( Figure 4 ).

[0123] 2) shRNA interference with circular RNA CircSPRED2 increases the sensitivity of ovarian cancer A2780 and OVCAR3 cells to platinum-based chemotherapy.

[0124] We stably infected A2780 and OVCAR3 cells with shRNA expression vectors, used scramble as a control, and treated them with different concentrations of carboplatin and cisplatin. We found that after interfering with the gene expression using shRNA technology, the cell survival activity of A2780 and OVCAR3 was reduced ( Figure 5 ), and the apoptosis rate increased ( Figure 6 ), suggesting that inhibition of RNA CircSPRED2 expression enhances the sensitivity of ovarian cancer cells to platinum-based chemotherapy.

[0125] shRNA expression vectors and their derivative reagents have potential gene therapy effects.

[0126] Example 5 Detection of the expression correlation between circular RNA CircSPRED2 and parental gene SPRED2

[0127] (1) Collect A2780 and OVCAR3 cells overexpressing circular RNA CircSPRED2 and extract total RNA: remove all the culture medium from the culture plate, add 1 ml of Trizol, place horizontally on ice for 5 min, allow the lysate to be evenly distributed on the cell surface, and then blow the cells with a pipette to make the cells fall off; transfer the cell lysate to a centrifuge tube, add 200 μL of chloroform, cover the centrifuge tube tightly, oscillate up and down for 15 seconds, let stand on ice for 5 minutes, and centrifuge at 13000g at 4℃ for 15 minutes. Take out the centrifuge tube, and the sample is divided into three layers: a light-colored supernatant aqueous phase, a middle white layer, and a pink lower organic phase. Carefully aspirate the light-colored supernatant aqueous phase and transfer it to another centrifuge tube, add an equal volume of isopropanol, mix gently, let stand at -20℃ for 30 minutes, and then centrifuge at 13000g at 4℃ for 15 minutes. White RNA precipitate can be seen at the bottom of the tube. Carefully remove the supernatant, slowly add 1 mL of 75% ethanol along the wall of the tube, and mix gently. Centrifuge at 7500g, 4℃ for 5 minutes, and carefully remove the supernatant. Dry the precipitate at room temperature for 2-5 minutes, add 30-50μL of enzyme-free water to dissolve the RNA precipitate, and detect the concentration and quality of RNA with a spectrophotometer. The OD260 / 280 ratio should be between 1.8-2.0, and store at -80℃.

[0128] (2) Reverse transcription of total RNA into cDNA using total RNA as template;

[0129] Random primers (100 μM) 1 μL

[0130] Total RNA 1μg

[0131] Enzyme-free water Total 12μL

[0132] Reverse transcription step 1: 65°C, 5 minutes

[0133]

[0134] Reverse transcription second step program: 25°C, 5 minutes; 42°C, 60 minutes; 72°C, 5 minutes.

[0135] (3) Real-time fluorescence quantitative PCR using circular RNA CircSPRED2, SPRED2-specific primers, and internal reference GAPDH primers:

[0136] Circular RNA CircSPRED2, SPRED2-specific primers, and internal reference GAPDH primer DNA sequences were synthesized by Shanghai Bioengineering Company.

[0137] First, dilute the reverse transcription product 5 times and mix well. The 20 μL reaction system is as follows:

[0138]

[0139] The real-time fluorescence quantitative PCR reaction was performed at 95°C for 30 seconds; 40 cycles of 95°C for 5 seconds; 65°C for 30 seconds; 72°C for 30 seconds; and 65-95°C, increasing by 0.5°C every 0.05 seconds.

[0140] Specific primers for fluorescent quantitative PCR:

[0141] CircRNA CircSPRED2 forward primer: 5'-TTTCCAAAGCCCTGCTGATG-3'

[0142] CircRNA CircSPRED2 reverse primer: 5'-ATAGCTGTCATGTAAAAACGTCAT-3'

[0143] Parental gene SPRED2 forward primer: 5'-ATCTGGATGACGGGGTACGA-3'

[0144] Parental gene SPRED2 reverse primer: 5'-GGAGTCCACGTAGGGGTAGT-3'

[0145] Specific primers for internal reference GAPDH:

[0146] 5'-AACGGATTTGGTCGTATTGG-3'

[0147] 5'-TTGATTTTGGAGGGATCTCG-3'

[0148] But not limited to the above specific internal reference controls

[0149] (4) Expression determination: The experimental data were analyzed by relative quantitative analysis, GAPDH was used as the internal reference gene, and the data were analyzed using GraphPad Prism. There was no significant change in the expression level of the parent gene SPRED2 in the cell line overexpressing circular RNA CircSPRED2, see Figure 7 The difference was statistically significant (p<0.05).

Claims

1. Use of an agent for inhibiting circular RNA CircSPRED2 in the preparation of a therapeutic agent for platinum-resistant human ovarian cancer, wherein the sequence of the circular RNA CircSPRED2 is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The preparation for treating platinum-resistant human ovarian cancer includes a preparation for enhancing the chemotherapy sensitivity of platinum-resistant human ovarian cancer.

3. The use according to claim 1 or 2, characterized in that: The preparation for inhibiting the expression of circular RNA CircSPRED2 is a short hairpin RNA expression vector for RNA interference designed for circular RNA CircSPRED2.

4. The use according to claim 3, characterized in that: The interference target sequence required for preparing the short hairpin RNA expression vector for RNA interference is as follows: 5′-GACGTTTTTACATGACAGC-3′; In view of the interference target sequence and vector, a single-stranded oligonucleotide and its reverse complementary sequence that can form a hairpin structure are designed. After annealing, a double-stranded DNA with sticky ends of restriction enzyme cutting sites at both ends is formed. The specific sequence is as follows: sh-CircSPRED2: 5'-CCGGTGACGTTTTTACATGACAGCTTCAAGAGAGCTGTCATGTAAAAACGTCTTTTTG-3' 5'-AATTCAAAAAGACGTTTTTACATGACAGCTCTCTTGAAGCTGTCATGTAAAAACGTCA-3'.

5. A preparation for treating platinum-resistant human ovarian cancer, comprising a preparation for inhibiting the expression of circular RNA CircSPRED2.

6. The therapeutic preparation according to claim 5, characterized in that The preparation for inhibiting the expression of circular RNA CircSPRED2 is a short hairpin RNA expression vector for RNA interference designed for circular RNA CircSPRED2; The interference target sequence required for preparing the short hairpin RNA expression vector for RNA interference is as follows: 5′-GACGTTTTTACATGACAGC-3′; In view of the interference target sequence and vector, a single-stranded oligonucleotide and its reverse complementary sequence that can form a hairpin structure are designed. After annealing, a double-stranded DNA with sticky ends of restriction enzyme cutting sites at both ends is formed. The specific sequence is as follows: sh-CircSPRED2: 5'-CCGGTGACGTTTTTACATGACAGCTTCAAGAGAGCTGTCATGTAAAAACGTCTTTTTG-3' 5'-AATTCAAAAAGACGTTTTTACATGACAGCTCTCTTGAAGCTGTCATGTAAAAACGTCA-3'.

7. Use of a reagent for detecting circular RNA CircSPRED2 in the preparation of a preparation for detecting platinum resistance in human ovarian cancer. The sequence of the circular RNA CircSPRED2 is shown in SEQ ID NO:

1.

8. The use according to claim 7, characterized in that: The human ovarian cancer platinum resistance detection preparation comprises a reagent for detecting the expression amount of circular RNA CircSPRED2 in human ovarian cancer tissues or cells.

9. The use according to claim 8, characterized in that: The reagent for detecting the expression of circular RNA CircSPRED2 in human ovarian cancer tissues or cells includes: real-time fluorescence quantitative PCR detection reagent; preferably, specific primers for PCR: Forward primer: 5′-TTTCCAAAGCCCTGCTGATG-3′; Reverse primer: 5′-ATAGCTGTCATGTAAAAACGTCAT-3′.

10. A kit for detecting platinum resistance in human ovarian cancer, comprising a reagent for detecting the expression of circular RNA CircSPRED2 in human ovarian cancer tissues or cells, specifically comprising: Real-time fluorescence quantitative PCR detection reagent; preferred PCR specific primers: Forward primer: 5′-TTTCCAAAGCCCTGCTGATG-3′; Reverse primer: 5′-ATAGCTGTCATGTAAAAACGTCAT-3′.

Images