Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

70results about How to "Increased chemosensitivity" patented technology

TRPM-2 antisense therapy

It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. In particular, such antisense therapy can be applied in treatment of prostate cancer and renal cell cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Thus, prostate cancer can be treated in an individual suffering from prostate cancer by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual, and administering to the individual a composition effective to inhibit expression of TRPM-2 by the tumor cells, thereby delaying the progression of prostatic tumor cells to an androgen-independent state in an individual Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. In addition, it has also been found that antisense TRPM-2 has beneficial effect for other cancer types. Specifically, antisense TRPM-2 ODN enhances chemosensitivity in human Renal cell cancer, a normally chemoresistant disease with no active chemotherapeutic agent having an objective response rate higher than 10%. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN. Thus, the antisense TRPM-2 ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-2 has been observed.
Owner:THE UNIV OF BRITISH COLUMBIA

Methods for improved cryo-chemotherapy tissue ablation

ActiveUS20090011032A1Good curative effectMaximize the effectOrganic active ingredientsBiocideTherapeutic AreaInflammatory cell
The current invention relates to a process for increasing the efficacy of cancerous disease inhibiting therapeutic agents delivered to a treatment region of a tissue structure, such as a tumor. The multi-step procedure takes advantage of the resulting thermal stress response occurring as a result of exposure to the cold. Coordinating the thermal related stress response with the timing of cancerous disease inhibiting agent action provides a unique therapeutic regiment to treat tumors which provides a maximized effect on the tumor, protects normal cells, and activates local pro-inflammatory cells.
Owner:NUVUE THERAPEUTICS

Method for establishing paclitaxel (PTX)-resistant ovarian cancer cell model

The invention relates to a method for establishing a paclitaxel (PTX)-resistant ovarian cancer cell model. The method comprises the following specific steps: intervening an OVCAR-3 cell and an SK-OV-3 cell by virtue of PTX, replacing a PTX-free culture medium, intervening the OVCAR-3 cell and the SK-OV-3 cell until growth of cells returns to be normal, namely, under the conditions that the cells stably grow, morphologies are full, no floating dead cells are produced and the passage density is 30%, enabling the cells to grow 90% in 3-5 days, starting to carry out normal passage and improving the concentration of PTX, wherein the intervention time for each time is 24 hours; and finally obtaining the PTX-resistant ovarian cancer cell model having the preservation numbers of CCTCC C2014203 and CCTCC C2014204. According to the method, by closely observing growth states of cells and selecting the intervention moment, the established cell model has higher level of drug-resistance coefficients and good resistance stability and can be used for the research on ovarian cancer drug-resistant mechanism, ovarian cancer drug-resistant reversion, prevention of chemotherapy resistance and the improvement on chemosensitivity.
Owner:JINSHAN HOSPITAL FUDAN UNIV

Model for studying the role of genes in chemoresistance

The invention provides novel inhibitors of protein translation initiation and inhibitors of eIF4F activity that can increase chemosensitivity or diminish or reverse chemoresistance in growth transformed cells and thereby reduce hyperproliferative conditions, such as cancer progression, in select patient populations having particular tumor genotypes. The invention also provides methods which target translation initiation controls in growth-transformed cells, such as tumor subtypes with altered expression of a gene activity, including the human akt, bcl-2, eIF4E, eIF4A or PTEN activities, to restore drug sensitivity in vivo in a genotype selective manner. In one aspect, the inhibitors of translation initiation of the invention are rocaglates, i.e., cyclopenta[b]benzofurons, which increases chemosensitivity or diminishes or reverses chemoresistance either alone or in combination, additively or synergistically, with other agents that alter growth or death. Preferably, the rocaglate is silvestrol, which is used alone or in combination with doxorubicin to reverses chemoresistance in PTEN-deficient lymphomas or eIF4E-over-expressing lymphomas and to promote cancer remission.
Owner:COLD SPRING HARBOR LAB INC +1

PI-3 kinase inhibitor prodrugs

The invention provides novel prodrugs of inhibitors of PI-3 kinase. The novel compounds are LY294002 and analogs thereof comprising a reversibly quaternized amine.
Owner:SIGNALRX PHARMA

TRPM-2 Antisense Therapy

It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. In particular, such antisense therapy can be applied in treatment of prostate cancer and renal cell cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Thus, prostate cancer can be treated in an individual suffering from prostate cancer by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual, and administering to the individual a composition effective to inhibit expression of TRPM-2 by the tumor cells, thereby delaying the progression of prostatic tumor cells to an androgen-independent state in an individual Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. In addition, it has also been found that antisense TRPM-2 has beneficial effect for other cancer types. Specifically, antisense TRPM-2 ODN enhances chemosensitivity in human Renal cell cancer, a normally chemoresistant disease with no active chemotherapeutic agent having an objective response rate higher than 10%. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN. Thus, the antisense TRPM-2 ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-2 has been observed.
Owner:THE UNIV OF BRITISH COLUMBIA

Use of pirna-54265 in diagnosis, treatment, and prognostic evaluation of colorectal cancer

InactiveUS20200017906A1Simple and efficient operationHigh amplification efficiencyOrganic active ingredientsMicrobiological testing/measurementColon rectal cancerOncology
The present invention relates to a marker piRNA-54265 and a method in diagnosis, treatment, and prognostic evaluation of colorectal cancer. The marker piRNA-54265 is capable of being used for diagnosing and / or treating colorectal cancer, wherein the marker piRNA-54265 is selected from any of molecules as follows: (1) SEQ ID NO.29: tggaggtgatgaactgtctgagcctgacc; (2) SEQ ID NO.30: UGGAGGUGAUGAACUGUCUGAGCCUGACC; (3) SEQ ID NO.31: GGUCAGGCUCAGACAGUUCAUCACCUCCA; (4) a piR-54265 variant and a piR-54265 derivative modified from the molecule shown in (1), (2) or (3) with a same function; (5) a piR-54265 polynucleotide construct capable of down-regulating an amount of the piR-54265 in vivo after being introduced; and (6) an expression vector containing the polynucleotide construct of (5). The method is used for diagnosing / screening colorectal cancer, evaluating chemosensitivity of a colorectal cancer patient, evaluating a prognosis of a colorectal cancer patient or treating colorectal cancer.
Owner:SUN YAT SEN UNIV +1

Methods For Improved Cryo-Chemotherapy Tissue Ablation

InactiveUS20120143167A1Increase efficacyInduces thermal stress responseOrganic active ingredientsUltrasound therapyTherapeutic AreaInflammatory cell
The current invention relates to a process for increasing the efficacy of cancerous disease inhibiting therapeutic agents delivered to a treatment region of a tissue structure, such as a tumor. The multi-step procedure takes advantage of the resulting thermal stress response occurring as a result of exposure to the cold. Coordinating the thermal related stress response with the timing of cancerous disease inhibiting agent action provides a unique therapeutic regiment to treat tumors which provides a maximized effect on the tumor, protects normal cells, and activates local pro-inflammatory cells.
Owner:NUVUE THERAPEUTICS

Cancer markers

InactiveUS20100152058A1Excellent indicatorsReduce spreadMicrobiological testing/measurementLibrary screeningGeneCancer marker
The invention relates to methods of diagnosis and prognosis of cancer, and in particular NSCLC, the methods comprising determining the expression level of one or more genes. In some embodiments the invention relates to prognosis of early stage NSCLC.
Owner:IFOM FOND INST FIRC DI ONCOLOGIA MOLECOLARE

Application of TRERNA1 gene to prediction and improvement of sensitivity of liver cancer drug sorafenib

ActiveCN109055549AEasy to importEasy assessment processMicrobiological testing/measurementAntineoplastic agentsMedical diagnosisChemotherapy resistant
The invention belongs to the technical field of biology, particularly relates to the field of medical diagnosis, in particular to application of TRERNA1 gene to prediction and improvement of sensitivity of liver cancer drug sorafenib. The prognosis of hepatocellular carcinoma and the evaluation of chemotherapy resistance of liver cancer are marked, and the expression level of TRERNA1 genes is detected by utilizing an RNA in-situ hybridization technology or qPCR, so that the prognosis and chemotherapy resistance of the hepatocellular carcinoma can be obtained, the introduction way of the TRERNA1 is simple, the whole prediction and evaluation process is simple and easy, and the feasibility is high.
Owner:SOUTHEAST UNIV

Application of transcription factor ZEB1 for preparing medicine capable of accelerating breast cancer chemosensitivity

The invention discloses application of a transcription factor ZEB1 for preparing a medicine capable of accelerating breast cancer chemosensitivity. The transcription factor ZEB1 can mediate the chemotherapy resistance of the breast cancer, and the breast cancer chemosensitivity can be improved through the targeted intervention of the ZEB1. On one hand, the ZEB1 can accelerate the breast cancer chemotherapy resistance through a way of accelerating DNA (Deoxyribose Nucleic Acid) damage repair, and the generation of the chemotherapy resistance is realized through the regulation and the control on ATM (Ataxia Telangiectasia-Mutated Gene) by the ZEB1. On the other hand, the ZEB1, P300 and / or PCAF (P300 / CBP-Associated Factor) can form a compound, wherein the compound performs a regulation and control function on the ATM. Meanwhile, a ZEB1-shRNA lentivirus gene knock-down system is used for verifying the function of Le-shZEB1 in enhancing the anti-tumor curative effect of anti-tumor medicines through breast carcinoma cell lines and an in vivo nude mouse model, and the tolerance problem of the breast cancer on chemotherapy is effectively solved. The invention provides a new target spot and a therapeutic strategy for alleviating the chemotherapy resistance of the breast cancer, increasing the sensitivity of chemotherapy medicines and the like.
Owner:NANKAI UNIV

Self-assembled nanoparticles for targeting delivery of paclitaxel and its preparation method and uses

The invention relates to self-assembled nanoparticles for targeting delivery of paclitaxel and its preparation method and uses, the self-assembled nanoparticles of the paclitaxel comprise by weight: 1000 parts of polyethylene glycol, 40 parts of vitamin E succinate, 20 parts of TWEEN80, 10-40 parts of medium chain triglycerides and 0.5-2 parts of the paclitaxel, the particle size of the self-assembled nanoparticles of the paclitaxel is 1-100nm, at the cellular level, the self-assembled nanoparticles of the paclitaxel can deliver the paclitaxel to drug-resistant cells, and can increase the chemotherapy sensitivity of the drug-resistant cells, and in the animal level, the self-assembled nanoparticles of the paclitaxel can targetedly deliver the paclitaxel to tumor sites, and can increase the inhibiting effect of chemotherapy drugs on drug-resistant tumor. By the design of the carrier, the sensibility of breast cancer and lung cancer drug resistant cells on the paclitaxel can be improved.
Owner:SHANGHAI INST OF MATERIA MEDICA CHINESE ACAD OF SCI

Adriamycin-resistant U87 cell model and application thereof

The invention relates to an adriamycin-resistant U87 cell model and an application thereof. U87 cells are intervened by use of the adriamycin, and then an adriamycin-free culture medium is adopted in stead; after the cells grow to 90% in 3-5 days under the circumstance of stable growth and full form of cells, no floating dead cells and 30% of passage density, normal passage is started and the concentration of the adriamycin is increased; the intervention time of the adriamycin each time is 24 hours; finally, the intervened U87 cells are detected, and consequently, the adriamycin-resistant U87 cell model is obtained; the collection number of the adriamycin-resistant U87 cell model is CCTCC NO: C201531. The cell model is strong in drug resistance, high in drug resistance coefficient, excellent in drug resistance stability, and can be applied to studying the drug resistance mechanism of the brain glioma, searching for the target spot of reversal of drug resistance of the brain glioma and screening drugs for treating the brain glioma or removing the drug resistance of the brain glioma, or to studying the mechanism of tumors causing intractable epilepsy, searching for the target spot of reversal of drug resistance of the epilepsy and screening drugs for treating the epilepsy or removing the drug resistance of the epilepsy.
Owner:JINSHAN HOSPITAL FUDAN UNIV

Cancer markers

The invention relates to methods of diagnosis and prognosis of cancer, and in particular NSCLC, the methods comprising determining the expression level of one or more genes. In some embodiments the invention relates to prognosis of early stage NSCLC.
Owner:IFOM FOND INST FIRC DI ONCOLOGIA MOLECOLARE

Multivalent fragments of antibody 3e10 and methods of use thereof

Antigen binding molecules that bind to the epitope of 3E10, and methods of use thereof are provided. The antigen binding molecule can include, for example, two or more variant single chain variable fragments (scFv) of monoclonal antibody 3E10, wherein the variant scFv has one or more insertions, deletions, or substitutions relative to a corresponding 3E10 scFv, and wherein the molecule can bind, preferably specifically bind, to the epitope of 3E10. Methods of using the antigen binding molecules for treating cancer and viral infections or preventing viral infections are also provided.
Owner:YALE UNIV +1

Application of ATF3 as target site in preparing taxol chemosensitization medicine for treating nasopharynx cancer

The invention discloses application of ATF3 as a target site in preparing a taxol chemosensitization medicine for treating nasopharynx cancer. Tests show that the expression level of an Activating transfactor 3 ATF3 in nasopharynx cancer taxol drug-resistant cells is remarkably lower than that of taxol sensitive cells, and in addition, ATF3 is capable of improving the taxol chemosensitization of nasopharynx cancer by regulating and controlling HIPPO signal paths. Therefore, ATF3 can be used as a potential target site for chemosensitization treatment on nasopharynx cancer. As the target site, ATF3 can be used for preparing nasopharynx cancer chemosensitization treatment medicines, and particularly as the target site, ATF3 can be used for preparing medicines for regulating and controlling HIPPO paths to improve taxol chemosensitization of nasopharyngeal carcinoma cells.
Owner:THE THIRD XIANGYA HOSPITAL OF CENT SOUTH UNIV

Application of composition in diagnosis of triple negative breast cancer

The invention provides application of a composition in diagnosis of triple negative breast cancer. The composition comprises miR-141, miR-200a and miR-145. It is proved for the first time that expression of the combination of miR-141, miR-200a and miR-145 is regulated down mainly in triple negative breast cancer. Meanwhile, the content of the combination of miR-141, miR-200a and miR-145 in serum of a patient with triple negative breast cancer is obviously reduced compared with that in serum of breast cancer patients of other molecular subtyping. New data are provided for breast cancer molecular subtyping, a new target point and a serum fast detection method are provided for detection of triple negative breast cancer molecular subtyping.
Owner:CANCER CENT OF GUANGZHOU MEDICAL UNIV

Novel application of gossypol

The invention relates to the field of medicines, and discloses novel application of gossypol. The gossypol can be used for effectively inhibiting the activity of NF-kappa B, AP-1 and HIF-1 alpha which are induced by reduction-oxidation of APE1 (apurinic / apyrimidinic endonuclease-1) and combined with DNA (deoxyribonucleic acid), and also remarkably inhibiting the DNA damage repairing function of APE1, so that the invention provides the application of gossypol in preparing an APE1 reduction-oxidation inhibitor or a DNA damage repairing function inhibitor of APE1. Furthermore, gossypol can be used for improving the sensitivity of tumor cells to etoposide chemotherapy, and can also reverse drug resistance of the tumor cells to chemotherapeutic medicines caused by high expression of APE1 in the tumor cells, so that the invention also provides application of gossypol in preparing adjuvants or chemosensitizer for treating cancers.
Owner:THE THIRD AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIV OF PLA

Application of GBE1 inhibitor flavopiridol and pharmaceutical composition thereof in preparing medicine for treating lung adenocarcinoma

The invention discloses application of a GBE1 inhibitor flavopiridol and its pharmaceutical composition in preparing a medicine for treating lung adenocarcinoma. According to the invention, it is found that flavopiridol can effectively inhibit the proliferation of lung adenocarcinoma cells, and the dose-dependent and time-dependent effects are obvious. According to the results of WB and Moleculardocking, flavopiridol may play a role in inhibiting the proliferation of lung adenocarcinoma cells by inhibiting GBE1, and flavopiridol may be an effective GBE1 inhibitor. Schisandrone alcohol, a compound that may participate in the regulation of GBE1 pathway, cannot directly inhibit the proliferation of lung adenocarcinoma cells, but can enhance the sensitivity of lung adenocarcinoma cells to chemotherapy of flavopiridol. Therefore, flavopiridol and Schisandrone alcohol can be used as a pharmaceutical composition to prepare an anti lung adenocarcinoma pharmaceutical preparation for the treatment of lung adenocarcinoma.
Owner:THE FIRST AFFILIATED HOSPITAL OF ZHENGZHOU UNIV

P53 messenger RNA nanoparticles, preparation method thereof and application thereof in preparing drug for treating tumors

InactiveCN110974804AInduce apoptosisInduced cycle arrestOrganic active ingredientsGenetic material ingredientsEverolimusMessenger RNA
The p53 messenger RNA nanoparticles, a preparation method thereof and an application thereof in preparing a drug for treating tumors belong to the technical field of genetic engineering. The p53 messenger RNA nanoparticles are prepared by the following method: 1, chemically modified p53mRNA is synthesized in vitro; and 2, a nano-system is prepared by a self-assembly method to deliver the p53 messenger RNA in vivo. The p53 messenger RNA nanoparticles play an anti-tumor and chemosensitivity-enhancing therapeutic role by restoring the anti-tumor function of p53. The advantages of the invention are as follows: 1, the p53 messenger RNA in the invention is successfully delivered to the p53 inactivated liver cancer and lung cancer tumor cells through the nano-system to effectively and rapidly induce cell apoptosis and G1 phase cell cycle arrest in vivo and in vitro, thus significantly inhibiting the growth of tumor cells; and 2, the p53 messenger RNA delivered by the nanoparticles can enhancethe anti-tumor effect of a mTOR inhibitor everolimus by supplementing the tumor suppressor p53 deleted in the tumor.
Owner:HANGZHOU NORMAL UNIVERSITY

Tumor suppressor gene NDRG2 based application for improving breast cancer chemotherapy sensibility

The invention discloses a tumor suppressor gene NDRG2 based application for improving breast cancer chemotherapy sensibility. The tumor suppressor gene NDRG2 is transfected into a breast cancer cell through an expression vector or a virus vector, and the result shows that the tumor suppressor gene NDRG2 can improve the breast cancer chemotherapy sensibility and can be applied to preparation of relevant drugs. The NDRG2 prompts a deoxyribonucleic acid (DNA) damage ability of Adr induced p53 wild type breast cancer cells, improves morphology damage of Adr to p53 wild type breast cancer cells, improves a proliferation inhibiting ability of the Adr to the p53 wild type breast cancer cells, improves the breast cancer chemotherapy sensibility which is independent of specific chemotherapy drugs and further prompts apoptosis of the Adr induced p53 wild type breast cancer cells.
Owner:FOURTH MILITARY MEDICAL UNIVERSITY

Methods for improved cryo-chemotherapy tissue ablation

The current invention relates to a process for increasing the efficacy of cancerous disease inhibiting therapeutic agents delivered to a treatment region of a tissue structure, such as a tumor. The multi-step procedure takes advantage of the resulting thermal stress response occurring as a result of exposure to the cold. Coordinating the thermal related stress response with the timing of cancerous disease inhibiting agent action provides a unique therapeutic regiment to treat tumors which provides a maximized effect on the tumor, protects normal cells, and activates local pro-inflammatory cells.
Owner:NUVUE THERAPEUTICS

Application of miR-22 in preparation of bladder cancer chemosensitization treatment drugs as target site

InactiveCN107432933AImpact sensitivityIncreased chemosensitivityOrganic active ingredientsMicrobiological testing/measurementBladder cancer cellChemosensitization
MiR-22 can realize the targeting negative regulation of the expression of REDD1, and the miR-22 is under-expressed in bladder cancer tissues. The miR-22 can influence the sensitivity of bladder cancer cells to paclitaxel chemotherapy through the "REDD1-autophagy" regulation axis, so the miR-22 can be used as a potential target for bladder cancer chemosensitization, and can be used in the preparation of the bladder cancer chemosensitization treatment drugs as the target site, and especially the miR-22 can be used for preparing drugs for inhibiting autophagy and increasing the sensitivity of bladder cancer cells to paclitaxel chemotherapy as the target site. The bladder cancer is BUC.
Owner:THE THIRD XIANGYA HOSPITAL OF CENT SOUTH UNIV

Interference RNA for inhibiting Rac1 expression and application thereof in increasing chemosensitivity to breast cancer

The invention relates to the field of biological medicines, in particular to interference RNA for inhibiting the Rac1 expression and an application thereof in increasing the chemosensitivity to breastcancer, and also discloses a breast cancer chemotherapeutic drug. The invention comprises the interference RNA for inhibiting the Rac1 expression and the chemotherapeutic drug, and a carrier of tumormicroenvironment response for transporting the interference RNA and the chemotherapeutic drug. According to the invention, an acid-sensitive nano-material is used as the carrier, can efficiently convey the siRNA and the chemotherapeutic drug into tumor cells, has a long circulation time in blood, and has high enrichment amount in tumors. Meanwhile, the nano-material encapsulates the siRNA and thechemotherapeutic pro-drug, can effectively silence the target gene and effectively inhibit the expression of drug-resistant genes, enhances the killing effect on tumor cells at the same time, obviously improves the tumor chemotherapy effect, has small toxic and side effects on normal tissue cells, and has no obvious damage to important organs such as heart and liver.
Owner:SUN YAT SEN MEMORIAL HOSPITAL SUN YAT SEN UNIV

Radix scutellariae soup, and application of equivalent component group of radix scutellariae soup to improvement of chemosensitivity of colon cancer on irinotecan

The invention discloses a radix scutellariae soup, and application of an equivalent component group of the radix scutellariae soup to improvement of the chemosensitivity of the colon cancer on the irinotecan. The invention finds that the radix scutellariae soup can be beneficial to remarkably improving the chemosensitivity of the colon cancer on the irinotecan, namely, improving the killability ofthe irinotecan on the the colon cancer, the inhibiting effect on colon cancer cell proliferation, and the acceleration on colon cancer cell apoptosis, so that without remarkably reducing a chemotherapeutic effect of the irinotecan, the administration dosage of the irinotecan is reduced favorably, and the chemotherapy side effects of the irinotecan is relieved. The invention finds that through a composition prepared from gallic acid, scutellarin, baicalein, wogonin, glycyrrhizic acid and oroxylin A in the radix scutellariae soup, the chemosensitivity of the colon cancer on the irinotecan can be remarkably improved, and the medicine effect is basically consistent to the equivalent dosage of radix scutellariae soup; the find is helpful to develop a composition medicine with definite development components and controllable quality so as to replace the radix scutellariae soup for assisting colon cancer chemotherapy, and also helpful to adopt the composition as a quality control index to control the quality of the radix scutellariae soup.
Owner:CHINA PHARM UNIV

Application method of long-chain non-coding RNA LOC107987064 and detection and treatment preparation

ActiveCN113234819AIncreased chemosensitivityFar-reaching practical significanceMicrobiological testing/measurementAntineoplastic agentsPlatinum resistanceIV Chemotherapy
The invention discloses an application method of long-chain non-coding RNA LOC107987064, a detection preparation and a treatment preparation. The invention relates to a detection reagent for detecting ovarian cancer platinum chemotherapy tolerance, in particular to a kit for detecting whether ovarian cancer is tolerant to platinum drugs or not by a real-time fluorescence quantitative analysis method and a human ovarian cancer platinum tolerance treatment preparation. The researches prove that the LncRNA LOC107987064 is highly expressed in a platinum-resistant ovarian cancer tissue, and the LOC107987064 is a marker of the platinum resistance of the ovarian cancer, so that the expression of the LOC107987064 is applied to the detection of the platinum chemotherapy resistance of the ovarian cancer and the enhancement of the chemotherapy sensitivity of the human ovarian cancer platinum drugs through inhibition, and the LncRNA LOC107987064 has profound clinical significance and generalization performance.
Owner:CENT SOUTH UNIV

Marker for evaluating sensitivity and/or prognosis of triple negative breast cancer to neoadjuvant chemotherapy drugs and application of marker

ActiveCN112760380AIncreased chemosensitivityDecreased chemosensitivityMicrobiological testing/measurementMaterial analysisBreast cancer cell lineChemotherapy drug
The invention provides a marker for evaluating the sensitivity and / or prognosis of triple negative breast cancer to neoadjuvant chemotherapy drugs and application of the marker. The marker for evaluating the sensitivity and / or prognosis of the triple negative breast cancer to the neoadjuvant chemotherapy drugs is RAD21 and / or protein thereof. the RAD21 is highly expressed in breast cancer tissues or breast cancer cell lines and is related to poor prognosis of patients; the RAD21 promotes the migration and invasion ability of triple negative breast cancer cells; the RAD21 participates in regulation and control of the sensitivity of triple negative breast cancer to neoadjuvant chemotherapy drugs adriamycin and 5-fluorouracil; and the RAD21 is a potential prediction index for treatment target or treatment scheme selection.
Owner:SHANDONG UNIV

YAP1 gene and application of inhibitor in enhancing chemosensitivity of stem cell of bladder cancer

The invention discloses a YAP1 gene and application of an inhibitor in enhancing chemosensitivity of a stem cell of bladder cancer. The YAP1 gene is related to chemosensitivity of the stem cell of bladder cancer. The inhibitor where the YAP1 gene is highly expressed can improve the chemosensitivity of the stem cell of bladder cancer on chemotherapeutics mitomycin C and cis-platinum by down-regulating the expression of the YAP1 gene, so that the inhibiting rate of the chemotherapeutics mitomycin C and cis-platinum on the stem cell of bladder cancer is increased. The inhibitor where the YAP1 gene is highly expressed can be any one or more of siRNA, shRNA, dsRNA, miRNA, cDNA, a small molecular compound, a peptide and an antibody, wherein the small molecular compound is a 2-amido benzoxazole derivative.
Owner:河南创新生物科技研究院有限公司