Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

544results about "Apolipeptides" patented technology

Apolipoprotein A-I agonists and their use to treat dyslipidemic disorders

The present invention provides peptides and peptide analogues that mimic the structural and pharmacological properties of human ApoA-I. The peptides and peptide analogues are useful to treat a variety of disorders associated with dyslipidemia.
Owner:DASSEUX JEAN LOUIS +5

Targeted modification of rat genome

Compositions and methods are provided for modifying a rat genomic locus of interest using a large targeting vector (LTVEC) comprising various endogenous or exogenous nucleic acid sequences as described herein. Compositions and methods for generating a genetically modified rat comprising one or more targeted genetic modifications in their germline are also provided. Compositions and methods are provided which comprise a genetically modified rat or rat cell comprising a targeted genetic modification in the rat interleukin-2 receptor gamma locus, the rat ApoE locus, the rat Rag2 locus, the rat Rag1 locus and / or the rat Rag2 / Rag1 locus. The various methods and compositions provided herein allows for these modified loci to be transmitted through the germline.
Owner:REGENERON PHARM INC

Apolipoprotein A-I agonists and their use to treat dyslipidemic disorders

The present invention provides peptides and peptide analogues that mimic the structural and pharmacological properties of human ApoA-I. The peptides and peptide analogues are useful to treat a variety of disorders associated with dyslipidemia.
Owner:JEAN LOUIS DASSEUX +5

Targeted modification of rat genome

InactiveUS20140309487A1Enhance homologous recombinationAnimal reproductionApolipeptidesRAG2Nucleic acid sequencing
Compositions and methods are provided for modifying a rat genomic locus of interest using a large targeting vector (LTVEC) comprising various endogenous or exogenous nucleic acid sequences as described herein. Compositions and methods for generating a genetically modified rat comprising one or more targeted genetic modifications in their germline are also provided. Compositions and methods are provided which comprise a genetically modified rat or rat cell comprising a targeted genetic modification in the rat interleukin-2 receptor gamma locus, the rat ApoE locus, the rat Rag2 locus, the rat Rag1 locus and / or the rat Rag2 / Rag1 locus. The various methods and compositions provided herein allows for these modified loci to be transmitted through the germline.
Owner:REGENERON PHARM INC

Treatment of Apolipoprotein-A1 Related Diseases by Inhibition of Natural Antisense Transcript to Apolipoprotein-A1

Oligonucleotide compounds modulate expression and / or function of an apolipoprotein (ApoA1) polynucleotides and encoded products thereof. Methods for treating diseases associated with apolipoprotein-A1 (ApoA1) comprise administering one or more Oligonucleotide compounds designed to inhibit the Apo-A1 natural antisense transcript to patients.
Owner:CURNA INC

Peptide/lipid complex formation by co-lyophilization

InactiveUS6287590B1Antibacterial agentsPowder deliveryLipid formationAmphipathic Alpha Helix
The invention relates to the formation of peptide / lipid vesicles and complexes through the co-lyophilization of peptides, preferably that are able to adopt an amphipathic alphahelical conformation, and one or more lipids. A single solution which solubilizes both the peptides and lipids or two separate solutions may be lyophilized.
Owner:ESPERION THERAPEUTICS

Method and system of runtime analysis

ActiveUS20120260344A1Facilitates code coverageApolipeptidesPeptide/protein ingredientsWeb applicationClient-side
A method and a system for detecting one or more security vulnerabilities. The method comprises providing test instructions for an application, such as a web application or a client server application, adding test code to a code segment of the application according to the test instructions, sending at least one message to the application according to the test instructions at runtime thereof, monitoring test information pertaining to at least one reaction of the application to the at least one message during an execution of the test code, performing an analysis of the at least one reaction, and detecting a presence or an absence of at least one security vulnerability according to the analysis.
Owner:SYNOPSYS INC

HDL particles for delivery of nucleic acids

Disclosed are high density lipoprotein-nucleic acid particles, wherein the particles include (a) an apolipoprotein; (b) a nucleic acid component comprising a therapeutic nucleic acid segment; and (c) a polypeptide comprising a positively charged region, wherein the positively-charged region of the polypeptide associates with the nucleic acid component. Also disclosed are pharmaceutical compositions that include a) an apolipoprotein; (b) a nucleic acid component comprising a therapeutic nucleic acid segment; and (c) a polypeptide comprising a positively charged region. Methods that concern the particles and pharmaceutical compositions of the present invention are also set forth, as well as kits.
Owner:UNIV OF NORTH TEXAS HEALTH SCI CENT +1

Lipoproteins as nucleic acid vectors

InactiveUS6635623B1Restores growth suppression controlReduce the numberBiocideApolipeptidesApolipoproteins ELow-density lipoprotein
The present invention relates to materials and methods for the in vivo transport and deliver of nucleic acids. More particularly, it concerns the use of lipoproteins, including but not limited to, low density lipoproteins ("LDL"), and / or apolipoproteins for the binding and in vivo transport of nucleic acids. In addition, the present invention relates to the use of lipoproteins in the early detection of cancer and / or metastatic cancer and / or arteriosclerosis.
Owner:BAYLOR COLLEGE OF MEDICINE

Apolipoprotein A-I agonists and their use to treat dyslipidemic disorders

The present invention provides peptides and peptide analogues that mimic the structural and pharmacological properties of human ApoA-I. The peptides and peptide analogues are useful to treat a variety of disorders associated with dyslipidemia.
Owner:DASSEUX JEAN LOUIS +4

Peptide/lipid complex formation by co-lyophilization

InactiveUS6455088B1Powder deliveryApolipeptidesLipid formationAmphipathic Alpha Helix
The invention relates to the formation of peptide / lipid vesicles and complexes through the co-lyophilization of peptides, preferably that are able to adopt an amphipathic alphahelical conformation, and one or more lipids. A single solution which solubilizes both the peptides and lipids or two separate solutions may be lyophilized.
Owner:DASSEUX JEAN LOUIS

Method for transporting a compound across the blood-brain barrier

The present invention relates to improvements in the field of drug delivery. More particularly, the invention relates to a non-invasive and flexible method and carrier for transporting a compound or drug across the blood-brain barrier of an individual. In particular the present invention relates to a carrier for transporting an agent attached thereto across a blood-brain barrier, wherein the carrier is able to cross the blood-brain barrier after attachment to the agent and thereby transport the agent across the blood-brain barrier. The present invention relates to improvements in the field of drug delivery. More particularly, the invention relates to a non-invasive and flexible method and carrier for transporting a compound or drug across the blood-brain barrier of an individual. In particular the present invention relates to a carrier for transporting an agent attached thereto across a blood-brain barrier, wherein the carrier is able to cross the blood-brain barrier after attachment to the agent and thereby transport the agent across the blood-brain barrier.
Owner:ANGLACHEM INC

Apolipoprotein analogues

The invention relates to a pharmaceutical composition comprising an apolipoprotein construct, to an apolipoprotein construct, a nucleic acid sequence encoding the apolipoprotein construct, a vector comprising the nucleic acid sequence, a method for producing the apolipoprotein construct, and a method of treatment comprising administering the apolipoprotein construct. The presented data document that the constructs according to the invention are capable of binding lipids, are capable of binding cubilin, which is a strong Apo Al receptor, stronger than native Apo A-I and that the plasma half life of the constructs is at least tripled compared to native Apo A-I. Together these data document that the constructs according to the invention are strong candidates for treatment of cardiovascular diseases.
Owner:F HOFFMANN LA ROCHE & CO AG

Gene therapy approaches to supply apolipoprotein A-I agonists and their use to treat dyslipidemic disorders

The invention relates to genetic approaches to supply nucleotide sequences encoding modified forms of the native forms of apolipoprotein A-I (ApoA-I): mature ApoA-I, preproApoA-I and proApoA-I; including native ApoA-I modified to contain ApoA-I agonists, peptides which mimic the activity of ApoA-I; ApoA-I superagonists, peptides which exceed the activity of native ApoA-I; and modified native ApoA-I having one or more amphipathic helices replaced by the nucleotide sequences of one or more ApoA-I agonists; for the treatment of disorders associated with dyslipoproteinemia, including cardiovascular disease, atherosclerosis, restenosis, hyperlipidemia, and other disorders such as septic shock.
Owner:DASSEUX JEAN LOUIS +5

Apolipoprotein A-I agonist compounds

The present invention provides peptides and peptide analogues that mimic the structural and pharmacological properties of human ApoA-I. The peptides and peptide analogues are useful to treat a variety of disorders associated with dyslipidemia.
Owner:DASSEUX JEAN LOUIS +5

Compositions and methods for apo-b48 and apo-b100 assay

The invention concerns compositions and methods for assay or detection of apolipoprotein-B48 in samples. In particular, it concerns a method for differential measurement of apolipoprotein-B48 (“Apo-B48”) and apolipoprotein-B100 (“Apo-B100”) in biological samples. The invention also concerns synthetic products of Apo-B100, the corresponding antibodies, kits containing same, and their uses for detecting, differentially quantifying and / or recording an amount of Apo-B48 and / or Apo-B100 in a sample, or for quantifying and / or recording atherogenic lipoparticles in a sample. The products, materials and kits hereinabove can also be used for differentially modulating the levels of Apo-B48 and / or Apo-B100 or their activity, in vitro or in vivo, and for regulating lipid metabolism in a subject.
Owner:GENFIT SA

Orally administered peptides to ameliorate atherosclerosis

InactiveUS7144862B2Readily taken up and deliveredMany symptomAntibacterial agentsBiocideAmphipathic helixMedicine
This invention provides novel peptides that ameliorate one or more symptoms of atherosclerosis. In certain embodiments, the peptide comprises an amino acid sequence that ranges in length from about 10 up to about 30 amino acids, that comprises at least one class A amphipathic helix, that bears at least one protecting group, that protects a phospholipid against oxidation by an oxidizing agent; and that is not the D-18A peptide. The peptides are highly stable and readily administered via an oral route.
Owner:UAB RES FOUND +1

TRPM-2 antisense therapy using an oligonucleotide having 2′-O-(2-methoxy)ethyl modifications

A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2′-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2′-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.
Owner:THE UNIV OF BRITISH COLUMBIA

Methods for modulating set and uses thereof

ActiveUS20100144627A1Reduce activationReducing neuronal cell deathAntibacterial agentsNervous disorderMedicinePeptide
The present invention provides methods for modulating SET activity by contacting SET with a binding agent such as an ApoE peptide derivative. In one embodiment of the invention, a pharmaceutical composition capable of modulating SET activity is administered to a patient for the treatment of an inflammatory or neurological condition. In another embodiment of the invention, compounds efficacious for the treatment of inflammatory and neurological conditions are identified by screening for a binding agent capable of competing with or inhibiting the binding of an ApoE derivative to SET.
Owner:CORNERSTONE BIOSCI INC

Membrane scaffold proteins

The membrane scaffold proteins (MSP) of the present invention assemble with hydrophobic or partially hydrophobic proteins to form soluble nanoscale particles which preserve native structure and function; they are improved over liposomes and detergent micelles, in terms of stability and preservation of biological activity and native conformation. In the presence of phospholipid, MSPs form nanoscopic phospholipid bilayer disks, with the MSP stabilizing the particle at the perimeter of the bilayer domain. The particle bilayer structure allows manipulation of incorporated proteins in solution or on solid supports, including for use with such surface-sensitive techniques as scanning probe microscopy or surface plasmon resonance. The nanoscale particles, which are robust in terms of integrity and maintenance of biological activity of incorporated proteins, facilitate pharmaceutical and biological research, structure / function correlations, structure determinations, bioseparations, and drug discovery.
Owner:BOARD OF TRUSTEES OF THE UNIV OF ILLINOIS THE A BODY & POLITIC OF THE STATE OF ILLINOIS

TRPM-2 antisense therapy

It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. In particular, such antisense therapy can be applied in treatment of prostate cancer and renal cell cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Thus, prostate cancer can be treated in an individual suffering from prostate cancer by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual, and administering to the individual a composition effective to inhibit expression of TRPM-2 by the tumor cells, thereby delaying the progression of prostatic tumor cells to an androgen-independent state in an individual Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. In addition, it has also been found that antisense TRPM-2 has beneficial effect for other cancer types. Specifically, antisense TRPM-2 ODN enhances chemosensitivity in human Renal cell cancer, a normally chemoresistant disease with no active chemotherapeutic agent having an objective response rate higher than 10%. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN. Thus, the antisense TRPM-2 ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-2 has been observed.
Owner:THE UNIV OF BRITISH COLUMBIA

Constructs binding to phosphatidylserine and their use in disease treatment

Disclosed are new phosphatidylserine binding constructs with surprising combinations of properties, and a range of diagnostic and therapeutic conjugates thereof. The new constructs effectively bind phosphatidylserine targets in disease and enhance their destruction, and can also specifically deliver attached imaging or therapeutic agents to the disease site. Also disclosed are methods of using the new construct compositions, therapeutic conjugates and combinations thereof in tumor vasculature targeting, cancer diagnosis and treatment, and for treating viral infections and other diseases.
Owner:PEREGRINE PHARMA INC +2

Orally administered peptides synergize statin activity

This invention provides novel peptides that ameliorate one or more symptoms of atherosclerosis. The peptides are highly stable and readily administered via an oral route. In addition, the peptides inhibit osteoporosis. When administered with a statin, the peptides enhance the activity of the statin permitting the statin to be used at significantly lower dosages. In certain embodiments, the peptides range in length from about 10 up to about 30 amino acids, comprise at least one class A amphipathic helix, and protect a phospholipid against oxidation by an oxidizing agent.
Owner:ALABAMA RESEARCG FOUND UNIV OF THE +1

Orally administered peptides synergize statin activity

This invention provides novel peptides that ameliorate one or more symptoms of atherosclerosis. The peptides typically range in length up to about 30 amino acids, comprise at least one class A amphipathic helix, and protect a phospholipid against oxidation by an oxidizing agent. The peptides are highly stable and readily administered via an oral route. The peptides are effective to stimulate the formation and cycling of pre-beta high density lipoprotein-like particles and / or to promote lipid transport and detoxification. In addition, the peptides inhibit osteoporosis. When administered with a statin, the peptides enhance the activity of the statin permitting the statin to be used at significantly lower dosages and / or cause the statins to be significantly more anti-inflammatory at any given dose.
Owner:UAB RES FOUND +1

Apoe immunotherapy

InactiveUS20120204275A1Treating and effectingTreating and effecting prophylaxisFungiNervous disorderDiseaseAntibody
Owner:PROTHENA BIOSCI LTD

Pharmaceutical Composition Comprising An Immunoglobulin FC Region as a Carrier

Disclosed is a novel use of an immunoglobulin Fc fragment, and more particularly, a pharmaceutical composition comprising an immunoglobulin Fc fragment as a carrier. The pharmaceutical composition comprising an immunoglobulin Fc fragment as a carrier remarkably extends the serum half-life of a drug while maintaining the in vivo activity of the drug at relatively high levels. Also, when the drug is a polypeptide drug, the pharmaceutical composition has less risk of inducing immune responses compared to a fusion protein of the immunoglobulin Fc fragment and a target protein, and is thus useful for developing long-acting formulations of various polypeptide drugs.
Owner:HANMI SCI CO LTD

Orally administered small peptides synergize statin activity

InactiveUS20050164950A1Many symptomReadily takenNervous disorderDipeptide ingredientsLipid TransportSmall peptide
This invention provides novel peptides that ameliorate one or more symptoms of atherosclerosis. The peptides are highly stable and readily administered via an oral route. The peptides are effective to stimulate the formation and cycling of pre-beta high density lipoprotein-like particles and / or to promote lipid transport and detoxification. This invention also provides a method of tracking a peptide in a mammal. In addition, the peptides inhibit osteoporosis. When administered with a statin, the peptides enhance the activity of the statin permitting the statin to be used at significantly lower dosages and / or cause the statins to be significantly more anti-inflammatory at any given dose.
Owner:UNIV OF ALABAMA BIRMINGHAM RES FOUND +1

Expression of factor IX in gene therapy vectors

Two mechanisms are provided for improving the expression of Factor IX in gene therapy vectors. The first is the use of a specific Factor IX polynucleotide coding sequence designed for optimal expression. The second is the use of transcriptional regulatory regions minimized in size so that they can be used to express Factor IX, as well as any other gene of interest, in a size-constrained environment such as in a self complementary gene therapy vector system.
Owner:ST JUDE CHILDRENS RES HOSPITAL INC

Process for separating unsaponifiable valuable products from raw materials

Disclosed are processes for separating valuable products, including unsaponifiable materials, from any given matrix of raw materials that is mainly composed of saponifiable components and unsaponifiable components. Preferred methods include converting sodium or potassium soaps obtained from the saponification of a starting material into metallic soaps which have a lower melting point, and when melted, have viscosity sufficiently low to enable processing such as by distillation / evaporation processes. Preferred raw materials include animal or vegetable products, as well as by-products, residues, and waste products from the processing of animal or vegetable products, such as from food processing, cellulose processing and the like. Valuable products which may be obtained by the disclosed processes include sterols, vitamins, flavonoids, and tocopherols.
Owner:RESITEC PARTICIPACOES