Use of pirna-54265 in diagnosis, treatment, and prognostic evaluation of colorectal cancer

Abstract

The present invention relates to a marker piRNA-54265 and a method in diagnosis, treatment, and prognostic evaluation of colorectal cancer. The marker piRNA-54265 is capable of being used for diagnosing and/or treating colorectal cancer, wherein the marker piRNA-54265 is selected from any of molecules as follows: (1) SEQ ID NO.29: tggaggtgatgaactgtctgagcctgacc; (2) SEQ ID NO.30: UGGAGGUGAUGAACUGUCUGAGCCUGACC; (3) SEQ ID NO.31: GGUCAGGCUCAGACAGUUCAUCACCUCCA; (4) a piR-54265 variant and a piR-54265 derivative modified from the molecule shown in (1), (2) or (3) with a same function; (5) a piR-54265 polynucleotide construct capable of down-regulating an amount of the piR-54265 in vivo after being introduced; and (6) an expression vector containing the polynucleotide construct of (5). The method is used for diagnosing/screening colorectal cancer, evaluating chemosensitivity of a colorectal cancer patient, evaluating a prognosis of a colorectal cancer patient or treating colorectal cancer.

Description

CROSS-REFERENCE TO RELATED APPLICATION[0001]This is a continuation-in-part application of International Application No. PCT / CN2018 / 096398, filed on Jul. 20, 2018, which claims the priority benefits of China Application No. 201810146715.6, filed on Feb. 12, 2018 and Chinese application no. 201910036674.X, filed on Jan. 15, 2019. The entirety of each of the above-mentioned patent applications is hereby incorporated by reference herein and made a part of this specification.BACKGROUNDTechnical Field[0002]The present invention belongs to the field of biomedical technologies, and more particularly, relates to use of piRNA-54265 in diagnosis, treatment, and prognostic evaluation of colorectal cancer.Description of Related Art[0003]Colorectal cancer is a common gastrointestinal tumor worldwide, ranking high among various malignant tumors, and is one of the leading causes of cancer-related death around the world. It is clinically difficult to cure advanced colorectal cancer but not colorecta...

AI Technical Summary

Benefits of technology

[0055]Based on the above research results, the present invention further provides a piRNA-54265 detection kit which can be used for early screening, diagnosis, efficacy monitoring and prognosis evaluation of colorectal cancer. The present invention originally provides a specific primer design pattern for the piRNA-54265, and verifies that both the amplification efficiency and specificity of the primers designed thereof are excellent. The kit provides a complete process from RNA purification of specimen to the expression level detection of the target piRNA 54265. The process is already optimized for easy and efficient operation. Moreover, when the kit is in use, a specimen to be detected is suitable for tissues, cells, cell supernatant and body fluids such as serum (plasma), urine, saliva, and other types of specimens with rare RNA, and the required specimen amount is less than that of the same type of kits in the market. Meanwhile, two optional expression detection methods including real-time fluorescent quantitative PCR and absolute quantitative droplet digital PCR are provided, so the application range is wide.

Problems solved by technology

It is clinically difficult to cure advanced colorectal cancer but not colorectal cancer at early stage.

Colonoscopy is an important means for early diagnosis of colorectal cancer and has high accuracy, but it is an examination method causing wounds and is difficult to apply in the general population census due to high economic costs, requirements on operators and equipment and poor compliance of persons to do the examination.

In addition, there are some early screening and companion diagnostic methods, but their sensitivity and specificity are poor.

Therefore, it is of great demand and significance to develop and establish a less economical cost, technically simple, but sensitive and specific biomarker for early screening and diagnosis of colorectal cancer.

Meanwhile, chemotherapy for colorectal cancer is also plagued by drug resistance in tumor.

There are significant individual differences in the effects of chemotherapy, but the mechanism is unclear and basically there are currently no biomarkers for predicting curative effect.

In addition, there is a huge individual difference in the prognosis of colorectal cancer patients, and there is currently no indicator for evaluating prognosis.

Another important issue for colorectal cancer is the judgment of prognosis for patient treatment and the selection of right treatment solutions.

When perturbing the expression level of the piRNA-54265, the colorectal cancer cells show a certain degree of enhancement of chemosensitivity; and the patients with high-expressed piRNA-54265 has poor short-term efficacy of chemotherapy.

Images