Use of pirna-54265 in diagnosis, treatment, and prognostic evaluation of colorectal cancer

a colorectal cancer and prognostic evaluation technology, applied in the field of biomedical technologies, can solve the problems of poor sensitivity and specificity, difficult application, and clinically difficult to cure advanced colorectal cancer, and achieve the effects of excellent amplification efficiency and specificity of the primer designed thereof, wide application range, and easy and efficient operation

Inactive Publication Date: 2020-01-16
SUN YAT SEN UNIV +1
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present invention provides a new marker, piRNA-54265, for the diagnosis and treatment of colorectal cancer. This marker can be used for early screening, diagnosis, and monitoring of treatment efficacy. It is highly expressed in cancer tissues and can indicate the chemosensitivity and prognosis of a patient. The marker can be detected in serums of patients and is easy to distinguish. Inhibiting or knocking down the expression of piRNA-54265 can enhance the chemotherapy efficacy of colorectal cancer cells and improve the overall survival of patients. The invention also provides a detection kit for early screening, diagnosis, and prognosis evaluation of colorectal cancer using the piRNA-54265 marker. The kit is easy to operate and can detect the marker in various specimens such as tissues, cells, and body fluids.

Problems solved by technology

It is clinically difficult to cure advanced colorectal cancer but not colorectal cancer at early stage.
Colonoscopy is an important means for early diagnosis of colorectal cancer and has high accuracy, but it is an examination method causing wounds and is difficult to apply in the general population census due to high economic costs, requirements on operators and equipment and poor compliance of persons to do the examination.
In addition, there are some early screening and companion diagnostic methods, but their sensitivity and specificity are poor.
Therefore, it is of great demand and significance to develop and establish a less economical cost, technically simple, but sensitive and specific biomarker for early screening and diagnosis of colorectal cancer.
Meanwhile, chemotherapy for colorectal cancer is also plagued by drug resistance in tumor.
There are significant individual differences in the effects of chemotherapy, but the mechanism is unclear and basically there are currently no biomarkers for predicting curative effect.
In addition, there is a huge individual difference in the prognosis of colorectal cancer patients, and there is currently no indicator for evaluating prognosis.
Another important issue for colorectal cancer is the judgment of prognosis for patient treatment and the selection of right treatment solutions.
When perturbing the expression level of the piRNA-54265, the colorectal cancer cells show a certain degree of enhancement of chemosensitivity; and the patients with high-expressed piRNA-54265 has poor short-term efficacy of chemotherapy.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of pirna-54265 in diagnosis, treatment, and prognostic evaluation of colorectal cancer
  • Use of pirna-54265 in diagnosis, treatment, and prognostic evaluation of colorectal cancer
  • Use of pirna-54265 in diagnosis, treatment, and prognostic evaluation of colorectal cancer

Examples

Experimental program
Comparison scheme
Effect test

embodiment 1

TCGA Data Analysis and Tissue Specimens of Patients Detection Indicates the Increased Expression Level of a piR-54265 in Colorectal Cancer

[0076]1. Experimental Method:

[0077]TCGA and GEO expression profile data were extracted and analyzed to obtain 20 top high-expressed piRNAs in colorectal cancer. Specific primers were designed for the top 20piRNAs, and then expression quantitation by qPCR was performed in 110 tumor tissue and paired non-tumor tissue specimens of colorectal cancer patients from Guangzhou. The expression level of the identified piR-54265 was verified in another 108 tumor tissue and paired non-tumor tissue specimens of colorectal cancer patients from Suzhou. Bioinformatics analysis of the gene copy number variation and DNA methylation modification of piRNA-54265 was performed According to the COAD data in TCGA database.

[0078]2. Experimental Results:

[0079]As shown in FIGS. 1a and 1b, only the expressions of the piRNA-54265 in the colorectal cancer tissue and the paired...

embodiment 2

High Expression Level of the piR-54265 in Cancer Tissues Associates with Poor Survival Prognosis in Colorectal Cancer Patients

[0083]1. Experimental Method:

[0084]SPSS (19.0) was used to analyze the expression of the piR-54265 in cancer tissues and the prognosis of colorectal cancer patients (such as the above-mentioned 110 colorectal cancer patients with postoperative chemotherapy from Guangzhou and 108 colorectal cancer patients with postoperative chemotherapy from Suzhou).

[0085]2. Experimental Results:

[0086]The expression level of the piR-54265 in cancer tissues was related to the survival prognosis of the colorectal cancer patients. The high-expressed piR-54265 was associated with poor prognosis of the colorectal cancer patients, having both shorter 5-year overall survival and 5-year progression-free survival. The results were consistent in the two sample sets, Guangzhou and Suzhou (as shown in FIG. 2).

embodiment 3

High Expression Level of the piR-54265 in Serum Associates with Poor Survival Prognosis of in Colorectal Cancer Patients

[0087]1. Experimental Method:

[0088]four serum specimens were randomly selected from the samples of colorectal cancer cases previously mentioned for Northern Blot to directly determine the presence or absence of piR-54265 in serum; then, RNA extraction and piR-54265 expression detection by RT-qPCR were performed on all serum specimens, and the correlation between the serum piR-54265 and the piR-54265 level in the cancer tissues was analyzed. Survival analysis was performed on the serum piR-54265 level and the prognosis of the corresponding patients. RNA was extracted from 111 serum specimens of normal people followed by piR-54265 expression detection via RT-qPCR and unpaired Student's t-test statistical analysis was performed to compare the serum piR-54265 levels of normal people and the colorectal cancer patients.

[0089]2. Experimental Results:

[0090]As shown in FIG....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
volumeaaaaaaaaaa
volumeaaaaaaaaaa
total volumeaaaaaaaaaa
Login to View More

Abstract

The present invention relates to a marker piRNA-54265 and a method in diagnosis, treatment, and prognostic evaluation of colorectal cancer. The marker piRNA-54265 is capable of being used for diagnosing and / or treating colorectal cancer, wherein the marker piRNA-54265 is selected from any of molecules as follows: (1) SEQ ID NO.29: tggaggtgatgaactgtctgagcctgacc; (2) SEQ ID NO.30: UGGAGGUGAUGAACUGUCUGAGCCUGACC; (3) SEQ ID NO.31: GGUCAGGCUCAGACAGUUCAUCACCUCCA; (4) a piR-54265 variant and a piR-54265 derivative modified from the molecule shown in (1), (2) or (3) with a same function; (5) a piR-54265 polynucleotide construct capable of down-regulating an amount of the piR-54265 in vivo after being introduced; and (6) an expression vector containing the polynucleotide construct of (5). The method is used for diagnosing / screening colorectal cancer, evaluating chemosensitivity of a colorectal cancer patient, evaluating a prognosis of a colorectal cancer patient or treating colorectal cancer.

Description

CROSS-REFERENCE TO RELATED APPLICATION[0001]This is a continuation-in-part application of International Application No. PCT / CN2018 / 096398, filed on Jul. 20, 2018, which claims the priority benefits of China Application No. 201810146715.6, filed on Feb. 12, 2018 and Chinese application no. 201910036674.X, filed on Jan. 15, 2019. The entirety of each of the above-mentioned patent applications is hereby incorporated by reference herein and made a part of this specification.BACKGROUNDTechnical Field[0002]The present invention belongs to the field of biomedical technologies, and more particularly, relates to use of piRNA-54265 in diagnosis, treatment, and prognostic evaluation of colorectal cancer.Description of Related Art[0003]Colorectal cancer is a common gastrointestinal tumor worldwide, ranking high among various malignant tumors, and is one of the leading causes of cancer-related death around the world. It is clinically difficult to cure advanced colorectal cancer but not colorecta...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12Q1/6827
CPCC12Q2600/166C12Q2600/178C12Q1/6827C12Q1/6886C12Q2600/106C12Q2600/118C12N15/113A61K31/7105C12N2310/113C12N2320/30G01N33/57419
InventorLIN, DONGXINZHENG, JIANMAI, DONGMEITAN, LIPING
OwnerSUN YAT SEN UNIV