61results about How to "Short survival time" patented technology

The present invention provides a plurality of biomarkers for predicting survival of a subject with a lung cancer. More specifically, the present invention relates to methods of predicting survival of a subject with a lung cancer, a kit for predicting survival of a subject with a lung cancer, and an array for predicting survival of a subject with lung cancer.

The invention discloses a method for refreshing water-detacted live portunus tritubercularus, which comprises the steps of: 1, purifying the portunus tritubercularus in seawater, and then putting the portunus tritubercularus in the 2-5 DEG C seawater for soaking for 3-5min to ensure that the portunus tritubercularus is in a narcosis state, wherein the 2-5 DEG C seawater contains 0.1 percent of stable vitamin C; 2, putting a moisturizing material in the 2-5 DEG C seawater containing 0.1 percent of stable vitamin C for soaking until the moisturizing material is saturated; and 3, firstly placingan oxygenating agent in a cavity in the middle of a package box, then laying one layer of moisturizing material above the oxygenating agent, placing the portunus tritubercularus above the moisturizing material, placing one layer of moisturizing material, i.e. a second layer of moisturizing material, above the portunus tritubercularus and covering the packaging box by the cover thereof. The methoddisclosed by the invention has the advantages of long survival time of the portunus tritubercularus, capability of effectively ensuring the edible value and enlarging the marketing range, clean surface of the portunus tritubercularus body, and low cost.

The present invention relates to methods for predicting the survival time of patients suffering from cancer. Said methods are based on the quantification and analysis of the cell free nucleic acids that are present in a sample from the patient and typically include the determination of the level of the mutant nucleic acid which contains a mutation of interest, the calculation of the mutation load for said mutation of interest, the calculation of the DNA integrity index or a combination thereof.

The present invention provides a method for predicting the treatment response of a human gastroesophageal cancer patient, the method comprising: a) measuring the gene expression of at least 3 of the following genes: CDH1, CDK6, COX2, ELOVL5, GATA4, EGFR, TBCEL, FGF7, CDH17, FNBP1, PIP5K1B, TWIST, CD44, MET, CEACAM1, TOX3, GLIPR2, GSTP1, RON, TMEM136, MYB, BRCA2, FGF1, POU5F1, EPR, DPYD, ABL2 and SH3RF1 in a sample obtained from the gastroesophageal tumour of the patient to obtain a sample gene expression profile of at least said genes; and b) making a prediction of the treatment response and / or prognosis of the patient based on the sample gene expression profile. Also provided are related computer-implemented methods and methods of treatment of gastroesophageal cancer.

The invention provides a natural protein / polycaprolactone nanofiber electrospun membrane, and preparation and application thereof. The natural protein / polycaprolactone nanofiber electrospun membrane is obtained by mixing natural protein and polycaprolactone to prepare a spinning solution and performing electrospinning, and the natural protein comprises natural elastin and natural collagen. The natural protein containing cardiac muscle tissue extracellular matrix components is mixed with an artificially synthesized degradable material, and the nanofiber membrane can be prepared quickly and effectively through an electrostatic spinning technically. The natural protein / polycaprolactone nanofiber electrospun membrane has the advantages that preparation is simple, materials are easy to obtain, and preparation cost is low. The natural protein / polycaprolactone nanofiber electrospun membrane not only has a good biomechanical property, but also can fully simulate cardiac muscle tissue extracellular matrix environment. Biological simulation can be carried out in the aspects of the structure and the ingredient, and an effect of treating myocardial infarction by stem cell transplantation is improved. Therefore, the natural protein / polycaprolactone nanofiber electrospun membrane can serve as an extracellular culture medium to provide an extracellular matrix microenvironment for promoting cell adhesion, survival and multiplication.

The present invention provides methods for detecting the risk of developing leukemia using genotyping analysis, for example of a SNP located in the promoter region of EPO. The present invention also provides kits and nucleic acids for the detection of the risk genotype.

The invention discloses a method for refreshing water-detacted live portunus tritubercularus, which comprises the steps of: 1, purifying the portunus tritubercularus in seawater, and then putting the portunus tritubercularus in the 2-5 DEG C seawater for soaking for 3-5min to ensure that the portunus tritubercularus is in a narcosis state, wherein the 2-5 DEG C seawater contains 0.1 percent of stable vitamin C; 2, putting a moisturizing material in the 2-5 DEG C seawater containing 0.1 percent of stable vitamin C for soaking until the moisturizing material is saturated; and 3, firstly placingan oxygenating agent in a cavity in the middle of a package box, then laying one layer of moisturizing material above the oxygenating agent, placing the portunus tritubercularus above the moisturizing material, placing one layer of moisturizing material, i.e. a second layer of moisturizing material, above the portunus tritubercularus and covering the packaging box by the cover thereof. The methoddisclosed by the invention has the advantages of long survival time of the portunus tritubercularus, capability of effectively ensuring the edible value and enlarging the marketing range, clean surface of the portunus tritubercularus body, and low cost.

The present invention relates to a marker piRNA-54265 and a method in diagnosis, treatment, and prognostic evaluation of colorectal cancer. The marker piRNA-54265 is capable of being used for diagnosing and / or treating colorectal cancer, wherein the marker piRNA-54265 is selected from any of molecules as follows: (1) SEQ ID NO.29: tggaggtgatgaactgtctgagcctgacc; (2) SEQ ID NO.30: UGGAGGUGAUGAACUGUCUGAGCCUGACC; (3) SEQ ID NO.31: GGUCAGGCUCAGACAGUUCAUCACCUCCA; (4) a piR-54265 variant and a piR-54265 derivative modified from the molecule shown in (1), (2) or (3) with a same function; (5) a piR-54265 polynucleotide construct capable of down-regulating an amount of the piR-54265 in vivo after being introduced; and (6) an expression vector containing the polynucleotide construct of (5). The method is used for diagnosing / screening colorectal cancer, evaluating chemosensitivity of a colorectal cancer patient, evaluating a prognosis of a colorectal cancer patient or treating colorectal cancer.

The invention provides a preparation method of a TiO2 / active carbon net-loaded adsorption-photocatalysis water purifying composite material, and relates to a preparation method of an adsorption-photocatalysis water purifying composite material. The preparation method provided by the invention is used for solving the technical problem that a TiO2 photocatalysed powder suspended phase catalyst is not easy to recycle, is liable to coagulate to cause secondary pollution, and has poor treatment effect on water body low concentration organic contamination. The preparation method comprises the steps of first, pre-treating active carbon; second, preparing TiO2 / active carbon composite powder; third, loading the composite powder to a net. The preparation method has the following advantages: active carbon with excellent adsorbability is combined with a TiO2 photocatalyst to prepare adsorption-photocatalysis composite powder, and the powder is loaded to the nylon net, so as to effectively treat a wide water area and realize recycle. Placing the composite material provided by the invention into sewage, and naturally treating for 12 hours, the organic matter degradation rate reaches not less than 90 percent. The preparation method is applied to the field of water treatment.

The invention provides a detection method for survival prognosis of glioblastoma. The method is characterized in that the method comprises the following steps: the expression levels of specific expression genes CBX3, BARD1, EGFR, IFRD1, CTSS, STAT1, GUCY1A3 and MOBP in a glioblastoma tissue are detected, survival prognosis of a glioblastoma patient is predicted according to the expression level ofthe detected gene, and the survival time of the glioblastoma patient highly expressing CBX3, BARD1, EGFR, IFRD1, CTSS or / and STAT1 is short; the glioma patient with high expression of GUCY 1A3 or / andMOBP has a long survival time. The invention also provides a prognostic typing method for glioblastoma. The glioblastoma with high expression of CBX3, BARD1, EGFR, IFRD1, CTSS or / and STAT1 in glioblastoma tissues is / are short in prognostic survival time; and the high expression of the GUCY 1A3 or / and MOBP in the cytoma tissue is prognosis, and the survival time is long.

The invention relates to the technical field of plant propagation expanding, specifically relates to a temporary planting method of plant tissue culture seedlings and particularly relates to a temporary planting method taro tissue culture seedlings. The temporary planting method includes the steps of firstly, hardening the plant tissue culture seedlings; secondly, taking out the hardened plant tissue culture seedlings, sterilizing and cleaning; thirdly, performing temporary planting, to be more specific, planting the cleaned plant tissue culture seedlings into a seedling bed, wherein the matrix in the seedling bed mainly comprises mushroom-dreg-fermented fertilizer, mud and water. The temporary planting method is fast in planting, difficult in weed generation, low in manpower cost, short in surviving time and high in survival rate.

The invention discloses aerosol purification equipment and belongs to the technical field of air purification. The equipment comprises an equipment main body. The left end of the equipment main body is provided with an air inlet, the right end of the equipment main body is provided with an air outlet, a fan is arranged at the position, close to the air outlet, in the equipment main body, a primaryfilter, an intermediate filter and a precision filter are sequentially arranged from the left end to the right end in the equipment main body, a first sterilization cavity is formed between the primary filter and the intermediate filter, an ultraviolet lamp and a high-voltage electrostatic sterilization device are arranged in the first sterilization cavity, a second sterilization cavity is formedbetween the intermediate filter and the precision filter, and an ultrasonic wave generating device is arranged in the second sterilization cavity. By adopting the comprehensive air purification method of physical filtration, ultraviolet sterilization, electrostatic dust collection, ultrasonic dust collection and copper material lining, the air purification effect and the killing rate of bacteriaand viruses can be further improved.

The current disclosure provides methods for detecting and analyzing KRT17 expression in a sample obtained from a subject. The current disclosure also pertains to methods and kits for identifying a mammalian subject with head and neck squamous cell carcinoma. The current disclosure further provides methods and kits for determining the likelihood of survival of a subject having head and neck squamous cell carcinoma.

The disclosure relates to methods and pharmaceutical compositions for the treatment of non-small cell lung cancer (NSCLC) that coexists with chronic obstructive pulmonary disease (COPD). In particular, the disclosure relates to a method of treating non-small cell lung cancer (NSCLC) in a patient suffering from chronic obstructive pulmonary disease (COPD) comprising administering to the patient a therapeutically effective amount of an immune checkpoint inhibitor such as is a multispecific antibody comprising at least one binding site that specifically binds to a PD-1 molecule and at least one binding site that specifically binds to a TIM-3 molecule.

The present invention relates to methods for the diagnosis and the treatment of cancer, in particular breast cancer. In particular, the present invention relates to a method of diagnosing cancer in a subject comprising the steps of i) determining the expression level of 11βHSD1 and / or 11βHSD2 in a sample obtained from the subject, ii) comparing the expression level determined at step i) with its predetermined reference value and ii) concluding that the subject suffers from a cancer when the expression level of 11βHSD1 is lower than its predetermined reference value or when the expression level of 11βHSD2 is higher than its predetermined reference value.

The invention belongs to the technical field of biomedicine, and particularly discloses an application of an FLT3LG protein to preparation of lung adenocarcinoma postoperation and prognosis evaluationreagents or kits. According to the application, the FLT3LG protein is taken as a marker to detect lung adenocarcinoma tissue specimens through an immunohistochemical method and judge the prognosis ofthe lung adenocarcinoma patients; the FLT3LG protein has high expression in the lung adenocarcinoma and has low expression in para-carcinoma tissues; the expression level of the FLT3LG protein in thelung adenocarcinoma is related to the survival of the patients; and the high-expression patients are bad in prognosis and short in survival. The expression level of the FLT3LG protein is not only related to the total survival of the lung adenocarcinoma patients, but also related to the disease-free survival of the patients, and the patients, the FLT3LG protein of which has high expression, have recurrence or metastasis earlier; and serving as a lung adenocarcinoma postoperation and prognosis marker, the FLT3LG protein has a wide application prospect and a relatively large social benefit.

The invention relates to a cell, an immunotherapy product, a gene editing method, a cell preparation method and the application. The invention discloses a cell which is a CAR-NK cell obtained after a target site is knocked out through an RNP compound, the RNP compound comprises Cas9 protein and sgRNA, the target site is PD-1, and the sgRNA at least comprises a nucleotide sequence SEQ ID NO: 8 and a nucleotide sequence SEQ ID NO: 12. According to the scheme, the anti-tumor activity of cells and the killing effect on tumor cells are effectively improved, and the compound can be developed into an effective anti-tumor biological preparation.

The invention discloses a building sewage treatment system. The building sewage treatment system comprises a reactor I, a reactor II and a reactor III, which are sequentially connected with one another. By utilizing a chemical treatment way, a flocculating agent, a sterilizing agent, a decoloring agent, a denitrition and dephosphorization agent, a deodorizing agent and the like are respectively charged into the sewage to be stirred, flocculated and precipitated, precipitated solids are compressed by virtue of a pressure chamber to form sludge with low water content, the sludge is bagged to be transported to a refuse landfill or to be secondarily biochemically treated, liquid naturally flows out by utilizing the water level height difference and enters an urban rainy water discharging pipe network, the escaping, overflow, dropping and leakage problems of the sewage pipe network can be solved; the internet technology also can be utilized to realize the centralized management remote monitoring of the building sewage treatment system, and the problem that the requirement of the biochemical treatment later management technology is high can be solved.

The present invention relates to a method and composition for treating melanoma, aggressive / invasive melanoma, metastatic melanoma or melanoma resistant. More particularly, inventors have shown that high expression of PTX3 correlates with melanoma invasiveness and with a poorer survival rate in metastatic melanoma patients. PTX3 knockdown inhibited melanoma cell migration, invasion, lung metastasis, and NFκB signaling pathway. An addition of melanoma-derived or recombinant PTX3, or overexpression of PTX3 enhanced motility of low migratory cells. Finally, they found that TLR4 and MYD88 knockdown or targeting inhibited PTX3-induced melanoma cell migration, suggesting that PTX3 functions through a TLR4 / NFκB-dependent pathway. Accordingly, the invention relates to a method for predicting the survival time of a subject suffering from melanoma, aggressive / invasive melanoma, metastatic melanoma or melanoma resistant by quantifying the expression level of PTX3 in a biological sample and to a method of treating melanoma, aggressive / invasive melanoma, metastatic melanoma or melanoma resistant by using the inhibitors of PTX3.

Methods, systems, and apparatus, including computer programs encoded on a computer storage medium, for receiving one or more subscription requests, wherein each subscription request is received from arespective subscriber client and is for a respective channel, authorizing one or more of the subscription requests, wherein each authorized subscription request permits the subscriber client of the request to receive messages published to the channel of the request, receiving one or more messages for publication, wherein each message is received from a respective publisher client and is for publication on a respective channel, for each of the messages, placing the message in a respective buffer for the channel of the message, wherein the messages are present in the buffer during a finite time-to-live period for the buffer, and for one or more of the buffers, sending any messages in the buffer to subscriber clients that are authorized.

The present invention relates to methods for the diagnosis and the treatment of cancer, in particular breast cancer. In particular, the present invention relates to a method of diagnosing cancer in a subject comprising the steps of i) determining the expression level of 11βHSD1 and / or 11βHSD2 in a sample obtained from the subject, ii) comparing the expression level determined at step i) with its predetermined reference value and ii) concluding that the subject suffers from a cancer when the expression level of 11βHSD1 is lower than its predetermined reference value or when the expression level of 11βHSD2 is higher than its predetermined reference value.

The invention discloses an application of SSX2IP in preventing and treating tumor metastasis. Specifically, the invention provides an application of an SSX2IP inhibitor in preparing drugs for inhibiting tumor metastasis or tumor cell migration. The SSX2IP inhibitor can be used as a drug effective component for inhibiting the tumor metastasis or tumor cell migration, can enhance sensitivity of the tumor cells to chemotherapeutics or reduce drug tolerance of the tumor cells to the chemotherapeutics. Besides, the SSX2IP gene or protein and agonist thereof can be used for promoting proliferation or migration of the tumor cells and for preparing an animal model for the tumor cells.

The invention relates to a glass fiber antistatic composition, which belongs to the technical field of glass fiber surface treatment. The composition comprises 1-35 parts by mass of an antistatic agent, 55-99 parts by mass of a polar organic solvent, and 0.02-1 part by mass of a wetting agent, wherein the wetting agent is an alkynediol ethyoxyl compound; the polar organic solvent has volatility. The invention also relates to application of the antistatic composition in preparation of antistatic glass fibers. Compared with the prior art, the composition has advantages that the composition can achieve uniform coating of the antistatic agent, the antistatic performance of the glass fibers is remarkably improved, and the problem that the product quality is influenced due to the fact that the dispersity of the glass fibers is reduced as moisture of an existing antistatic agent is not easy to volatilize can be avoided.

The invention discloses an application of SSX2IP in predicating or diagnosing tumor metastasis. Specifically, the invention provides an application of SSX2IP gene or protein in preparing a reagent or a kit for detecting the tumor metastasis. Studies demonstrate that SSX2IP gene and an expression product thereof can be used as a specific marker gene for diagnosing or predicating tumor (for example, liver cancer) metastasis, and is beneficial to diagnose and predicate the tumor metastasis more accurately and early.

The present invention relates to an in vitro method for determine the prognosis of the survival time of a patient suffering from a cancer comprising the steps consisting of i) determining the expression level of the couple DNMT3A / ISGF3γ in a sample from said patient, ii) comparing said expression level with a predetermined reference value and iii) providing a good prognosis when the expression level is lower than the predetermined reference value and a poor prognosis when the expression level is higher than the predetermined reference value. The invention also relates a compound which is a DNMT3A / ISGF3γ antagonist or a compound which is a DNMT3A / ISGF3γ gene expression inhibitor for use in the treatment and prevention of cancer.

The invention provides a composite resin aerogel, which is obtained by compounding an organic resin prepared from glycidyl methacrylate, divinyl benzene and ethylene glycol dimethacrylate with activated cellulose, then modifying with 3-alpha-furyl acrylic acid, and carrying out circulating freeze drying; or compounding the activated cellulose with organic resin, modifying with 3-alpha-furyl acrylic acid, loading a photocatalyst, and carrying out circulating freeze drying to obtain the product. The invention further provides a specific preparation method of the composite resin aerogel and an application method of the composite resin aerogel in sewage treatment, the process is simple, the effect is excellent, the aerogel is wrapped in the stainless steel grids, so that the contact area between the aerogel and sewage is large enough, the integrity of the aerogel is protected, and the aerogel can be repeatedly used; the composite resin aerogel is high in porosity, large in specific surface area, excellent in shape recovery performance, excellent in heavy metal ion adsorption performance, capable of being resolved and regenerated, capable of being recycled for multiple times and good in application potential.

The present invention relates to methods for predicting the survival time of patients with decompensated alcoholic cirrhosis. In particular, the present invention relates to a method for predicting the survival time of a patient with decompensated alcoholic cirrhosis comprising i) determining the expression level of OAS2 or MX2 in a sample of peripheral blood mononuclear cells obtained from the patient, ii) comparing the level determined at step i) with a predetermined reference value and iii) and concluding that the patient will have a short survival time when the level determined at step i) is higher than its predetermined reference value or concluding that the patient will have a long survival time when the level determined at step i) is lower than the predetermined reference value.

The invention relates to the field of biotechnology, in particular to the application of ICOSL protein in the preparation of breast cancer prognosis assessment kits. The beneficial effect of the present invention is that: the present invention utilizes immunohistochemistry technique, staining result semi-quantitative analysis method, analyzes the expression level of tumor tissue ICOSL protein, and combines postoperative follow-up information, determines whether ICOSL protein expression is related to the prognosis of breast cancer patients. There is a correlation, and the ICOSL protein can be used to prepare protein molecular markers for judging the prognosis of breast cancer patients, and it also has important guiding significance for postoperative monitoring and sequential treatment of breast cancer patients.