Exosome miR-101-3p and miR-101-3p antagonist and application thereof

Abstract

The invention discloses an exosome miR-101-3p, a miR-101-3p antagonist and application of the exosome miR-101-3p and the miR-101-3p antagonist. The nucleotide sequence of the miR-101-3p is shown as SEQ ID NO: 1. The exosome miR-101-3p is used as a biomarker for preparing a reagent or a kit, and is used for predicting vascular cognitive impairment, white matter damage conditions and neuroinflammation; reference basis is provided for diagnosis of clinical vascular cognitive impairment related diseases, and the method has great economic value and use value. The antagonist of the targeted miR-101-3p achieves the treatment effect of improving the vascular cognitive impairment by improving the vascular cognitive impairment, relieving white matter damage and relieving neuroinflammation.

Description

Technical Field

[0001] The present invention relates to the field of vascular drugs, and in particular to an exosome miR-101-3p and a miR-101-3p antagonist and applications thereof. Background Art

[0002] Vascular cognitive impairment (VCI) is a series of cognitive deficit diseases closely related to cerebrovascular disease, ranging from mild cognitive impairment to dementia. Vascular dementia, the most severe form of VCI, has become the second leading cause of dementia worldwide, bringing a heavy disease burden to human society. The most common pathological feature of VCI is white matter lesions, which are manifested by high signals in white matter on imaging examinations. Chronic cerebral hypoperfusion is a common cause and main driving factor of VCI, which appears before white matter lesions and persists until the late stage of dementia. At present, lipid-lowering and antihypertensive drugs and cognitive improvement drugs are the main treatment methods in clinical practice, but their main purpose is to reduce the occurrence of ischemic events and relieve symptoms, and there is still a lack of effective treatment methods. Neuroinflammation is an important physiological and pathological mechanism of VCI, involving multiple cell types and molecular mechanisms. Neuroinflammation can lead to damage to oligodendrocytes, which in turn causes damage to myelin and lesions in white matter, ultimately causing cognitive dysfunction. By regulating neuroinflammatory responses, it is expected that effective treatment strategies will be developed to improve cognitive function and quality of life in patients with VCI. Exosomes are microvesicle structures with a diameter of 40-150nm, which can carry DNA, RNA, proteins, lipids and other substances, and are widely present in the extracellular matrix and body fluids. The microRNA (miRNA) carried by exosomes plays an important role in intercellular communication and can participate in the pathogenesis of VCI through intercellular signaling. Current research evidence shows that exosomal miRNA plays an important role in the occurrence and development of vascular cognitive dysfunction and neuroinflammatory response. However, there are currently no reports on the development of exosome-related biomarkers in VCI patients and their application in their diagnosis and treatment.

[0003] MiRNA antagonists are specially chemically modified miRNA antagonists that strongly competitively bind to mature miRNAs in the body, preventing the complementary pairing of miRNAs with their target gene mRNAs and inhibiting the function of miRNAs. The Chinese invention patent with publication number CN105251008A discloses the use of miRNA-155 antagonists in the preparation of drugs for the treatment of scleroderma, suggesting the feasibility of developing antagonists against miRNAs for the treatment of VCI combined with AS. Although there are currently some different applications of miRNA antagonists in the treatment of diseases, there are no reports on the use of related antagonists as treatments for VCI.

[0004] Therefore, it is of great clinical significance to discover a biomarker that can effectively predict vascular cognitive dysfunction. At the same time, there is an urgent need to develop specific antagonists for targeted intervention of miRNA carried by exosomes, which can be used as a potential therapeutic drug to improve and delay cognitive dysfunction in VCI patients. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an exosomal miR-101-3p (hereinafter referred to as miR-101-3p) and its antagonist and application. The present invention uses miR-101-3p as a biomarker to prepare a kit or reagent for vascular cognitive dysfunction or predicting white matter damage after vascular cognitive dysfunction or predicting neuroinflammation after vascular cognitive dysfunction; the present invention also develops an antagonist of miR-101-3p and determines the role of the miR-101-3p antagonist in the preparation of a drug for treating vascular cognitive dysfunction.

[0006] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0007] The present invention provides an application of exosomal miR-101-3p as a biomarker in the preparation of a reagent or a kit for predicting or evaluating symptoms related to vascular cognitive dysfunction, wherein the nucleotide sequence of the exosomal miR-101-3p is uacaguacugugauaacugaa, as shown in SEQ ID NO: 1.

[0008] Furthermore, the vascular cognitive dysfunction-related symptom is the severity of vascular cognitive dysfunction or the severity of neuroinflammation after vascular cognitive dysfunction or the degree of white matter damage after vascular cognitive dysfunction. The present invention also provides a miR-101-3p antagonist, whose nucleotide sequence is uucaguuaucacaguacugua, as shown in SEQ ID NO:2.

[0009] Furthermore, the nucleotide sequence of the miR-101-3p antagonist is chemically modified.

[0010] The present invention also provides a use of the miR-101-3p antagonist in the preparation of medicines for improving vascular cognitive dysfunction and white matter damage.

[0011] The present invention also provides a use of the miR-101-3p antagonist in the preparation of a drug for alleviating neuroinflammation after vascular cognitive dysfunction.

[0012] The present invention also provides a drug for improving vascular cognitive dysfunction and white matter damage, and relieving neuroinflammation after vascular cognitive dysfunction, characterized in that the drug comprises an effective amount of the above-mentioned miR-101-3p antagonist and a pharmaceutically acceptable excipient.

[0013] Furthermore, the dosage form of the drug is an injection, and the auxiliary material is enzyme-free water.

[0014] Furthermore, the content of the miR-101-3p antagonist is 0.2 nmol.

[0015] Beneficial effects of the present invention:

[0016] 1. The exosome miR-101-3p of the present invention is used as a biomarker to prepare a reagent or a kit for predicting vascular cognitive dysfunction, predicting white matter damage and predicting neuroinflammation; it provides a reference for the diagnosis of clinical vascular cognitive dysfunction-related diseases and has significant economic value and use value.

[0017] 2. Antagonists targeting miR-101-3p can achieve the therapeutic effect of improving vascular cognitive dysfunction by improving vascular cognitive dysfunction, reducing white matter damage, and alleviating neuroinflammation. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The expression level diagram of exosomal miR-101-3p in mice with low / high expression;

[0019] Figure 2 The statistical graphs are the number of repeated visits of mice with low / high expression of exosomal miR-101-3p, the number of different walls in the first 8 visits (left figure) and the recognition index (right figure);

[0020] Figure 3 This is the correlation analysis diagram between the expression level of exosomal miR-101-3p and the recognition index;

[0021] Figure 4 Statistical graph of white matter damage scores of mice with low / high expression of exosomal miR-101-3p;

[0022] Figure 5 This is a correlation analysis diagram between the expression level of exosomal miR-101-3p and white matter damage score;

[0023] Figure 6 Statistical graphs of microglial cell density (left) and cell body area (right) in mice with low / high expression of exosomal miR-101-3p;

[0024] Figure 7The following are the correlation analysis diagrams of the expression level of exosomal miR-101-3p with microglia density (left figure) and cell body area (right figure);

[0025] Figure 8 The statistical graphs are the number of repeated visits after injection of miR-101-3p antagonist / control, the number of different walls visited in the first 8 times (left figure) and the recognition index (right figure);

[0026] Fig. 9 This is a statistical graph of white matter damage scores after injection of miR-101-3p antagonist / control;

[0027] Fig.10 Statistical graphs of microglial cell density (left) and cell body area (right) after injection of miR-101-3p antagonist / control;

[0028] Fig.11 This is a statistical chart of the changes in mRNA levels of various inflammation-related indicators after microglia were treated with miR-101-3p antagonists;

[0029] In the figure, A is the expression level of Nlrp3, B is the expression level of iNOS, C is the expression level of TNF-α, and D is the expression level of IL-4. DETAILED DESCRIPTION

[0030] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0031] Example 1 Exosomal miR-101-3p aggravates vascular cognitive dysfunction

[0032] C57BL / 6J wild-type mice aged 8-10 weeks were used to establish an animal model of vascular cognitive dysfunction by narrowing the bilateral common carotid arteries with a 0.22um spring under anesthesia. The BCAS mice injected with exosomes were divided into a low expression level group and a high expression level group according to the expression level of miR-101-3p. Figure 1 ) and observe their cognitive dysfunction respectively.

[0033] The cognitive dysfunction of mice after BCAS was evaluated by behavioral experiments, including the eight-arm maze test and the novel object recognition test.

[0034] 1) The eight-arm maze experiment is a behavioral experimental method commonly used to study the learning, memory and spatial navigation ability of mice. The number of choices used by the mouse to find the food at the end of each arm in the eight-arm maze is recorded, where the number of repeated visits is the number of times the mouse repeatedly visits the arm it has visited, and the number of different walls visited in the first 8 times is the number of different walls entered by the mouse in the first 8 choices. The fewer the number of repeated visits and the more the number of different walls visited in the first 8 times, the better the spatial learning ability of the mouse.

[0035] 2) The novel object recognition experiment is a behavioral experimental method commonly used to study the memory and cognitive function of mice. This experiment is based on the natural exploration tendency of animals for novel objects and is mainly used to evaluate their recognition memory. The recognition index is the number of times the mouse explores a novel object / the total time the mouse explores a novel object and a familiar object, which is used to quantify the animal's preference for a novel object. The higher the recognition index, the better the recognition memory function of the mouse.

[0036] The results of behavioral experiments showed that the number of repeated visits of mice increased, the number of different walls visited in the first 8 times decreased, and the recognition index decreased ( Figure 2 ). This indicates that the expression level of exosomal miR-101-3p is closely related to vascular cognitive dysfunction, and the level of exosomal miR-101-3p can be used as a potential biomarker for predicting cognitive dysfunction after chronic cerebral ischemia; wherein, the nucleotide sequence of miR-101-3p is uacaguacugugauaacugaa, as shown in SEQ ID NO:1.

[0037] Further correlation analysis was performed between the exosomal miR-101-3p level and the severity of cognitive dysfunction in the BCAS mouse model.

[0038] The results showed that the recognition index of the novel object recognition test of BCAS mice was negatively correlated with the expression level of miR-101-3p (R 2 =0.7010, p<0.0001). Therefore, plasma exosomal miR-101-3p can be used as a biomarker to predict the severity of vascular cognitive impairment ( Figure 3 ).

[0039] Example 2 Evaluation of white matter damage after vascular cognitive impairment by miR-101-3p level

[0040] Lok's fast blue staining is a method of using alkaline dyes to distinguish myelin sheaths in central nervous system tissues. It is commonly used to show changes in the integrity of myelin sheaths. Myelin is an insulating sheath composed of lipids and proteins that wraps around nerve fibers (axons). It plays a key role in the central and peripheral nervous systems, helping to speed up the conduction of nerve impulses and protect nerve fibers. The formation and maintenance of myelin sheaths is essential for the normal function of the nervous system. The specific method is as follows:

[0041] a. After rewarming the frozen sections at room temperature, wash them with phosphate buffer, tap water and ultrapure water for 5 minutes each, then dehydrate them in a gradient of 75% to 95% to 100% alcohol, and stain them in 0.1% LFB dye at 60°C for 6 to 8 hours.

[0042] b. After staining, take out the slices and place them at room temperature. Then, use 0.05% lithium carbonate differentiation solution and 75% alcohol to repeatedly separate the slices under a microscope until the myelin sheath is dyed blue and the background is almost colorless. The Lauck fast blue staining method can selectively dye the myelin sheath, which is used to observe the structure of the myelin sheath and determine the severity of white matter damage:

[0043] a. Normal myelin tissue is stained with blue dense structure, which is level 0.

[0044] b. Myelin fiber arrangement disorder is level 1,

[0045] c. Myelin cavitation is obvious at level 2,

[0046] d. Myelin fiber disappearance is grade 3;

[0047] The severity of white matter damage was assessed by Lough's fast blue staining.

[0048] The results showed that the severity of white matter damage in the group injected with high-expression miR-101-3p exosomes was significantly increased ( Figure 4 ). This indicates that the expression level of exosomal miR-101-3p is closely related to white matter damage after vascular cognitive dysfunction, and the level of exosomal miR-101-3p can be used as a potential biomarker to predict white matter damage after vascular cognitive dysfunction.

[0049] The correlation between the exosomal miR-101-3p level and the severity of white matter damage in the BCAS mouse model was further analyzed.

[0050] The results showed that the severity of white matter damage in BCAS mice was positively correlated with the level of miR-101-3p (R 2=0.5025, p=0.0021). Therefore, exosomal miR-101-3p can be used as a biomarker to assess posterior white matter damage after vascular cognitive impairment ( Figure 5 ).

[0051] Example 3: miR-101-3p levels predict the severity of neuroinflammation after vascular cognitive impairment

[0052] As innate immune cells of the central nervous system, the activation of microglia plays an important role in mediating neuroinflammation. Its highly activated state can release high levels of proinflammatory factors and cytotoxic substances, thereby exacerbating oligodendrocyte death and demyelination. The morphology of microglia is closely related to its function. Under normal circumstances, the cell bodies of microglia in the resting state are small and highly branched. When neuroinflammation in brain tissue is obvious, microglia gather in large numbers near the lesion tissue, with enlarged cell bodies and shortened processes. The activation of microglia can be described by the degree of aggregation and cell body area of ​​microglia. An increase in cell density indicates that they are activated and aggregated near the lesion, and a larger cell body area indicates that the cells are more activated.

[0053] In this example, the activation degree of microglia was analyzed by observing Iba-1 (a classic biomarker of microglia) through immunofluorescence staining.

[0054] The results showed that in the group injected with high-expression miR-101-3p exosomes, the density of microglia increased, the cell body area increased, and they were significantly activated ( Figure 6 ). This suggests that the level of exosomal miR-101-3p is closely related to microglia-mediated neuroinflammation after vascular cognitive dysfunction, and the level of exosomal miR-101-3p can be used as a potential biomarker to predict neuroinflammation after vascular cognitive dysfunction.

[0055] The correlation between the exosomal miR-101-3p level and the degree of microglial activation in the BCAS mouse model was further analyzed.

[0056] The results showed that the density of microglia in BCAS mice was positively correlated with the level of miR-101-3p (R 2 =0.4185, p = 0.0068), the cell body area of ​​microglia in BCAS mice was positively correlated with the level of miR-101-3p (R 2 =0.5461, p=0.0011). Therefore, exosomal miR-101-3p can be used as a biomarker to predict the severity of neuroinflammation after vascular cognitive impairment ( Figure 7 ).

[0057] Example 4 Antagonist sequences and modification methods

[0058] The nucleotide sequence of the miR-101-3p antagonist is uucaguuaucacaguacugua;

[0059] The negative control sequence was uuuguacuacacaaaaguacug;

[0060] The miR-101-3p antagonist is the reverse complementary sequence of the mature chain of miRNA miR-101-3p.

[0061] Example 5: miR-101-3p antagonist improves cognitive dysfunction after vascular cognitive dysfunction

[0062] The classic bilateral common carotid artery stenosis (BCAS) method was used to establish a mouse model of vascular cognitive dysfunction. The mice after BCAS modeling were injected with exosomes that highly expressed miR-101-3p once every 3 days through the tail vein for a total of 28 days. At the same time, the mice after modeling were injected with miR-101-3p antagonists (0.2nmol) or negative controls of the same dose to observe the intervention effect of miR-101-3p antagonists on vascular cognitive dysfunction in BCAS mice with high expression of exosomal miR-101-3p. The cognitive dysfunction of mice was evaluated by behavioral experiments (including eight-arm maze test and novel object recognition test).

[0063] The results showed that the number of repeated visits of mice injected with miR-101-3p antagonist decreased, the number of different walls visited in the first 8 times increased, and the recognition index increased ( Figure 8 ), indicating that the cognitive dysfunction of mice injected with miR-101-3p antagonists was improved to a certain extent. These results indicate that miR-101-3p antagonists can improve vascular cognitive dysfunction and thus improve the prognosis of patients.

[0064] Example 6 miR-101-3p antagonist improves white matter damage after vascular cognitive impairment

[0065] The changes in the severity of white matter damage in mice were shown by Lough's fast blue staining. The results showed that the severity of white matter damage in mice injected with miR-101-3p antagonist was significantly reduced ( Fig. 9 This suggests that miR-101-3p antagonists can reduce white matter damage after vascular cognitive dysfunction, thereby improving cognitive dysfunction.

[0066] Example 7 miR-101-3p antagonist alleviates neuroinflammation after vascular cognitive impairment

[0067] Iba-1 is often used as a biomarker for microglia. Observing Iba-1 by immunofluorescence staining can analyze the degree of microglial activation (microglial cell density and cell body area).

[0068] The results showed that after injection of miR-101-3p antagonist, the number of microglia in the ischemic white matter lesions decreased (density decreased) and the cell body area decreased, indicating that their activation was significantly weakened ( Fig.10 ). This suggests that miR-101-3p antagonists can inhibit the degree of microglial activation, indicating that this antagonist can reduce microglial inflammatory damage after vascular cognitive dysfunction and play a protective role against neuroinflammation as a potential therapeutic drug.

[0069] Example 8 Effect of miR-101-3p antagonist on alleviating neuroinflammation

[0070] In order to verify the antagonistic effect of miR-101-3p antagonist on neuroinflammation in vitro, this example uses miR-101-3p antagonist and its negative control to intervene in primary cultured microglia in vitro to verify the inhibitory effect of miR-101-3p inhibitor on neuroinflammation; the specific method is as follows:

[0071] Primary cultured microglia were cultured to a good state and then inoculated into cell well plates. A modified glucose-oxygen deprivation (OGD) model was used to simulate the ischemic, hypoxic and demyelinating environment of ischemic white matter damage in mice: the culture medium was replaced with a low-glucose culture medium, myelin fragments (5ug / mL) were added, and the microglia were placed in an incubator with an oxygen concentration of 1% for 4 hours of hypoxic culture for glucose-oxygen deprivation.

[0072] Primary cultured microglia were treated with miR-101-3p antagonist (50 nmol / L) and its negative control 48 hours before glucose-oxygen deprivation. After 4 hours of glucose-oxygen deprivation, the cells were lysed with Trizol, RNA was extracted, and the expression levels of microglial inflammatory factors were detected by real-time quantitative PCR.

[0073] Classical view is that activated microglia can secrete a variety of inflammatory factors, play a pro-inflammatory role, aggravate inflammatory damage, and promote the progression of the disease; classic pro-inflammatory indicators include: NOD-like receptor pyrin domain-related protein 3 (Nlrp3), inducible nitric oxide synthase (iNOS), etc. Microglia can also secrete anti-inflammatory cytokines that contribute to neuroprotection.

[0074] Classic anti-inflammatory indicators include tumor necrosis factor 1 (TNF-α), interleukin 4 (IL-4), etc. By detecting these inflammation-related indicators, the inflammatory phenotype of microglia and its corresponding functions can be reflected.

[0075] Specifically, in this example, the expression levels of these different indicators were detected by PCR to monitor the functional changes of microglia after treatment with miR-101-3p antagonist. Specific indicators and corresponding primer sequences include:

[0076] Gene Upstream primer Downstream primer β-Actin TGGAATCCTGTGGCATCCATGA AATGCCTGGGTACATGGTGGTA Nlrp3 ATTACCCGCCCGAGAAAGG TCGCAGCAAAGATCCACACAG iNOS GTTCTCAGCCCAACAATACAAGA GTGGACGGGTCGATGTCAC TNF-α CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG IL-4 GGTCTCAACCCCCAGCTAGT GCCGATGATCTCTCTCAAGTGAT

[0077] The results showed that the microglial inflammation-related indicators (Nlrp3, iNOS, TNF-a) after treatment with miR-101-3p antagonist were significantly decreased compared with the negative control group, while the related indicators of inflammation inhibition (IL-4) were significantly increased compared with the negative control group ( Fig.11 ). This suggests that miR-101-3p antagonists can reduce the pro-inflammatory damage of microglia and promote the expression of anti-inflammatory factors in microglia, thereby exerting a neuroprotective effect. This also suggests the potential of miR-101-3p antagonists as a drug for the treatment of neuroinflammation.

[0078] In summary, miR-101-3p antagonist can be used as a potential therapeutic drug to improve cognitive dysfunction after vascular cognitive dysfunction, reduce white matter demyelination damage, inhibit neuroinflammation, and promote the release of neuroprotective factors, thereby exerting a neuroprotective effect. This further suggests its possibility as a clinical therapeutic drug for vascular cognitive dysfunction.

[0079] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. Use of exosomal miR-101-3p as a biomarker in the preparation of a reagent or kit for predicting or evaluating symptoms related to vascular cognitive dysfunction, characterized in that: The exosomal miR-101-3p has a nucleotide sequence as shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The vascular cognitive dysfunction-related symptoms are the severity of vascular cognitive dysfunction or the severity of neuroinflammation after vascular cognitive dysfunction or the assessment of the degree of white matter damage after vascular cognitive dysfunction.

3. A miR-101-3p antagonist, characterized in that: The nucleotide sequence of the miR-101-3p antagonist is shown in SEQ ID NO:

2.

4. Use of the miR-101-3p antagonist according to claim 3 in the preparation of a medicine for improving vascular cognitive dysfunction and white matter damage.

5. Use of the miR-101-3p antagonist according to claim 3 in the preparation of a drug for alleviating neuroinflammation after vascular cognitive dysfunction.

6. A drug for improving vascular cognitive dysfunction and white matter damage, and relieving neuroinflammation after vascular cognitive dysfunction, characterized in that: The medicine comprises an effective amount of the miR-101-3p antagonist according to claim 3 and a pharmaceutically acceptable excipient.

7. The drug according to claim 7, characterized in that: The dosage form of the medicine is injection, and the auxiliary material is enzyme-free water.

8. The medicine according to claim 6 or 7, characterized in that: The content of the miR-101-3p antagonist is 0.2 nmol.

Images