Saccharomyces cerevisiae with effect of reducing nitrite and ammonia nitrogen and application of saccharomyces cerevisiae

Abstract

The invention discloses saccharomycetes with the effect of reducing nitrite and ammonia nitrogen and application of the saccharomycetes. The saccharomycetes are respectively named as Cyberlindnera jadinii A-1, and the preservation number of the saccharomycetes is GDMCC No: 64447. The invention further discloses a preparation method of the saccharomycetes. The saccharomycetes are high in adaptability, can effectively inhibit vibrio, grow well in high-ammonia-nitrogen and high-nitrite environments, are relatively high in nitrogen degradation efficiency, can be used as functional strains for improving water quality, deodorizing farms, deodorizing garbage yards and the like, can be applied to a plurality of places, effectively degrade harmful substances such as nitrite, ammonia nitrogen and the like in water bodies and environments, reduce nitrogen accumulation, protect the environment, and have a good application prospect. The method has great application potential in livestock and poultry aquaculture.

Description

Technical field:

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a yeast capable of reducing nitrite and ammonia nitrogen and application thereof. Background technology:

[0002] In recent years, with the continuous improvement of aquaculture level and the pursuit of higher economic benefits, the aquaculture density has been continuously increased, the nitrogen in the water body has exceeded the standard, and the excessive nitrogen source has been converted into toxic substances such as ammonia nitrogen and nitrite, which seriously endangers the safety of aquatic products and increases the risk of aquatic animal aquaculture. At present, the "Fishery Water Quality Standard" stipulates that in the process of aquaculture, the concentration of ammonia should be controlled below 0.2 mg / L, and the concentration of nitrite in aquaculture water should not exceed 0.2 mg / L. Therefore, effectively reducing the concentration of ammonia nitrogen and nitrite nitrogen in aquaculture water has become an urgent problem to be solved. Yeast has the advantages of being easy to culture, high protein content, and can synthesize bacterial protein using inorganic nitrogen sources such as ammonia nitrogen and nitrite nitrogen. Yeast can use various nutritional factors in water bodies, reduce the consumption of dissolved oxygen, help purify water bodies, and promote the growth and development of aquaculture bodies. The protein content of yeast is as high as 40% of the dry weight of cells, and it is easily digested by aquaculture bodies. At present, brewer's yeast and utilis have been included in the catalog of feed additives. Yeast is gradually gaining favor in the market due to its advantages such as being green, safe, non-toxic and pollution-free. Summary of the invention:

[0003] The first object of the present invention is to provide a Cyberlindnera jadinii A-1 with the ability to efficiently degrade nitrite and ammonia nitrogen, which provides a good biological material for improving water quality in aquaculture.

[0004] The Cyberlindnera jadinii A-1 was deposited in the Guangdong Microbiological Culture Collection Center (GDMCC) on March 25, 2024, with the address at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is GDMCC No: 64447.

[0005] The second object of the present invention is to provide the use of Cyberlindnerajadinii A-1 in removing odor in livestock and poultry farms.

[0006] Preferably, the method is used in reducing nitrite and removing ammonia nitrogen.

[0007] The third object of the present invention is to provide the use of Cyberlindnera jadinii A-1 in inhibiting Vibrio.

[0008] Preferably, the Vibrio is Vibrio harveyi or Vibrio alginolyticus.

[0009] The fourth object of the present invention is to provide a microbial agent for degrading nitrite, ammonia nitrogen and inhibiting Vibrio, which contains Cyberlindnera jadinii A-1 or its fermentation liquid as an active ingredient.

[0010] The fifth object of the present invention is to provide the use of the Cyberlindnerajadinii A-1 in the preparation of microbial agents or animal feed additives.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] (1) The Jardineseberlindnerella A-1 of the present invention has a strong ability to degrade nitrite.

[0013] (2) The Jedinseiberlindnerella A-1 of the present invention has a strong ability to degrade ammonia nitrogen.

[0014] (3) The Lindnerella jardiniseiberi A-1 of the present invention has an inhibitory effect on Vibrio.

[0015] (4) The Jardineseberlindnerella A-1 of the present invention has good acid resistance, bile salt resistance and salt resistance.

[0016] In summary, the Jadinseberlindner yeast A-1 of the present invention has a good degradation effect on nitrite and ammonia nitrogen in common aquaculture water bodies, can inhibit Vibrio, and is acid-resistant, salt-resistant, and bile-resistant, and has great application potential in livestock and poultry aquaculture.

[0017] Cyberlindnera jadinii A-1 was deposited on March 25, 2024 in the Guangdong Microbiological Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100, Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is GDMCC No.64447. Description of the drawings:

[0018] Figure 1 This is a photograph of the morphology of Lindnerella jedinii A-1.

[0019] Figure 2 This is the effect of yeast on nitrite degradation in the culture medium at different times.

[0020] Figure 3 This is the effect of yeast on ammonia nitrogen degradation in the culture medium at different times.

[0021] Figure 4 The tolerance of yeast to different pH values.

[0022] Figure 5 Tolerance of yeast to different bile salts.

[0023] Figure 6 The tolerance of yeast to different salt concentrations.

[0024] Figure 7 The antibacterial effect of yeast on Vibrio. Specific implementation method:

[0025] The specific embodiments of the present invention are further described in detail below in conjunction with the accompanying drawings and examples. The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. The parameters, proportions, etc. of the examples can be selected according to local conditions without substantial effect on the results. Unless otherwise specified, the methods described in the examples are all conventional methods, and the reagents used are all conventional reagents or reagents prepared in a conventional manner.

[0026] Example 1 Enrichment, culture, separation, purification and preservation of yeast strains

[0027] (1) Isolation, screening and preservation of yeast strains

[0028] The yeast strain of the present invention is separated from industrial waste water by the inventor.

[0029] Separation medium (PDA medium): 200 g potato (peeled), 20 g glucose, 14 g agar, add water to make up to 1000 mL, divide into 250 mL Erlenmeyer flasks, 100 mL per bottle; sterilize at 121°C for 20 min.

[0030] The sample was spread on a plate containing a separation medium by dilution and coating, and the yeast strain was purified. The yeast strain with the ability to degrade nitrite and ammonia nitrogen was screened, and the A-1 bacteria was obtained. The colony morphology of the Jardine Seberlindner yeast A-1 was observed by naked eyes. It was round, with neat edges, opaque, white on the front, convex in the middle, bright and smooth on the surface, moist in texture, and easy to pick up. Figure 1 .

[0031] Example 2 Molecular Biological Identification of Yeast

[0032] The DNA of strain A-1 was extracted using a yeast DNA kit. The forward primer ITS1 (5'-TCC GTA GGT GAACCT GCG G-3) and the reverse primer ITS4 (5'-TCC TCC GCT TAT TGA TAT GC-3') were used to amplify the ITS1 and ITS2 regions of the rDNA gene by polymerase chain reaction (PCR). The sequence was sent to Shanghai Meiji Biopharmaceutical Technology Co., Ltd. (Guangzhou Branch) for sequence sequencing, and the sequence is shown in SEQ ID NO.1. The sequencing results were submitted to the NCBI database, and BLAST was used for homology sequence retrieval to determine the taxonomic status of the target strain. Combined with morphological observation, the A-1 bacterial strain isolated in Example 1 of the present invention was preliminarily identified as Cyberlindnera jadinii A-1, which was deposited in the Guangdong Microbial Culture Collection Center (GDMCC) on March 25, 2024, with an address of 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is GDMCC No: 64447.

[0033] Example 3 Determination of the effect of yeast on degradation of nitrite and ammonia nitrogen

[0034] Culture medium 1 (1 L): glucose 0.5 g, sodium pyruvate 0.3 g, potassium dihydrogen phosphate 0.3 g, disodium hydrogen phosphate 0.2 g, sodium chloride 0.5 g, magnesium chloride 0.1 g, ammonium chloride 0.0535 g, NaNO2 0.025 g, water 1 L.

[0035] Trace element solution (1L): 0.64g disodium ethylenediaminetetraacetic acid, 0.55g ferrous sulfate, 0.23g zinc sulfate, 0.34g manganese sulfate, 0.075g copper sulfate, 0.55g calcium chloride, 0.025g ammonium molybdate, 1L water.

[0036] The culture medium 1 is sterilized by high pressure, and the trace element solution is added to the culture medium 1 at a volume ratio of 0.2% to obtain the final culture medium 2.

[0037] The activated Cyberlindnera jadinii A-1 was inoculated into the YPD medium and placed in a 30°C incubator for about 20 hours to obtain the seed solution. The seed solution was centrifuged and washed twice with water, then resuspended and added to the medium 2 at a volume ratio of 1%. After culturing for 2 and 3 days, samples were taken to monitor the changes in nitrite and ammonia nitrogen content. The positive control strains were GDM2.148, GDM2.176, GDM2.8, and GDM2.9. The method for determining the nitrite content was based on the spectrophotometric method for the determination of nitrite nitrogen in water quality of GB7493-1987, and the method for determining the ammonia nitrogen content was based on the spectrophotometric method for the determination of ammonia nitrogen in water quality of HJ535-2009.

[0038] from Figure 2 It can be seen that Cyberlindnera jadinii A-1 significantly degraded nitrite after 2 days of culture, with a degradation efficiency of 99.54%.

[0039] from Figure 3 It can be seen that Cyberlindnera jadinii A-1 has a significant effect on degrading ammonia nitrogen after culturing for 2 days, with a degradation efficiency of 90.48%.

[0040] Example 4 Analysis of tolerance of isolated yeast

[0041] The seed solution of Example 3 was inoculated into PDB liquid culture media with different pH values ​​(3.0, 4.0, 5.0, 6.0, 7.0) at an inoculum rate of 3% (V / V), and cultured at 30°C for 4 h. The OD600 nm value was measured by a spectrophotometer. Three replicates were measured and the average value was taken. The growth of yeast under different conditions was determined based on the OD600 nm value.

[0042] The seed liquid was inoculated into PDB liquid culture medium with different bile salt contents (mass fraction 0.3%, 0.4%, 0.5%, 0.6%) and different NaCl contents (mass fraction 3.0%, 5.0%, 7.0%, 9.0%) at an inoculum volume of 3% (V / V), and cultured at 30°C for 24 h. The OD600 nm value was determined by a spectrophotometer. Three parallel measurements were made and the average value was taken. The growth of yeast under different conditions was determined based on the OD600 nm value.

[0043] Depend on Figure 4 It can be seen that Cyberlindnera jadinii A-1 has the largest OD600 value at pH 7 and slightly decreases at pH 3, indicating that it has good tolerance to low pH values.

[0044] Depend on Figure 5 It can be seen that compared with the blank, Cyberlindnera jadinii A-1 has a higher OD600 value in a bile salt environment, and the OD600 value is the highest when the bile salt content is 0.6%, indicating that it has good high bile salt tolerance.

[0045] Depend on Figure 6 It can be seen that compared with the blank, the OD600 value of Cyberlindnera jadinii A-1 in a high-salt environment is lower, and as the sodium chloride content in the environment increases, the OD600 value gradually decreases, and it has good tolerance in a 3% high-salt environment.

[0046] Example 5 Analysis of antibacterial properties of isolated yeast

[0047] Preparation of test bacteria supernatant: The activated Cyberlindnera jadinii A-1 was inoculated into PDB culture medium and cultured in a 30°C incubator for about 24 hours; after the culture medium was centrifuged, the supernatant was taken and placed in 4°C for later use.

[0048] Preparation of bacterial plates: Culture the test strains GDM1.451 Vibrio alginolyticus and GDM1.781 Vibrio harveyi in two bacterial solutions respectively, then apply appropriate amount of bacterial solution to the corresponding plates, and use a hole puncher to evenly punch holes (hole diameter 9 mm) on the same plate.

[0049] Antibacterial test: About 100 μL of the supernatant after centrifugation of Cyberlindnera jadinii A-1 was added to each well of the plate containing the test pathogen, and the plate was incubated at 30°C for about 24 hours to observe the antibacterial effect (see the results). Figure 7 ), and the diameter of the inhibition zone was measured.

[0050] Depend on Figure 7 It can be seen that yeast A-1 has a significant inhibitory effect on Vibrio harveyi and Vibrio alginolyticus, with the diameters of the inhibition zones being 11.34 mm and 11.30 mm, respectively.

[0051] SEQ ID NO.1

[0052] GGCTCCACCAATACACAGTGTATTTTGCTTCTTTTGCTTTGGCTCTGCCAAAGGTTTTAAACACAGAAATTTATTTTCTCTAGAAACTAGTCAATTTGAATTTTAATCTTCAAAACTTT

[0053] CAACAACGGATCTCTTGGTTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTAA

[0054] TGTGAATTGCAGGTTTTCGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTCTGGCAT

[0055] TCCAGAGAGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAGATCCTCTAGGGGACTTGGT

[0056] ATTGAGTGATACTCTGTGTTAACTTGAAATACTCTAGGCAGAGCTCCCCCTAGAAATCCT

[0057] CTGGGCCGAAATAATGTATTAGGTTCTACCAACTCGTTATTTTCCAGACAGACTTCCAGG

[0058] CAGAGCTCGGCTGAACAACCTTTCTAAGCTTGACCTCAAATCAGGTAGGACT。

Claims

1. Cyberlindnera jadinii A-1, deposited with GDMCC No: 64447.

2. Use of Cyberlindnera jadinii A-1 according to claim 1 for removing odor in livestock and poultry farms.

3. Use of Cyberlindnera jadinii A-1 according to claim 1 in reducing nitrite and removing ammonia nitrogen.

4. Use of Cyberlindnera jadinii A-1 according to claim 1 in inhibiting Vibrio.

5. The use according to claim 4, characterized in that: The Vibrio is Vibrio harveyi or Vibrio alginolyticus.

6. A microbial agent for degrading nitrite, ammonia nitrogen and inhibiting Vibrio, characterized in that: The method comprises the Cyberlindnera jadinii A-1 or a fermentation liquid thereof as claimed in claim 1 as an active ingredient.

7. Use of Cyberlindnera jadinii A-1 according to claim 1 in the preparation of microbial agents or animal feed additives.

Images