Methods and compounds for modulating huntington's disease

Abstract

The present disclosure relates to transcription regulator molecules having a first end, a second end and an oligomeric backbone and methods for treating Huntington's disease.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Application No. 63 / 326,625 filed on April 1, 2022 and U.S. Application No. 63 / 482,670 filed on February 1, 2023, each of which is incorporated herein by reference in its entirety. Technical Field

[0003] Disclosed herein are novel chimeric heterocyclic polyamide compounds and compositions, and their use as pharmaceuticals for treating diseases. Also provided are methods for regulating the expression of a target gene comprising a CAG trinucleotide repeat sequence in an individual for treating diseases such as Huntington's disease ("HD"). Background Art

[0004] Huntington's disease ("HD") was first identified in the late 19th century as an autosomal dominant neurodegenerative disorder. Symptoms of HD include a range of motor, cognitive, and psychiatric symptoms that typically appear in adulthood. HD is associated with the presence of CAG trinucleotide repeats in the Htt gene, which encodes a protein called huntingtin. Subjects with greater than about 36 trinucleotide repeats typically exhibit HD symptoms, with a larger number of trinucleotide repeats associated with an earlier onset of symptoms. The pathology results from a cascade of steps: the production of poly-Q huntingtin followed by the fragmentation of the elongated huntingtin protein into smaller peptides that bind together and accumulate in neurons. This cascade is evident in the basal ganglia and cortex of the brain.

[0005] Huntington's disease syndrome refers to a group of diseases with symptoms similar to those of Huntington's disease, but lacking the characteristic mutation of the Htt gene. Huntington's disease 2 syndrome ("HDL2") is associated with a count of about 40 or more CAG trinucleotide repeats in the junctophilin 3 (Jph3) gene. HDL2 is a genetic disorder that has been seen in subjects with African ancestry. The age of onset is negatively correlated with the number of trinucleotide repeats. Symptoms of this syndrome include insufficiency and chorea (uncontrolled movements), mood disorders, dysphonia, bradykinesia, inability to integrate new learning, and difficulty making decisions. Life expectancy can range from a few years to more than a decade after diagnosis. Current theories believe that the poly Q protein encoded by the Jph3 gene forms aggregates in neuronal cells, thereby causing the pathology of the disease. However, evidence indicating that mRNA has acquired toxic functions has also been found, indicating that there may be a dual pathway for pathology.

[0006] In some embodiments, the above mechanisms provide opportunities for effectively treating diseases or conditions characterized by the presence of excessive CAG trinucleotide repeats in the target gene. In some embodiments, the pathology of the disease or condition is attributed to the presence of mRNA containing excessive CAG trinucleotide repeats. In some embodiments, the pathology of the disease or condition is attributed to the presence of translation products containing excessive glutamine amino acid residues. In some embodiments, the pathology of the disease or condition is attributed to the loss of function of the translation product. In some embodiments, the pathology of the disease or condition is attributed to the gain of function of the translation product. In some embodiments, the pathology of the disease or condition can be alleviated by increasing the transcription rate of the defective gene. In some embodiments, the pathology of the disease or condition can be alleviated by reducing the transcription rate of the defective gene. Summary of the invention

[0007] The present disclosure utilizes regulatory molecules present in the nucleus that control gene expression. Eukaryotic cells provide several mechanisms for controlling gene replication, transcription and / or translation. Regulatory molecules produced by various biochemical mechanisms within the cell can regulate the various processes involved in the conversion of genetic information into cellular components. Several regulatory molecules are known to regulate the production of mRNA, and if directed against a target gene (such as Htt), the production of target gene mRNA that causes diseases such as Huntington's disease or Huntington's disease-like syndrome will be regulated, and thus the progression of these diseases will be reversed.

[0008] Provided herein are compounds and methods for recruiting regulatory molecules to a target gene that is immediately adjacent to a CAG trinucleotide repeat sequence. The compounds disclosed herein contain: (a) a DNA binding portion that will selectively bind to a target gene, which is connected to (b) a recruitment portion that will bind to a regulatory molecule. Without being bound by theory, the compounds may counteract the expression of a defective target gene by:

[0009] (1) The DNA binding part can selectively bind to the characteristic CAG trinucleotide repeat sequence of the target gene;

[0010] (2) the recruitment moiety attached to the DNA binding moiety can thus be maintained in the vicinity of the target gene;

[0011] (3) The recruitment part adjacent to the target gene can recruit the regulatory molecule to the vicinity of the gene; and

[0012] (4) Regulatory molecules can regulate the expression of target genes by directly interacting with genes, thereby counteracting the expression of defective mRNA.

[0013] The DNA binding moiety can selectively bind to, for example, the characteristic CAG trinucleotide repeat sequence of Htt. The recruitment moiety attached to the DNA binding moiety will thereby remain in the vicinity of the target gene; the regulatory molecule will be recruited to the vicinity of the gene; and the regulatory molecule will modulate expression by directly interacting with the target gene and thus counteract the production of the defective target gene. This mechanism may provide an effective treatment for HD, which is caused by the expression of defective Htt, and therefore, correcting the expression of defective target genes represents an effective approach to treating these diseases.

[0014] The present disclosure also provides a DNA binding portion that selectively binds to one or more copies of a CAG trinucleotide repeat sequence that is unique to a defective target gene. Due to the high CAG count associated with a defective target gene, the DNA binding portion can selectively bind to the target gene, thereby directing the recruitment portion to the vicinity of the gene and recruiting the regulatory molecule to a location that regulates gene transcription.

[0015] The DNA binding portion comprises a polyamide segment that will selectively bind to the target CAG sequence. Polyamides designed by, for example, Dervan (U.S. Pat. Nos. 9,630,950 and 8,524,899) and others can selectively bind to selected DNA sequences. These polyamides are located in the minor groove of the double helix DNA and form hydrogen bonding interactions with Watson-Crick base pairs. Polyamides that selectively bind to specific DNA sequences can be designed according to existing chemical rules by connecting single amide building blocks. One building block is provided for each DNA base pair, wherein each building block non-covalently and selectively binds to one of the DNA base pairs: A / T, T / A, G / C, and C / G. According to this criterion, trinucleotides bind to molecules having three amide units (i.e., triamides). In general, these polyamides can be oriented in either direction of the DNA sequence.

[0016] In principle, a long DNA sequence can be targeted with higher specificity and / or higher affinity by combining a large number of monoamide building blocks into a longer polyamide chain. Ideally, the binding affinity of the polyamide would simply be equal to the sum of each individual monoamide / DNA base pair interaction. However, in practice, due to the geometric mismatch between the relatively rigid polyamide and DNA structures, the binding of a long polyamide sequence to a long DNA sequence is not as tight as expected by simple addition of the shares. The geometric mismatch between the long polyamide sequence and the long DNA sequence induces an unfavorable geometric strain, thereby reducing the originally expected binding affinity.

[0017] The present disclosure provides transcriptional regulator molecules comprising a DNA binding portion (e.g., a polyamide comprising a polyamine subunit) connected to a protein binding portion via a spacer (e.g., a linker portion or an oligomeric backbone). The spacer can alleviate geometric strain that would otherwise reduce the binding affinity of the larger polyamide sequence.

[0018] Disclosed herein are compounds comprising a polyamide moiety that can bind to one or more copies of a CAG trinucleotide repeat sequence and can modulate the expression of a target gene comprising a CAG trinucleotide repeat sequence. Treatment of a subject with these compounds will modulate the expression of a defective target gene, and this can reduce the appearance, severity, or frequency of symptoms associated with the disease. Certain compounds disclosed herein will provide higher binding affinity and selectivity than previously observed for such compounds.

[0019] It should be understood, however, that the detailed description and specific examples, while indicating specific embodiments, are given by way of illustration only, since various changes and modifications within the spirit and scope of the present disclosure will become apparent to those skilled in the art from this detailed description.

[0020] References incorporated

[0021] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. DETAILED DESCRIPTION

[0022] The present disclosure provides transcriptional regulator molecules comprising a DNA binding portion (e.g., a polyamide comprising polyamine subunits) connected to a protein binding portion via a spacer (e.g., a linker portion or an oligomeric backbone). The spacer can alleviate geometric strain that would otherwise reduce the binding affinity of the larger polyamide sequence.

[0023] Treatment with these compounds will then modulate the expression of defective target genes, and this can reduce the appearance, severity or frequency of symptoms associated with genetic diseases such as HD. The compounds described herein recruit regulatory molecules to modulate the expression of defective target genes and effectively treat and alleviate symptoms associated with the disease.

[0024] Compound

[0025] The compounds disclosed herein are transcriptional regulator molecules. They have useful activity for regulating the transcription of target genes (e.g., Htt) containing one or more CAG repeat sequences, and can be used to treat or prevent diseases or conditions in which the target gene plays an effective role. Therefore, in a broad aspect, some embodiments also provide pharmaceutical compositions comprising one or more compounds disclosed herein and a pharmaceutically acceptable carrier, as well as methods for preparing and using the compounds and compositions.

[0026] In one aspect, provided herein is a transcriptional regulator molecule having a first end, a second end, and a linker portion, wherein:

[0027] (a) the first end comprises a DNA binding portion, and the DNA binding portion is capable of binding to a nucleotide repeat sequence comprising CAG;

[0028] (b) the second end comprises a protein binding portion, the protein binding portion is capable of binding to a regulatory molecule, the regulatory molecule regulates the expression of a gene having the nucleotide repeat sequence; and

[0029] (c) the oligomeric backbone connects the first end and the second end.

[0030] First end - DNA binding part

[0031] The first end interacts and binds to the gene, in particular to the minor groove having the CAG sequence. On the one hand, the molecules disclosed herein provide a polyamide sequence to interact with each base pair of a single polyamide subunit with a CAG repeat sequence. In some embodiments, the molecule provides a turn component (e.g., an aliphatic amino acid portion) to enable the molecule to bind to a hairpin with CAG, wherein each nucleotide pair interacts with two subunits of the polyamide. In some embodiments, one or more polyamide backbone carbonyl groups (C=O) are replaced by oxetane. In some embodiments, at least one polyamide backbone carbonyl group is replaced by oxetane.

[0032] In some embodiments, each subunit comprises a moiety independently selected from a heterocycle and an aliphatic chain.

[0033] In some embodiments, the aliphatic chain is C 1- C 6 In some embodiments, the aliphatic chain has the structural formula -(CH 2 ) m -, wherein m is selected from 1, 2, 3, 4 and 5. In some embodiments, the aliphatic chain is -CH 2 CH 2 -.

[0034] In some embodiments, the heterocycle is a monocyclic heterocycle. In some embodiments, the heterocycle is a monocyclic 5-membered heterocycle. In some embodiments, each heterocycle contains a heteroatom independently selected from N, O, or S. In some embodiments, each heterocycle is independently selected from pyrrole, imidazole, thiazole, oxazole, thiophene, and furan.

[0035] In some embodiments, the DNA binding moiety comprises -NH-QC(O)-, wherein Q is an optionally substituted C 6 -C 10 arylene, an optionally substituted 4- to 10-membered heterocyclylene, an optionally substituted 5- to 10-membered heteroarylene, or an optionally substituted alkylene.

[0036] In some embodiments, the DNA binding portion comprises at least three selected aromatic carboxamide moieties corresponding to the nucleotide repeat sequence CAG, and at least one aliphatic amino acid residue selected from the group consisting of: glycine, β-alanine, γ-aminobutyric acid, 2,4-diaminobutyric acid, and 5-aminopentanoic acid. In some embodiments, the DNA binding portion comprises one or more subunits selected from the group consisting of: optionally substituted N-methylpyrrole, optionally substituted N-methylimidazole, β-alanine (β), and γ-aminobutyric acid. In some embodiments, the DNA binding portion comprises at least one γ-aminobutyric acid.

[0037] In some embodiments, the DNA binding moiety comprises a polyamide having one or more subunits selected from:

[0038]

[0039]

[0040] -NH-benzopyrazinylene-C(O)-, -NH-phenylene-C(O)-, -NH-pyridinylene-C(O)-, -NH-piperidinylene-C(O)-, -NH-pyrimidinylene-C(O)-, -NH-anthracenylene-C(O)-, -NH-quinolinylene-C(O)-, and wherein each R' is independently hydrogen, optionally substituted C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Heteroalkyl, optionally substituted C 1 -C 20 haloalkyl or optionally substituted C 1 -C 20 Alkylamino; and Z is H, NH 2 , C 1 -C 6 Alkyl, C1 -C 6 Haloalkyl or C 1 -C 6 Alkyl-NH 2 .

[0041] In some embodiments, the first terminus is a DNA binding moiety comprising a structure of formula (A-1):

[0042]

[0043] or a pharmaceutically acceptable salt thereof, wherein:

[0044] Z 1 absent, or -O- or -NH-;

[0045] Each X 1 , X 2 , X 3 , X 4 , X 5 , X 6 , X 7 and X 8 are independently O, S or NR 2 ;

[0046] Each Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , Y 6 , Y 7 and Y 8 are independently CH or N;

[0047] W 1 is deuterium, hydrogen, optionally substituted C 1 -C 6 Alkyl, (nitro)methylenediamine, (nitro)-N,N,N',N'-tetramethylmethylenediamine, -C(O)-NR 1A R 1B 、-NR 1A -C(O)-NR 1A R 1B , -Z B -P(O)(OR 1A ) 2 , -Z B -(CH 2 ) p3 -PO(OR 1A ) 2 , -Z B -(CH 2 ) p3 -OP(O)(OR 1A) 2 ,in

[0048] Z B is -N- or -O-;

[0049] p 3 is an integer from 1 to 10;

[0050] W 2 is an optionally substituted C 1 -C 6 Alkyl or -C(O)-NR 1A R 1B ;

[0051] Each R 1 are independently hydrogen, deuterium, halogen, amino, cyano, optional C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Heteroalkyl or -NC(O)R 1A ;or

[0052] Two R on the same atom or adjacent atoms 1 and the atoms to which they are attached are combined to form an optionally substituted 3- to 6-membered carbocyclic ring or an optionally substituted 3- to 6-membered heterocyclic ring;

[0053] Each R 2 are independently hydrogen, deuterium, optionally substituted C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Heteroalkyl, optionally substituted C 1 -C 20 haloalkyl or optionally substituted C 1 -C 20 Alkylamino;

[0054] Each R 1A are independently hydrogen, deuterium or optionally substituted C 1 -C 20 alkyl;

[0055] Each R 1B are independently hydrogen, deuterium, optionally substituted C 1 -C 20 Alkyl, optionally substituted C 2 -C 10 heteroalkyl, optionally substituted 5-membered heteroaryl, or (AA) p2 ,in

[0056] Each AA is an amino acid;

[0057] p2 is an integer from 1 to 10;

[0058] j 1 is 0 or 1;

[0059] n 0 is 1 or 0;

[0060] m 1 and n 1 Each independently is an integer from 0 to 3;

[0061] p 1 is 2 or 3, provided that when Z 1 When it is -O- or -NH-, p 1 is 2, and when Z 1 When it does not exist, p 1 is 3; and

[0062] Where W 1 or W 2 One of them is connected to the oligomeric backbone.

[0063] In some embodiments, n 0 Yes 1.

[0064] In some embodiments, the first terminus is a DNA binding moiety comprising a structure of formula (A-2):

[0065]

[0066] or a pharmaceutically acceptable salt thereof, wherein:

[0067] Z 1 absent, or -O- or -NH-;

[0068] Each X 1 , X 2 , X 3 , X 4 , X 5 , X 6 , X 7 and X 8 are independently O, S or NR 2 ;

[0069] Each Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , Y 6 , Y 7 and Y 8 are independently CH or N;

[0070] W 1is deuterium, hydrogen, optionally substituted C 1 -C 6 Alkyl, (nitro)methylenediamine, (nitro)-N,N,N',N'-tetramethylmethylenediamine, -C(O)-NR 1A R 1B 、-NR 1A -C(O)-NR 1A R 1B , -Z B -P(O)(OR 1A ) 2 , -Z B -(CH 2 ) p3 -P(O)(OR 1A ) 2 , -Z B -(CH 2 ) p3 -OP(O)(OR 1A ) 2 ,in

[0071] Z B is -N- or -O-;

[0072] p 3 is an integer from 1 to 10;

[0073] W 2 is an optionally substituted C 1 -C 6 Alkyl or -C(O)-NR 1A R 1B ;

[0074] Each R 1 are independently hydrogen, deuterium, halogen, amino, cyano, optional C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Heteroalkyl or -NC(O)R 1A ;or

[0075] Two R on the same atom or adjacent atoms 1 and the atoms to which they are attached are combined to form an optionally substituted 3- to 6-membered carbocyclic ring or an optionally substituted 3- to 6-membered heterocyclic ring;

[0076] Each R 2 are independently hydrogen, deuterium, optionally substituted C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Heteroalkyl, optionally substituted C 1 -C20 haloalkyl or optionally substituted C 1 -C 20 Alkylamino;

[0077] Each R 1A are independently hydrogen, deuterium or optionally substituted C 1 -C 20 alkyl;

[0078] Each R 1B are independently hydrogen, deuterium, optionally substituted C 1 -C 20 Alkyl, optionally substituted C 2 -C 10 heteroalkyl, optionally substituted 5-membered heteroaryl, or (AA) p2 ,in

[0079] Each AA is an amino acid;

[0080] p 2 is an integer from 1 to 10;

[0081] j 1 is 0 or 1;

[0082] m 1 and n 1 Each independently is an integer from 0 to 3;

[0083] p 1 is 2 or 3, provided that when Z 1 When it is -O- or -NH-, p 1 is 2, and when Z 1 When it does not exist, p 1 is 3; and

[0084] Where W 1 or W 2 One of them is connected to the oligomeric backbone.

[0085] In some embodiments, n 0 It is 0.

[0086] In some embodiments, the DNA binding moiety comprises a structure of formula (A-3) or a pharmaceutically acceptable salt thereof:

[0087]

[0088] or a pharmaceutically acceptable salt thereof, wherein:

[0089] Z 1 absent, or -O- or -NH-;

[0090] Each X 1 , X2 , X 3 , X 4 , X 5 , X 6 , X 7 and X 8 are independently O, S or NR 2 ;

[0091] Each Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , Y 6 , Y 7 and Y 8 are independently CH or N;

[0092] W 1 is deuterium, hydrogen, optionally substituted C 1 -C 6 Alkyl, (nitro)methylenediamine, (nitro)-N,N,N',N'-tetramethylmethylenediamine, -C(O)-NR 1A R 1B 、-NR 1A -C(O)-NR 1A R 1B , -Z B -P(O)(OR 1A ) 2 , -Z B -(CH 2 ) p3 -P(O)(OR 1A ) 2 , -Z B -(CH 2 ) p3 -OP(O)(OR 1A ) 2 ,in

[0093] Z B is -N- or -O-;

[0094] p 3 is an integer from 1 to 10;

[0095] W 2 is an optionally substituted C 1 -C 6 Alkyl or -C(O)-NR 1A R 1B ;

[0096] Each R 1 are independently hydrogen, deuterium, halogen, amino, cyano, optional C 1 -C20 Alkyl, optionally substituted C 1 -C 20 Heteroalkyl or -NC(O)R 1A ;or

[0097] Two R on the same atom or adjacent atoms 1 and the atoms to which they are attached are combined to form an optionally substituted 3- to 6-membered carbocyclic ring or an optionally substituted 3- to 6-membered heterocyclic ring;

[0098] Each R 2 are independently hydrogen, deuterium, optionally substituted C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Heteroalkyl, optionally substituted C 1 -C 20 haloalkyl or optionally substituted C 1 -C 20 Alkylamino;

[0099] Each R 1A are independently hydrogen, deuterium or optionally substituted C 1 -C 20 alkyl;

[0100] Each R 1B are independently hydrogen, deuterium, an optionally substituted 5-membered heteroaryl, an optionally substituted C 1 -C 20 Alkyl, optionally substituted C 2 -C 10 Heteroalkyl or (AA) p2 ,in

[0101] Each AA is an amino acid;

[0102] p 2 is an integer from 1 to 10;

[0103] j 1 is 0 or 1;

[0104] m 1 is an integer from 0 to 3;

[0105] p 1 is 2 or 3, provided that when Z 1 When it is -O- or -NH-, p 1 is 2; and when Z 1 When it does not exist, p 1 is 3; and

[0106] Where W 1 or W 2 One of them is connected to the oligomeric backbone.

[0107] In some embodiments, Z 1 In some embodiments, Z 1 It is -O- or -NH-.

[0108] In some embodiments, W 2 Yes-C(O)NR 1A R 1B , where W 2 Attached to the oligomeric backbone. In some embodiments, R 1A is hydrogen and R 1B is AA, wherein AA is β-alanine. In some embodiments, W 2 is -C(O)NH-(β-alanine)-. In some embodiments, W 2 Yes-C(O)NR 1A R 1B , where R 1A is hydrogen and R 1B is an alkyl group optionally substituted with an oxo group (=O). In some embodiments, W 2 It is -C(O)NH(CH 2 ) 2 C(O)-. In some embodiments, W 2 It is -C(O)NH-.

[0109] In some embodiments, the DNA binding moiety is expressed via W 2 In some embodiments, the oligomeric backbone is a linker moiety. In some embodiments, the DNA binding moiety is not linked to the oligomeric backbone. 2 Attached to the oligomeric backbone. In some embodiments, W 2 It is -C(O)NH(CH 2 ) 2 C(O)-**, wherein the linker moiety is attached at **. In some embodiments, W 2 It is -C(O)O(CH 2 ) 2 C(O)-**, wherein the linker moiety is attached at **. In some embodiments, W 2 is -C(O)-NH-**, wherein the linker moiety is attached at **. In some embodiments, W 2 is -C(O)OH-**, wherein the linker moiety is attached at **. In some embodiments, W 2 is -C(O)-**, wherein the linker moiety is attached at **.

[0110] In some embodiments, the DNA binding moiety comprises a structure of formula (A-4) or a pharmaceutically acceptable salt thereof:

[0111]

[0112] In some embodiments, each R 1 are independently halogen, amino, cyano, optionally C 1 -C 20 Alkyl or optionally substituted C 1 -C 20 In some embodiments, R 1 It is C 1 -C 20 Alkyl or C 1 -C 20 In some embodiments, each R 1 independently -NHC(O)R 1A , where R 1A is alkyl, aryl or heteroaryl. In some embodiments, each R 1 Independently -NH 2 、-NHCH 3 or -NHC(O)CH(CH 3 ) 3 In some embodiments, each R 1 It's hydrogen.

[0113] In some embodiments, two R on the same atom or adjacent atoms 1 The atoms to which they are attached are combined to form an optionally substituted 3 to 6-membered carbocyclic or 3 to 6-membered heterocyclic ring. In some embodiments, two R on the same carbon atom 1 are combined to form an optionally substituted 3 to 6-membered carbocyclic or 3 to 6-membered heterocyclic ring. In some embodiments, two R on the same carbon atom 1 are combined to form an optionally substituted 3 to 6 membered carbocyclic ring. In some embodiments, the carbocyclic ring is a cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl ring. In some embodiments, two R on the same carbon atom are 1 are combined together to form an optionally substituted 3 to 6 membered heterocyclic ring optionally containing 1 to 2 heteroatoms selected from N, O or S. In some embodiments, the heterocyclic ring is oxetane, tetrahydrofuran or tetrahydro-2H-pyran.

[0114] In some embodiments, two R 1 The atoms to which they are attached are combined to form an optionally substituted 3 to 6-membered carbocyclic or 3 to 6-membered heterocyclic ring. In some embodiments, two R on adjacent atoms 1 The atoms to which they are attached are combined to form an optionally substituted 3 to 6 membered carbocyclic ring. 1The atoms to which they are attached are combined to form an optionally substituted 3 to 6 membered heterocyclic ring. In some embodiments, cyclization occurs between the α and β carbon atoms or between the β and δ carbon atoms.

[0115] In some embodiments, the DNA binding moiety comprises a structure of formula (A-5):

[0116]

[0117] or a pharmaceutically acceptable salt thereof, wherein:

[0118] Ring A' is an optionally substituted C 3 -C 6 carbocyclic or optionally substituted 3- to 6-membered heterocyclic ring.

[0119] In some embodiments, the DNA binding moiety comprises a structure of formula (A-6) or a pharmaceutically acceptable salt thereof:

[0120]

[0121] In some embodiments, the DNA binding moiety comprises a structure of formula (A-7) or a pharmaceutically acceptable salt thereof:

[0122]

[0123] In some embodiments, Y 2 , Y 4 and Y 7 are each independently N; and Y 1 and Y 3 Each is independently CH.

[0124] In some embodiments, Y 6 is CH. In some embodiments, Y 6 It is N.

[0125] In some embodiments, X 1 , X 2 , X 3 , X 4 , X 5 , X 6 and X 7 Each independently is -NR 2 .

[0126] In some embodiments, the DNA binding moiety comprises a structure of formula (A-8):

[0127]

[0128] or a pharmaceutically acceptable salt thereof, wherein:

[0129] Y8 is CH or N; and

[0130] R 2A , R 2B , R 2C , R 2D , R 2E , R 2F and R 2G are each independently hydrogen, deuterium, optionally substituted C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Heteroalkyl, optionally substituted C 1 -C 20 haloalkyl or optionally substituted C 1 -C 20 Alkylamino.

[0131] In some embodiments, the DNA binding moiety comprises a structure of formula (A-9):

[0132]

[0133] or a pharmaceutically acceptable salt thereof, wherein:

[0134] Y 8 is CH or N; and

[0135] R 2A , R 2B , R 2D , R 2E , R 2F and R 2G are each independently hydrogen, deuterium, optionally substituted C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Heteroalkyl, optionally substituted C 1 -C 20 haloalkyl or optionally substituted C 1 -C 20 Alkylamino.

[0136] In some embodiments, the DNA binding moiety comprises a structure of formula (A-10):

[0137]

[0138] or a pharmaceutically acceptable salt thereof, wherein:

[0139] Y 8 is CH or N; and

[0140] R 2A , R2B , R 2C , R 2D , R 2E , R 2F and R 2G are each independently hydrogen, deuterium, optionally substituted C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Heteroalkyl, optionally substituted C 1 -C 20 haloalkyl or optionally substituted C 1 -C 20 Alkylamino.

[0141] In some embodiments, Y 8 is N. In some embodiments, Y 8 It is CH.

[0142] In some embodiments, R 2A , R 2B , R 2C , R 2D , R 2E , R 2F and R 2G are each independently hydrogen, deuterium, optionally substituted C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 haloalkyl or optionally substituted C 1 -C 20 Heteroalkyl.

[0143] In some embodiments, R 2A , R 2B , R 2C , R 2D , R 2E , R 2F and R 2G are each independently an optionally substituted C 1 -C 20 In some embodiments, R 2A , R 2B , R 2C , R 2D , R 2E , R 2F and R 2G Each independently is a straight chain or a branched chain C 1 -C 20 In some embodiments, R 2A , R 2B , R 2C , R 2D , R2E , R 2F and R 2G Each is independently an optionally substituted methyl, ethyl, isopropyl, n-butyl, isobutyl, sec-butyl or tert-butyl. 2A , R 2B , R 2C , R 2D , R 2E , R 2F and R 2G Each is independently methyl, ethyl or tert-butyl.

[0144] In some embodiments, the DNA binding moiety comprises a structure of formula (A-11) or a salt thereof:

[0145]

[0146] In some embodiments, the DNA binding moiety comprises a structure of formula (A-12) or a salt thereof:

[0147]

[0148] In some embodiments, the DNA binding moiety comprises a structure of formula (A-13) or a salt thereof:

[0149]

[0150] In some embodiments, W 1 Yes-C(O)-NR 1A R 1B or -NR 1A -C(O)-NR 1A R 1B .

[0151] In some embodiments, W 1 It's hydrogen.

[0152] In some embodiments, W 1 Yes-Z B -P(O)(OR 1A ) 2 , -Z B -(CH 2 ) p3 -P(O)(OR 1A ) 2 , -Z B -(CH 2 ) p3 -OP(O) 2 (OR 1A ) 2 , where Z B is O or N, and p 3is an integer from 1 to 10.

[0153] In some embodiments, W 1 is (nitro)methanediamine or (nitro)-N,N,N',N'-tetramethylmethanediamine. In some embodiments, W 1 yes In some embodiments, W 1 yes

[0154] In some embodiments, the DNA binding moiety is expressed via W 1 In some embodiments, the oligomeric backbone is a linker moiety. In some embodiments, the DNA binding moiety is not linked to the oligomeric backbone. 1 Attached to the oligomeric backbone.

[0155] In some embodiments, m 1 is 0. In some embodiments, m 1 is 1. In some embodiments, m 1 is 2. In some embodiments, m 1 Serves 3.

[0156] In some embodiments, p 1 is 2. In some embodiments, p 1 Serves 3.

[0157] In some embodiments, m 1 is 0 or 1 and p 1 Serves 2.

[0158] In some embodiments, n 1 is 0. In some embodiments, n 1 is 1. In some embodiments, n 1 is 2. In some embodiments, n 1 Serves 3.

[0159] In some embodiments, 1 is 0. In some embodiments, j 1 Yes 1.

[0160] The binding affinity between polyamide and target gene can be adjusted based on the composition of polyamide. In some embodiments, polyamide can bind DNA with an affinity of less than about 600nM, about 500nM, about 400nM, about 300nM, about 250nM, about 200nM, about 150nM, about 100nM or about 50nM. In some embodiments, polyamide can bind DNA with an affinity of less than about 300nM. In some embodiments, polyamide can bind DNA with an affinity of less than about 200nM. In some embodiments, polyamide can bind DNA with an affinity greater than about 200nM, about 150nM, about 100nM, about 50nM, about 10nM or about 1nM. In some embodiments, polyamide can bind DNA with an affinity within the range of about 1-600nM, 10-500nM, 20-500nM, 50-400nM or 100-300nM.

[0161] In some embodiments, the first end is capable of binding DNA with an affinity of less than 500 nM.

[0162] The binding affinity between polyamide and target DNA can be determined using a quantitative footprint titration experiment. The experiment involves measuring the dissociation constant, K, of the polyamide for the target sequence at 24°C or 37°C. d , and using standard polyamide assay solution conditions or approximating intracellular solution conditions.

[0163] The binding affinity between the regulatory protein and the ligand at the second terminus can be determined using an assay appropriate for the particular protein. The assay involves measuring the dissociation constant, K, of the ligand for the protein. d , and use of standard protein assay solution conditions or approximate intracellular solution conditions.

[0164] The first terminal DNA binding portion in the molecules described herein has a high binding affinity to a sequence with multiple CAG repeats, and preferentially binds to a target nucleotide repeat relative to other nucleotide repeats or other nucleotide sequences. In some embodiments, the first terminal has a higher binding affinity to a sequence with multiple CAG repeats than a sequence with CGG repeats. In some embodiments, the first terminal has a higher binding affinity to a sequence with multiple CAG repeats than a sequence with CCG repeats. In some embodiments, the first terminal has a higher binding affinity to a sequence with multiple CAG repeats than a sequence with CCTG repeats. In some embodiments, the first terminal has a higher binding affinity to a sequence with multiple CAG repeats than a sequence with TGGAA repeats. In some embodiments, the first terminal has a higher binding affinity to a sequence with multiple CAG repeats than a sequence with GGGGCC repeats. In some embodiments, the first terminal has a higher binding affinity to a sequence with multiple CAGCTG repeats than a sequence with GAA repeats.

[0165] Since the first end preferentially binds to the target nucleotide repeat sequence, the transcriptional regulator molecules described herein are positioned around the region with multiple CAG repeat sequences. In some embodiments, the local concentration of the first end of the molecule described herein is higher near the sequence with multiple CAG repeat sequences than near the sequence with CGG repeat sequences. In some embodiments, the local concentration of the first end of the molecule described herein is higher near the sequence with multiple CAG repeat sequences than near the sequence with CCG repeat sequences. In some embodiments, the local concentration of the first end of the molecule described herein is higher near the sequence with multiple CAG repeat sequences than near the sequence with CCTG repeat sequences. In some embodiments, the local concentration of the first end of the molecule described herein is higher near the sequence with multiple CAG repeat sequences than near the sequence with TGGAA repeat sequences. In some embodiments, the local concentration of the first end of the molecule described herein or the molecule is higher near the sequence with multiple CAG repeat sequences than near the sequence with GGGGCC repeat sequences. In some embodiments, the local concentration of the first end of the molecule described herein is higher near the sequence with multiple CAG repeat sequences than near the sequence with GAA repeat sequences.

[0166] The first terminal DNA binding portion in the molecule described herein is positioned at a sequence having multiple CAG repeats, and preferentially binds to a target nucleotide repeat relative to other nucleotide repeats. In some embodiments, the sequence has at least 2, 3, 4, 5, 8, 10, 12, 15, 20, 25, 30, 40, 50, 100, 200, 300, 400 or 500 CAG repeats. In some embodiments, the sequence comprises at least 1000 nucleotide repeats of CAG. In certain embodiments, the sequence comprises at least 500 nucleotide repeats of CAG. In certain embodiments, the sequence comprises at least 200 nucleotide repeats of CAG. In some embodiments, the sequence comprises at least 100 nucleotide repeats of CAG. In some embodiments, the sequence comprises at least 50 nucleotide repeats of CAG. In some embodiments, the sequence comprises at least 20 nucleotide repeats of CAG.

[0167] Polyamides composed of pre-selected subunit combinations can selectively bind to DNA in the minor groove. In their hairpin structure, antiparallel side-by-side pairs of two aromatic amino acids bind to the DNA sequence, with the polyamide rings stacked specifically for each DNA base. N-methylpyrrole (Py) prefers T, A, and C bases to the exclusion of G; N-methylimidazole (Im) is a G reader; and 3-hydroxy-N-methylpyrrole (Hp) is specific for thymine bases. Nucleotide base pairs can be identified using the pairing principles shown in Tables 1A and 1B below, using different amino acid subunit pairs. For example, based on symmetry, the Im / Py pair reads G·C, the Py / Im pair reads C·G, the Hp / Py pair can distinguish T·A from A·T, G·C, and C·G, while the Py / Py pair non-specifically distinguishes A·T and T·A from G·C and C·G.

[0168] In some embodiments, the first terminus comprises Im corresponding to nucleotide G; Im or Nt corresponding to nucleotide pair G; Py corresponding to nucleotide C, wherein Im is N-alkylimidazole, Py is N-alkylpyrrole, Hp is 3-hydroxyN-methylpyrrole and β-alanine. In some embodiments, the first terminus comprises Im / Py corresponding to nucleotide pair G / C, Py / Im corresponding to nucleotide pair C / G, wherein Im is N-alkylimidazole (e.g., N-methylimidazole), Py is N-alkylpyrrole (e.g., N-methylpyrrole), and Hp is 3-hydroxyN-methylpyrrole.

[0169] Table 1A. Base pairing of single amino acid subunits (favorable (+), unfavorable (-)).

[0170]

[0171]

[0172]

[0173]

[0174] * Subunits HpBi, ImBi and PyBi act as conjugates of two monomeric subunits and bind to two nucleotides. The binding properties of HpBi, ImBi and PyBi correspond to Hp-Py, Im-Py and Py-Py, respectively.

[0175] Table 1B. Representative base pairings for hairpin polyamides.

[0176]

[0177]

[0178]

[0179] The monomer subunits of the polyamide can be linked together in series based on the pairing principle shown in Table 1A and Table 1 B. The monomer subunits of the polyamide can be linked together in series based on the pairing principle shown in Table 1C.

[0180] Table 1C shows examples of monomer subunits that can bind to specific nucleotides. The first end can include a polyamide described as having several monomer subunits linked together, where the monomer subunits are selected from each row. For example, the polyamide can include Py-Py-Im that binds to CAG, where Py is selected from column C, Py is selected from column A, and Im is selected from the first G column. The polyamide can be any combination of subunits with CAGCAG, where the subunits are selected from each column in Table 1C, where the subunits are linked together following the CAG binding order.

[0181] Additionally, the polyamide may also include fractions or multiples of five subunits, such as 1.5, 2, 2.5, 3, 3.5 or 4 sets of three subunits. The polyamide may include 3, 4, 5, 6, 7, 8, 9, 10, 12, 14 and 16 monomer subunits.

[0182] The polyamide may include monomeric subunits of 2, 3, 4, or 5 nucleotides bound to CAG. For example, the polyamide may be bound to CA, CAG, AGC, CAGC, CAGCA, CAGCAG. The polyamide may include monomeric subunits of 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides bound to the CAG repeat sequence.

[0183] When positioned as a terminal unit, the monomer subunit does not have an amine, carbonyl or carboxylic acid group at the end. The carboxylic acid group in the end is replaced by hydrogen. For example, Py is understood to have the following structure when used as a terminal unit: (For example, ); and Im, when positioned as a terminal unit, should be understood to have the following structure: (For example, ).

[0184] Table 1C. Examples of monomer subunits conjugated to CAG in linear polyamides.

[0185]

[0186]

[0187] Recognition of nucleotide repeats or DNA sequences by two antiparallel polyamide chains depends on the code of side-by-side aromatic amino acid pairs in the minor groove, usually oriented N to C relative to the 5' to 3' direction of the DNA helix. Enhanced affinity and specificity of polyamide nucleotide binding is achieved by covalently linking the antiparallel chains. A "hairpin motif" connects the N- and C-termini of the two chains through a γ-aminobutyric acid unit (γ-turn) to form a folded linear chain. An "H-pin motif" connects the antiparallel chains through a short flexible bridge across the central or near-central loop / loop pair.

[0188] Second terminus - regulatory protein binding portion

[0189] In some embodiments, the second end comprises a protein binding moiety capable of binding to a regulatory molecule that regulates expression of a gene having an expanded nucleotide repeat sequence.

[0190] In some embodiments, the second terminus comprises a bromodomain binding moiety.

[0191] In some embodiments, the second terminus comprises a moiety capable of binding to a bromodomain and beyond-terminal domain (BET) family member.

[0192] In some embodiments, the BET family member is BRD2, BRD3, BRD4, or BRDT. In some embodiments, the BET family member is BRD2. In some embodiments, the BET family member is BRD3. In some embodiments, the BET family member is BRD4. In some embodiments, the BET family member is BRD3. In some embodiments, the BET family member is BRDT.

[0193] In some embodiments, the bromodomain is CBP / p300, PCAF (P300 / CBP-associated factor), CECR2 (cat eye syndrome chromosomal region candidate gene 2), BRPF (bromodomain-containing and PHD finger protein), ATAD2 / ATAD2B (chromatin remodeling protein), TRIM24 (triplet-containing motif protein 24), BAZ2 (bromodomain adjacent to zinc finger), or TAF1 (TBP-associated factor).

[0194] In some embodiments, the bromodomain is CBP / p300.

[0195] In some embodiments, the bromodomain is PCAF (P300 / CBP-associated factor).

[0196] In some embodiments, the bromodomain is CECR2 (cat eye syndrome chromosomal region candidate gene 2).

[0197] In some embodiments, the bromodomain is a BRPF (bromodomain- and PHD finger-containing protein).

[0198] In some embodiments, the bromodomain is an ATAD2 or ATAD2B chromatin remodeling protein.

[0199] In some embodiments, the bromodomain is BAZ2 (bromodomain adjacent to zinc finger).

[0200] In some embodiments, the bromodomain is TAF1 (TBP-associated factor).

[0201] In some embodiments, the bromodomain is TRIM24 (triplet-containing motif-containing protein 24).

[0202] In some embodiments, the regulatory molecule modulates the rearrangement of histones.

[0203] In some embodiments, the regulatory molecule modulates the glycosylation, phosphorylation, alkylation, or acylation of a histone.

[0204] In some embodiments, the regulatory molecule is a transcription factor.

[0205] In some embodiments, the regulatory molecule is an RNA polymerase.

[0206] In some embodiments, the regulatory molecule is a moiety that regulates RNA polymerase activity.

[0207] In some embodiments, the recruitment moiety binds to the regulatory molecule but does not inhibit the activity of the regulatory molecule. In some embodiments, the recruitment moiety binds to the regulatory molecule and inhibits the activity of the regulatory molecule. In some embodiments, the recruitment moiety binds to the regulatory molecule and increases the activity of the regulatory molecule.

[0208] In some embodiments, the recruitment moiety binds to the active site of the regulatory molecule. In certain embodiments, the recruitment moiety binds to the regulatory site of the regulatory molecule.

[0209] The binding affinity between the regulatory protein and the second end can be adjusted based on the composition of the molecule or the type of protein. In some embodiments, the second end binds to the regulatory molecule with an affinity of less than about 600nM, about 500nM, about 400nM, about 300nM, about 250nM, about 200nM, about 150nM, about 100nM, or about 50nM. In some embodiments, the second end binds to the regulatory molecule with an affinity of less than about 300nM. In some embodiments, the second end binds to the regulatory molecule with an affinity of less than about 200nM.

[0210] In some embodiments, the second terminus comprises a diazine or diazepine ring, wherein the diazine or diazepine ring is adjacent to C 6 -C 10 The second terminus is fused to an aryl or 5- to 10-membered heteroaryl ring comprising one or more heteroatoms selected from S, N and O. In some embodiments, the second terminus comprises an optionally substituted bicyclic or tricyclic structure.

[0211] In some embodiments, the second terminal has a triazolodiazepine structure. In some embodiments, the second terminal has a thiazolodiazepine structure.

[0212] In some embodiments, the second terminus comprises a structure of formula (2-A):

[0213]

[0214] or a pharmaceutically acceptable salt thereof, wherein:

[0215] Ring A is optionally substituted aryl or optionally substituted 5- to 6-membered heteroaryl;

[0216] Ring B is absent or is an optionally substituted 6-membered monocyclic aryl or heteroaryl group;

[0217] D is C or N;

[0218] E is O or N;

[0219] Y A is -NH- or -O-;

[0220] R 5 is hydrogen, deuterium or C 1 -C 6 alkyl;

[0221] R 6 is selected from hydrogen, optionally substituted C 1 -C 6Alkyl, optionally substituted C 1 -C 6 haloalkyl and optionally substituted C 1 -C 6 Hydroxyalkyl;

[0222] R 7 Selected from hydrogen, deuterium, halogen, -NO 2 , -CN, optionally substituted aryl, optionally substituted C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Heteroalkyl, optionally substituted C 1 -C 6 haloalkyl and optionally substituted C 1 -C 6 Hydroxyalkyl;

[0223] or R 7 Yes - NR 7A R 7B ,in

[0224] R 7A and R 7B are each independently hydrogen, deuterium, optionally substituted C 1 -C 20 Alkyl or optionally substituted C 1 -C 20 heteroalkyl; and

[0225] x 1 is an integer from 1 to 6.

[0226] In some embodiments, D is N and E is N. In some embodiments, D is C and E is O.

[0227] In some embodiments, the second terminus comprises a structure of formula (2-B):

[0228]

[0229] or a pharmaceutically acceptable salt thereof, wherein:

[0230] Ring A is optionally substituted aryl or optionally substituted 5- to 6-membered heteroaryl;

[0231] Ring B is absent or is an optionally substituted 6-membered monocyclic aryl or heteroaryl group;

[0232] Y A is -NH- or -O-;

[0233] R 5 is hydrogen, deuterium or C 1 -C 6 alkyl;

[0234] R 6 is selected from hydrogen, optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 haloalkyl and optionally substituted C 1 -C 6 Hydroxyalkyl;

[0235] R 7 Selected from hydrogen, deuterium, halogen, -NO 2 , -CN, optionally substituted aryl, optionally substituted C 1 -C 20 Alkyl, optionally substituted C 1 -C 20 Heteroalkyl, optionally substituted C 1 -C 6 haloalkyl and optionally substituted C 1 -C 6 Hydroxyalkyl;

[0236] or R 7 Yes - NR 7A R 7B ,in

[0237] R 7A and R 7B are each independently hydrogen, deuterium, optionally substituted C 1 -C 20 Alkyl or optionally substituted C 1 -C 20 heteroalkyl; and

[0238] x 1 is an integer from 1 to 6.

[0239] In some embodiments, Ring A is an optionally substituted aromatic ring. In some embodiments, Ring A is an optionally substituted phenyl. In some embodiments, Ring A is an optionally substituted 5-membered heteroaryl. In some embodiments, Ring A is an optionally substituted oxazolyl. In some embodiments, Ring A is an optionally substituted furanyl. In some embodiments, Ring A is an optionally substituted thienyl.

[0240] In some embodiments, the second terminus comprises a structure of formula (2-C):

[0241]

[0242] or a pharmaceutically acceptable salt thereof, wherein:

[0243] R 8 and R 9are each independently selected from hydrogen, deuterium, optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 haloalkyl or optionally substituted C 1 -C 6 Hydroxyalkyl.

[0244] In some embodiments, R 8 and R 9 are each independently selected from optionally substituted C 1 -C 6 Alkyl, C 1 -C 6 Haloalkyl or C 1 -C 6 In some embodiments, R 8 and R 9 are each independently selected from optionally substituted C 1 -C 6 In some embodiments, R 8 and R 9 Each is independently methyl, ethyl or propyl. In some embodiments, R 8 and R 9 Each is independently methyl. In some embodiments, R 8 and R 9 Each is independently ethyl. In some embodiments, R 8 and R 9 are each independently propyl.

[0245] In some embodiments, the second terminus comprises a structure of formula (2-D):

[0246]

[0247] or a pharmaceutically acceptable salt thereof, wherein:

[0248] R 10 is selected from hydrogen, deuterium, optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 haloalkyl or optionally substituted C 1 -C 6 Hydroxyalkyl.

[0249] In some embodiments, R 5 It is C 1 -C 6 In some embodiments, R 5 is methyl or ethyl. In some embodiments, R 5In some embodiments, R 5 In some embodiments, R 5 It's hydrogen.

[0250] In some embodiments, R 7 is selected from hydrogen, halogen, optionally substituted C 1 -C 6 Alkyl, C 1 -C 6 Haloalkyl or C 1 -C 6 In some embodiments, R 7 is halogen. In some embodiments, R 7 is Br, Cl or F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is F. In some embodiments, R 7 It's Br.

[0251] In some embodiments, R 7 Yes - NR 7A R 7B , where R 7A and R 7B are each independently hydrogen or optionally substituted C 1 -C 6 alkyl.

[0252] In some embodiments, R 10 Selected from optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 haloalkyl or optionally substituted C 1 -C 6 In some embodiments, R 10 Selected from optionally substituted C 1 -C 6 In some embodiments, R 10 is methyl, ethyl or propyl. In some embodiments, R 10 In some embodiments, R 10 is an optionally substituted C 1-6 In some embodiments, R 10 Yes-OMe.

[0253] In some embodiments, R 6 Selected from optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6haloalkyl or optionally substituted C 1 -C 6 In some embodiments, R 6 is an optionally substituted C 1 -C 6 In some embodiments, R 6 is methyl, ethyl or propyl. In some embodiments, R 6 In some embodiments, R 6 In some embodiments, R 6 In some embodiments, R 6 It's hydrogen.

[0254] In some embodiments, Y A is -NH-. In some embodiments, Y A Yes -O-.

[0255] In some embodiments, Y A is NH and x 1 Yes 1.

[0256] In some embodiments, x 1 is an integer from 1 to 5, from 1 to 4, from 1 to 3, or from 1 to 2. In some embodiments, x 1 is 1. In some embodiments, x 1 Serves 2.

[0257] In some embodiments, ring B is an optionally substituted 6-membered monocyclic aryl or heteroaryl, each of which is optionally substituted with alkyl, amino, halogen, hydroxyl, hydroxyalkyl or PEG. In some embodiments, ring B is phenyl. In some embodiments, ring B is a 6-membered monocyclic heteroaryl. In some embodiments, ring B is pyridine or pyrimidine. In some embodiments, ring B is absent.

[0258] In some embodiments, the second terminus comprises a structure of formula (2-E) or a pharmaceutically acceptable salt thereof:

[0259]

[0260] In some embodiments, the second terminus comprises a structure of formula (2-F) or a pharmaceutically acceptable salt thereof:

[0261]

[0262] In some embodiments, the second terminus comprises a structure of formula (2-G) or a pharmaceutically acceptable salt thereof:

[0263]

[0264] In some embodiments, the second terminus comprises a structure of formula (3-A):

[0265]

[0266]

[0267] or a pharmaceutically acceptable salt thereof, wherein

[0268] Y B Yes-CH 2 NH-, -CH 2 O-, -NH-, or -O-;

[0269] R 11A and R 11B are each independently hydrogen, deuterium or an optionally substituted C 1 -C 6 alkyl;

[0270] R 12 is hydrogen, halogen, -OH, optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 haloalkyl or optionally substituted C 1 -C 6 Hydroxyalkyl;

[0271] R 14 and R 15 are independently hydrogen, deuterium, halogen, -CN, -NO 2 , optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 haloalkyl or optionally substituted C 1 -C 6 Hydroxyalkyl;

[0272] or R 14 Yes - NR A R B ;

[0273] R 16 is an optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 Heteroalkyl, optionally substituted C 2 -C 6 Alkenyl, optionally substituted C 2 -C 6 Alkynyl, C 1 -C 6Hydroxyalkyl, -SO 2 R A or -NHSO 2 R A ;

[0274] R Y is hydrogen, optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 haloalkyl or optionally substituted 5- to 6-membered monocyclic aryl or heteroaryl;

[0275] Each R A and R B are independently hydrogen, deuterium, optionally substituted C 1 -C 6 Alkyl or optionally substituted C 1 -C 6 heteroalkyl; and

[0276] y 1 is 1 to 3; and

[0277] The connection to the linker is in R 14 or R Y Place.

[0278] In some embodiments, the second terminus comprises a structure of formula (3-B):

[0279]

[0280] or a pharmaceutically acceptable salt thereof, wherein

[0281] Ring C is absent or is an optionally substituted 5- to 6-membered monocyclic aryl or heteroaryl or a 4- to 8-membered heterocyclic ring;

[0282] Y B -NH-, -CH 2 NH-, -CH 2 O- or -O-;

[0283] R 11A and R 11B are each independently hydrogen, deuterium or an optionally substituted C 1 -C 6 alkyl;

[0284] R 12 is hydrogen, deuterium, optionally substituted C 1 -C 6 Alkyl, C(O)R A or C(O)NR A R B ;in

[0285] Each R A and R B are independently hydrogen, deuterium, optionally substituted C 1 -C 6 Alkyl or optionally substituted C 1 -C 6 heteroalkyl; and

[0286] R 13 is hydrogen, substituted aryl, substituted heteroaryl, or substituted diphenyl ether; and

[0287] y 2 is an integer from 0 to 2.

[0288] In some embodiments, y 2 is 0. In some embodiments, y 2 is 1. In some embodiments, y 2 is 2.

[0289] In some embodiments, R 13 is a substituted aryl or a substituted heteroaryl. In some embodiments, R 13 It's hydrogen.

[0290] In some embodiments, R 13 It is a substituted diphenyl ether.

[0291] In some embodiments, R 13 yes in

[0292] R 14 and R 15 are independently hydrogen, deuterium, halogen, -CN, -NO 2 , optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 haloalkyl or optionally substituted C 1 -C 6 Hydroxyalkyl;

[0293] or R 14 Yes - NR A R B ;

[0294] R 16 is an optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 Heteroalkyl, optionally substituted C 2 -C 6 Alkenyl, optionally substituted C2 -C 6 Alkynyl, C 1 -C 6 Hydroxyalkyl, -SO 2 R A or -NHSO 2 R A ;

[0295] Each R A and R B are independently hydrogen, deuterium, optionally substituted C 1 -C 6 Alkyl or optionally substituted C 1 -C 6 heteroalkyl; and

[0296] y 1 It is 1 to 3.

[0297] In some embodiments, the second terminus comprises a structure of formula (3-C):

[0298]

[0299] or a pharmaceutically acceptable salt thereof, wherein:

[0300] Ring C is absent or is an optionally substituted 5- to 6-membered monocyclic aryl or heteroaryl or a 4- to 8-membered heterocyclic ring;

[0301] Y B -NH-, -CH 2 NH-, -CH 2 O- or -O-;

[0302] R 14 and R 15 are independently hydrogen, deuterium, halogen, -CN, -NO 2 , optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 haloalkyl or optionally substituted C 1 -C 6 Hydroxyalkyl;

[0303] or R 14 Yes - NR A R B ,in

[0304] Each R A and R B are independently hydrogen, deuterium, optionally substituted C 1 -C 6 Alkyl or optionally substituted C 1 -C6 heteroalkyl; and

[0305] R 16 is an optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 Heteroalkyl, optionally substituted C 2 -C 6 Alkenyl, optionally substituted C 2 -C 6 Alkynyl, C 1 -C 6 Hydroxyalkyl, -SO 2 R A or -NHSO 2 R A ;as well as

[0306] y 1 is an integer from 1 to 3.

[0307] In some embodiments, Y B is -NH-. In some embodiments, Y B Yes-CH 2 NH-. In some embodiments, Y B Yes-CH 2 In some embodiments, Y B Yes -O-.

[0308] In some embodiments, Ring C is an optionally substituted 5 or 6 membered monocyclic aryl or heteroaryl, each of which is optionally substituted with alkyl, amino, halogen, hydroxy, hydroxyalkyl, or PEG.

[0309] In some embodiments, ring C is phenyl. In some embodiments, ring C is a 6-membered heteroaryl. In some embodiments, ring C is pyridine, pyrazine, or triazine. In some embodiments, ring C is pyridine. In some embodiments, ring C is pyrazine. In some embodiments, ring C is triazine. In some embodiments, ring C is a 5-membered heteroaryl. In some embodiments, ring C is pyrazole. In some embodiments, ring C is triazole, pyrrole, imidazole, oxazole, oxadiazole, thiazole, or thiadiazole. In some embodiments, ring C is triazole. In some embodiments, ring C is imidazole or pyrrole. In some embodiments, ring C is oxazole or oxadiazole. In some embodiments, ring C is thiazole or thiadiazole.

[0310] In some embodiments, Ring C is absent.

[0311] In some embodiments, the second terminus comprises a structure of Formula (3-D) or a pharmaceutically acceptable salt thereof:

[0312]

[0313] or a pharmaceutically acceptable salt or solvate thereof, wherein:

[0314] R 11A and R 11B are each independently hydrogen, deuterium or an optionally substituted C 1 -C 6 alkyl;

[0315] R 12 is hydrogen, deuterium, optionally substituted C 1 -C 6 Alkyl, C(O)R A or C(O)NR A R B ;

[0316] Each R 15 are independently hydrogen, deuterium, halogen, -CN, -NO 2 , optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 haloalkyl or optionally substituted C 1 -C 6 Hydroxyalkyl;

[0317] R 16 is an optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 Heteroalkyl, optionally substituted C 2 -C 6 Alkenyl, optionally substituted C 2 -C 6 Alkynyl, optionally substituted C 1 -C 6 Hydroxyalkyl, -SO 2 R A -or-NHSO 2 R A ;in

[0318] Each R A and R B are independently hydrogen, deuterium, optionally substituted C 1 -C 6 Alkyl or optionally substituted C 1 -C 6 heteroalkyl; and

[0319] y 1 is an integer from 1 to 3.

[0320] In some embodiments, R11A and R 11B are each independently an optionally substituted C 1 -C 6 In some embodiments, R 11A and R 11B Each is independently methyl, ethyl, propyl or tert-butyl. 11A and R 11B Each is independently methyl. In some embodiments, R 11A and R 11B are each independently hydrogen.

[0321] In some embodiments, R 11A is C optionally substituted by a haloalkyl group or phosphorus hydroxide 1 -C 6 In some embodiments, R 11A is -OP(O)(OH) 2 Substituted C 1 -C 6 In some embodiments, R 11A is the unsubstituted C 1 -C 6 In some embodiments, R 11A is methyl, ethyl or tert-butyl. In some embodiments, R 11A In some embodiments, R 11A It's hydrogen.

[0322] In some embodiments, R 12 is an optionally substituted C 1 -C 6 In some embodiments, R 12 It's hydrogen.

[0323] In some embodiments, R 12 It is C(O)R A or C(O)NR A R B In some embodiments, R 12 It is C(O)NR A R B , where R A and R B are each independently hydrogen or optionally substituted C 1 -C 6 alkyl.

[0324] In some embodiments, R 14 and R 15 are independently hydrogen, -CN or -NO 2 In some embodiments, R 14and R 15 are each independently halogen or optionally substituted C 1 -C 6 In some embodiments, R 14 and R 15 Each is independently Br, Cl, F, methyl or ethyl. In some embodiments, R 14 and R 15 Each is independently F or methyl.

[0325] In some embodiments, R 16 is an optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 Heteroalkyl, optionally substituted C 2 -C 6 Alkenyl, optionally substituted C 2 -C 6 Alkynyl or optionally substituted C 1 -C 6 Hydroxyalkyl, each of which is optionally substituted with amide, alkyl, alkynyl, azido, amino, halogen, haloalkyl, hydroxy, nitro, oxo (=0), phosphonium hydroxide, or PEG.

[0326] In some embodiments, R 16 is an optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 Heteroalkyl or optionally substituted C 1 -C 6 In some embodiments, R 16 It is C 1 -C 6 Alkyl or C 1 -C 6 heteroalkyl, each or they are optionally substituted by -CN, -NH 2 、-N 3 , -OH, CF 3 or -OP(O)(OH) 2 replace.

[0327] In some embodiments, R 16 Yes-SO 2 R A , where R A It is C 1 -C 6 In some embodiments, R 16 Yes-SO 2 In some embodiments, R 16Yes-SO 2 Me.

[0328] In some embodiments, R 16 Yes - NHSO 2 R A , where R A It is C 1 -C 6 In some embodiments, R 16 Yes - NHSO 2 In some embodiments, R 16 Yes - NHSO 2 Me.

[0329] In some embodiments, y 1 is 1. In some embodiments, y 1 is 2. In some embodiments, y 1 is 3.

[0330] In some embodiments, the second terminus comprises a structure of formula (3-E) or a pharmaceutically acceptable salt thereof:

[0331]

[0332] In some embodiments, the second terminus comprises a structure of formula (3-F) or a pharmaceutically acceptable salt thereof:

[0333]

[0334] In some embodiments, the second terminus comprises a structure of Formula (3-G) or Formula (3-H), or a pharmaceutically acceptable salt thereof:

[0335]

[0336] In some embodiments, the second terminus comprises a structure of formula (4-A):

[0337]

[0338] or a pharmaceutically acceptable salt thereof, wherein;

[0339] Ring D is absent or is phenyl or a 5- to 6-membered heteroaryl group;

[0340] X 9 and X 10 are independently C or N, wherein X 9 or X 10 One of them is N;

[0341] L 2 Absent, or optionally substituted alkylene, -O- or -NR D-,in

[0342] R D is hydrogen, deuterium or optionally substituted C 1 -C 3 alkyl;

[0343] R 18 is an optionally substituted 5- to 6-membered heteroaryl;

[0344] R 19 is an optionally substituted C 3 -C 8 cycloalkyl or optionally substituted 4- to 7-membered heteroaryl;

[0345] Each R 20 are independently hydrogen, deuterium, halogen, -CN, -NO 2 , optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 haloalkyl or optionally substituted C 1 -C 6 Hydroxyalkyl;

[0346] x 3 is an integer from 1 to 3; and

[0347] y 3 is an integer from 1 to 4; and

[0348] The connection to the linker is in R 19 or in R 20 One of the places.

[0349] In some embodiments, the connection to the linker is at R 19 Place.

[0350] In some embodiments, the connection to the linker is at an R 20 Place.

[0351] In some embodiments, the second terminus comprises a structure of formula (4-B):

[0352]

[0353] or a pharmaceutically acceptable salt thereof, wherein;

[0354] Ring D is absent or is optionally substituted phenyl or optionally substituted 5- to 6-membered heteroaryl;

[0355] X 9 and X 10 are independently C or N, wherein X 9 or X 10One of them is N;

[0356] L 2 Absent, or optionally substituted alkylene, -O- or -NR D -,in

[0357] R D is hydrogen, deuterium or optionally substituted C 1 -C 3 alkyl;

[0358] R 18 is an optionally substituted 5- to 6-membered heteroaryl;

[0359] R 19 is an optionally substituted C 3 -C 8 cycloalkyl or optionally substituted 4- to 7-membered heteroaryl; and

[0360] x 3 is an integer from 1 to 3.

[0361] In some embodiments, X 9 is N; and X 10 is C. In some embodiments, X 9 is C; and X 10 It is N.

[0362] In some embodiments, the second terminus comprises a structure of formula (4-C) or a pharmaceutically acceptable salt thereof:

[0363]

[0364]

[0365] In some embodiments, ring D is an optionally substituted monocyclic 6-membered aryl or 5-6-membered heteroaryl. In some embodiments, ring D is an optionally substituted monocyclic 6-membered aryl. In some embodiments, ring D is an optionally substituted phenyl.

[0366] In some embodiments, R 19 is an optionally substituted C 3 -C 8 In some embodiments, R 19 is an optionally substituted 4- to 7-membered heteroaryl group.

[0367] In some embodiments, the second terminus comprises a structure of formula (4-D):

[0368]

[0369] or a pharmaceutically acceptable salt thereof, wherein;

[0370] L 2 is optionally substituted alkylene, -O- or -NR D -,in

[0371] R D is hydrogen, deuterium or optionally substituted C 1 -C 3 alkyl;

[0372] R 18 is an optionally substituted 5- to 6-membered heteroaryl;

[0373] R 20 It is hydrogen, deuterium, halogen, -CN, -NO 2 , optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 haloalkyl or optionally substituted C 1 -C 6 Hydroxyalkyl;

[0374] x 3 is an integer from 1 to 3; and

[0375] y 3 is an integer from 1 to 4.

[0376] In some embodiments, L 2 is an optionally substituted alkylene group. 2 is optionally replaced by one or more C 1 -C 3 Alkyl substituted C 2 -C 4 In some embodiments, L 2 Does not exist.

[0377] In some embodiments, L 2 Yes - NR D -. In some embodiments, L 2 It is -NH-.

[0378] In some embodiments, R 18 is an optionally substituted 5-membered heteroaryl. 18 is an optionally substituted oxazole, oxadiazole, thiazole, thiadiazole, pyrrole or pyrazole. 18 is an optionally substituted oxazole.

[0379] In some embodiments, R 20 Halogen, -CN, -NO 2 , optionally substituted C 1 -C 6Alkyl, optionally substituted C 1 -C 6 haloalkyl or optionally substituted C 1 -C 6 Hydroxyalkyl.

[0380] In some embodiments, x 3 is 1. In some embodiments, x 3 is 2. In some embodiments, x 3 Serves 3.

[0381] In some embodiments, y 4 is 1 or 2. In some embodiments, y 4 is 1. In some embodiments, y 4 is 2. In some embodiments, y 4 is 3. In some embodiments, y 4 Serves 4.

[0382] In some embodiments, the second terminus comprises a structure of Formula (4-E) or Formula (4-F), or a pharmaceutically acceptable salt thereof:

[0383]

[0384] In some embodiments, the second terminus comprises a structure of formula (4-G) or a pharmaceutically acceptable salt thereof:

[0385]

[0386] In some embodiments, the second terminus comprises a structure of formula (5-A):

[0387]

[0388] or a pharmaceutically acceptable salt thereof, wherein;

[0389] Ring E is absent or is optionally substituted phenyl or optionally substituted 5- to 6-membered heteroaryl;

[0390] X 11 is CH or N;

[0391] L 3 Yes - NR E -or-CR E R E -,in

[0392] Each R E are independently hydrogen, deuterium or optionally substituted C 1 -C 3 alkyl;

[0393] R 21 It is C1 -C 6 Alkyl or C 3 -C 6 Cycloalkyl; and

[0394] R 22 Halogen, CN, NO 2 , optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 haloalkyl or optionally substituted C 1 -C 6 Hydroxyalkyl.

[0395] In some embodiments, Ring E is absent. In some embodiments, Ring E is an optionally substituted phenyl. In some embodiments, Ring E is an optionally substituted 5- to 6-membered heteroaryl. In some embodiments, Ring E is a 5-membered heteroaryl. In some embodiments, Ring E is a 6-membered heteroaryl.

[0396] In some embodiments, X 11 is CH and L 3 Yes - NR E -. In some embodiments, X 11 is N and L 3 Yes-CR E R E -.

[0397] In some embodiments, R 21 It is C 1 -C 6 In some embodiments, R 21 It's methyl.

[0398] In some embodiments, R 22 is halogen, optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 haloalkyl or optionally substituted C 1 -C 6 In some embodiments, R 22 is CN, F, Cl, Br or methyl.

[0399] In some embodiments, the second terminus comprises a structure of formula (5-B) or a pharmaceutically acceptable salt thereof:

[0400]

[0401] In some embodiments, the second terminus comprises a structure of formula (6-A):

[0402]

[0403] or a pharmaceutically acceptable salt thereof, wherein;

[0404] Ring G is an optionally substituted C 3 -C 6 Cycloalkyl or optionally substituted 4- to 6-membered heterocycloalkyl;

[0405] L 6 is -O-(optionally substituted alkylene);

[0406] R 28 is an optionally substituted 5- to 6-membered heteroaryl;

[0407] R 29 is an optionally substituted C 1 -C 6 Alkyl (C 6 -C 10 Aryl) or optionally substituted C 1 -C 6 Alkyl(6- to 10-membered heteroaryl); and

[0408] R 30 is an optionally substituted C 1 -C 6 Alkyl, optionally substituted C 1 -C 6 haloalkyl or optionally substituted C 1 -C 6 Hydroxyalkyl.

[0409] In some embodiments, the second terminus comprises a structure of formula (7-A):

[0410]

[0411] or a pharmaceutically acceptable salt thereof, wherein

[0412] A 5 is -O-, -NH- or -CH 2 -;

[0413] Z 1 is CH or N;

[0414] W is O or S;

[0415] Each R 31 are independently hydrogen, halogen, -OH, -CN, -NO 2 、-NH 2 , optionally substituted C 1 -C 10 Alkyl, optionally substituted C1 -C 10 haloalkyl, optionally substituted C 1 -C 10 Hydroxyalkyl, optionally substituted C 2 -C 10 Alkenyl, optionally substituted C 2 -C 10 Alkynyl, optionally substituted C 3 -C 8 Cycloalkyl or optionally substituted 3- to 8-membered heterocycloalkyl;

[0416] or two R 31 Together with the atoms to which they are attached, they form an optionally substituted C 5 -C 8 Cycloalkyl or optionally substituted 5- to 8-membered heterocycloalkyl;

[0417] R 32 is hydrogen or optionally substituted C 1 -C 10 alkyl;

[0418] R 33 It is hydrogen, halogen, -OH, -CN, -NO 2 、-NH 2 , optionally substituted C 1 -C 10 Alkyl, optionally substituted C 1 -C 10 haloalkyl or optionally substituted C 1 -C 10 hydroxyalkyl; and

[0419] q 6 It is 0 to 4.

[0420] In some embodiments, Z 1 is CH. In some embodiments, Z 1 It is N.

[0421] In some embodiments, W is O. In some embodiments, W is S.

[0422] In some embodiments, each R 31 is independently optionally substituted C 1 -C 10 Alkyl, optionally substituted C 1 -C 10 haloalkyl or optionally substituted C 1 -C 10 In some embodiments, each R 31 is independently optionally substituted C 3 -C8 -cycloalkyl or optionally substituted 3 to 8 membered heterocycloalkyl. 31 are independently hydrogen, halogen, -OH, -CN, -NO 2 or -NH 2 In some embodiments, each R 31 It's hydrogen.

[0423] In some embodiments, R 32 is an optionally substituted C 1 -C 10 In some embodiments, R 32 In some embodiments, R 32 It's hydrogen.

[0424] In some embodiments, R 33 It is hydrogen, halogen, -OH, -CN, -NO 2 or -NH 2 In some embodiments, R 33 is an optionally substituted C 1 -C 10 Alkyl, optionally substituted C 1 -C 10 haloalkyl or optionally substituted C 1 -C 10 Hydroxyalkyl.

[0425] In some embodiments, the second terminus comprises a structure of formula (7-B) or a pharmaceutically acceptable salt thereof:

[0426]

[0427] In some embodiments, the second terminus comprises a structure of formula (8-A):

[0428]

[0429] or a pharmaceutically acceptable salt thereof, wherein

[0430] Ring H is optionally substituted phenyl or optionally substituted 6-membered heteroaryl;

[0431] or ring H is

[0432] Z B absent or optionally substituted phenylcarboxamide;

[0433] X 12 is CH or N;

[0434] R 34 is optionally substituted phenyl or optionally substituted 6-membered heteroaryl;

[0435] R 34A is hydrogen, halogen or optionally substituted C 1 -C 3 alkyl;

[0436] R 33 are independently halogen, optionally substituted C 1 -C 10 alkyl or optionally substituted 5-membered heteroaryl; and

[0437] The connection to the linker is in R 35 , Z B Or at ring H.

[0438] In some embodiments, Ring H is an optionally substituted phenyl. In some embodiments, Ring H is an optionally substituted 6-membered heteroaryl.

[0439] In some embodiments, Ring H is

[0440] In some embodiments, Z B In some embodiments, Z B is an optionally substituted phenylcarboxamide. B It is -C(O)NH-phenyl.

[0441] In some embodiments, X 12 is CH. In some embodiments, X 12 It is N.

[0442] In some embodiments, R 34 is an optionally substituted phenyl. 34 is an optionally substituted 6-membered heteroaryl.

[0443] In some embodiments, R 34A is hydrogen or halogen. In some embodiments, R 34A is an optionally substituted C 1 -C 3 In some embodiments, R 34A It's methyl.

[0444] In some embodiments, the connection between formula (8-A) and the linker is at R 35 In some embodiments, the connection between formula (8-A) and the linker is at Z B In some embodiments, the connection between formula (8-A) and the linker is at ring H.

[0445] In some embodiments, the second end comprises a structure of Formula (8-B) or Formula (8-C) or a pharmaceutically acceptable salt thereof:

[0446]

[0447] In some embodiments, the second terminus comprises a structure of formula (8-D) or a pharmaceutically acceptable salt thereof:

[0448]

[0449] In some embodiments, the second terminus comprises a structure of formula (9-A) or a pharmaceutically acceptable salt thereof:

[0450]

[0451] In some embodiments, the second end comprises a structure of Formula (10-A) or Formula (10-B) or a pharmaceutically acceptable salt thereof:

[0452]

[0453] In some embodiments, the second end comprises a structure of formula (11-A) or a pharmaceutically acceptable salt thereof:

[0454]

[0455] In some embodiments, the second end is selected from the group consisting of:

[0456]

[0457]

[0458] or a pharmaceutically acceptable salt thereof.

[0459] In some embodiments, the second terminus is selected from the moieties described in Table 2 or a pharmaceutically acceptable salt thereof.

[0460] Table 2. Exemplary bromodomain binding moieties.

[0461]

[0462]

[0463]

[0464]

[0465] Oligomeric backbone-linker moiety

[0466] The oligomeric backbone is a linker that connects the first terminus and the second terminus and brings the regulatory molecule into proximity with the target gene to modulate gene expression.

[0467] The length of the linker depends on the type of regulatory protein and target gene. In some embodiments, the linker has a length of less than about 50 angstroms. In some embodiments, the linker has a length of about 20 to 30 angstroms.

[0468] In some embodiments, the oligomeric backbone comprises 5 to 50 chain atoms.

[0469] In some embodiments, the oligomeric backbone comprises a polymer having 2 to 50 spacer moieties, wherein

[0470] Each spacer moiety is independently selected from the group consisting of: -((CR 3a R 3b ) x -O) y -、-((CR 3a R 3b ) x -NR 4a ) y -、-((CR 3a R 3b ) x -CH=CH-(CR 3a R 3b ) x -O) y -, optionally substituted C 1 -C 12 Alkyl, optionally substituted C 2 -C 10 Alkenyl, optionally substituted C 2 -C 10 Alkynyl, optionally substituted C 6 -C 10 Arylene, optionally substituted C 3 -C 7 cycloalkylene, optionally substituted 5- to 10-membered heteroarylene, optionally substituted 4- to 10-membered heterocycloalkylene, amino acid residue, -O-, -C(O)NR 4a -、-NR 4a C(O)-, -C(O)-, -NR 1a -, -C(O)O-, -S-, -S(O)-, -S(O) 2 -、-S(O) 2 NR 4a -、-NR 4a S(O) 2 - and -P(O)OH- and any combination thereof; wherein

[0471] each x is independently 2 to 4;

[0472] each y is independently 1 to 10;

[0473] Each R 1a are independently hydrogen or optionally substituted C 1 -C 6 alkyl;

[0474] Each R 3a and R 3b independently selected from hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted alkoxy, optionally substituted amino, carboxyl, carboxyl ester, acyl, acyloxy, acylamino, aminoacyl, optionally substituted alkylamide, sulfonyl, optionally substituted thioalkoxy, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl, and optionally substituted heterocyclyl; and

[0475] Each R 4a are independently hydrogen or optionally substituted C 1 -C 6 alkyl.

[0476] In some embodiments, the oligomeric backbone comprises a polymer having 2 to 50 spacer moieties, wherein each spacer moiety is independently selected from the group consisting of: an optionally substituted C 1 -C 12 Alkyl, -((CH 2 ) x -O) y -、-((CH 2 ) x -NH) y -, -O-, -C(O)NH-, -NH-, and any combination thereof.

[0477] In some embodiments, the oligomeric backbone comprises -(T 1 -V 1 ) a -(T 2 -V 2 ) b -(T 3 -V 3 ) c -(T 4 -V 4 ) d -(T 5 -V 5 ) e -,in

[0478] a, b, c, d and e are each independently 0 or 1, and wherein the sum of a, b, c, d and e is 1 to 5;

[0479] T 1 、T 2 、T3 , T 4 and T 5 are each independently selected from optionally substituted C 1 -C 12 alkylene, optionally substituted alkenylene, optionally substituted alkynylene, (EA) w 、(EDA) m , (PEG) n 、(Modified PEG) n 、(AA) p 、-(CR 2a OH) h -, optionally substituted C 6 -C 10 Arylene, optionally substituted C 3 -C 7 cycloalkylene, optionally substituted 5- to 10-membered heteroarylene, optionally substituted 4- to 10-membered heterocycloalkylene, acetal group, disulfide, hydrazine, carbohydrate, β-lactam and ester,

[0480] (a) w is an integer from 1 to 20;

[0481] (b) m is an integer from 1 to 20;

[0482] (c) n is an integer from 1 to 30;

[0483] (d) p is an integer from 1 to 20;

[0484] (e) h is an integer from 1 to 12;

[0485] (f) EA has the following structure:

[0486]

[0487] (g) EDA has the following structure:

[0488] wherein each q is independently an integer from 1 to 6, each x is independently an integer from 1 to 4, and each R is independently 0 or 1;

[0489] (h)(PEG) n With -(CR 2a R 2b -CR 2a R 2b -O) n -CR 2a R 2b - structure;

[0490] (i) (Modified PEG) n With -(CH 2 -CR2a =CR 2a -CH 2 -O)-or-(CR 2a R 2b -CR 2a R 2b -S)-substituted (PEG) n At least one of -(CR 2a R 2b -CR 2a R 2b -O)- structure;

[0491] (j) AA is an amino acid residue;

[0492] (k)V 1 、V 2 、V 3 、V 4 and V 5 are each independently selected from the group consisting of: a bond, C(O)-, -NR 1a -、-C(O)NR 1a -、-NR 1a C(O)-、-CONR 1a -C 1 -C 4 Alkyl-, -NR 1a C(O)-C 1 -C 4 Alkyl-, -C(O)O-, -OC(O)-, -O-, -S-, -S(O)-, -S(O) 2 -、-S(O) 2 NR 1a -、-NR 1a S(O) 2 - and -P(O)OH-;

[0493] (l) Each R 1a are independently hydrogen or optionally substituted C 1 -C 6 Alkyl; and

[0494] Each R 2a and R 2b independently selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, halogen, alkoxy, substituted alkoxy, amino, substituted amino, carboxyl, carboxyl ester, acyl, acyloxy, acylamino, aminoacyl, alkylamide, substituted alkylamide, sulfonyl, thioalkoxy, substituted thioalkoxy, aryl, substituted aryl, heteroaryl, substituted heteroaryl, cycloalkyl, substituted cycloalkyl, heterocyclyl, and substituted heterocyclyl.

[0495] In some embodiments, a, b, c, d, and e are each independently 0 or 1, wherein the sum of a, b, c, d, and e is 1. In some embodiments, a, b, c, d, and e are each independently 0 or 1, wherein the sum of a, b, c, d, and e is 2. In some embodiments, a, b, c, d, and e are each independently 0 or 1, wherein the sum of a, b, c, d, and e is 3. In some embodiments, a, b, c, d, and e are each independently 0 or 1, wherein the sum of a, b, c, d, and e is 4. In some embodiments, a, b, c, d, and e are each independently 0 or 1, wherein the sum of a, b, c, d, and e is 5.

[0496] In some embodiments, n is 3 to 9. In some embodiments, n is 4 to 8. In some embodiments, n is 5 or 6.

[0497] In some embodiments, T 1 , T 2 , T 3 and T 4 and T 5 Each independently selected from C 1- C 12 Alkyl, substituted C 1 -C 12 Alkyl, (EA) w 、(EDA) m , (PEG) n 、(Modified PEG) n 、(AA) p 、-(CR 2a OH) h -, phenyl, substituted phenyl, piperidine-4-amino (P4A), p-amino-benzyloxycarbonyl (PABC), m-amino-benzyloxycarbonyl (MABC), p-amino-benzyloxy (PABO), m-amino-benzyloxy (MABO), p-aminobenzyl, acetal group, disulfide, hydrazine, carbohydrate, β-lactam, ester, (AA) p -MABC-(AA) p 、(AA) p -MABO-(AA) p 、(AA) p -PABO-(AA) p and (AA) p -PABC-(AA) p In some embodiments, piperidine-4-amino (P4A) is Where R 1a is hydrogen or C 1 -C 6 alkyl.

[0498] In some embodiments, T 1 , T 2 , T 3 , T 4 and T 5 Each independently selected from (C 1 -C 12 ) alkyl, substituted C 1 -C 12 Alkyl, (EA) w 、(EDA) m , (PEG) n 、(Modified PEG) n 、(AA) p 、-(CR 2a OH) h -, optionally substituted C 6 -C 10 arylene, 4 to 10 membered heterocycloalkene, optionally substituted 5 to 10 membered heteroarylene. In some embodiments, EA has the following structure:

[0499] and

[0500] EDA has the following structure:

[0501]

[0502] In some embodiments, for EA and EDA, x is 2 to 3 and q is 1 to 3. In some embodiments, R 1a is hydrogen or C 1 -C 6 alkyl.

[0503] In some embodiments, T 4 or T 5 is an optionally substituted C 6 -C 10 Arylene.

[0504] In some embodiments, T 4 or T 5 is phenylene or substituted phenylene. In some embodiments, T 4 or T 5 is phenylene or is replaced by 1 to 3 groups selected from C 1 -C 6 alkyl, halogen, OH or amine substituted phenylene. In some embodiments, T 4 or T 5 is a 5- to 10-membered heteroarylene or substituted heteroarylene. In some embodiments, T 4 or T 5is a 4- to 10-membered heterocyclylene or a substituted heterocyclylene. In some embodiments, T 4 or T 5 is heteroarylene or optionally substituted by 1 to 3 groups selected from C 1 -C 6 A heteroarylene group substituted with an alkyl, halogen, OH or amine substituent.

[0505] In some embodiments, T 1 , T 2 , T 3 , T 4 and T 5 and V 1 、V 2 、V 3 、V 4 and V 5 Selected from Table 3 below.

[0506] Table 3. Exemplary linker units.

[0507]

[0508]

[0509] In some embodiments, the oligomeric backbone comprises N(R 1a )(CH 2 ) x N(R 1b )(CH 2 ) x N-, where R 1a and R 1b are each independently selected from hydrogen or optionally substituted C 1 -C 6 alkyl; and each x is independently an integer in the range of 1 to 6.

[0510] In some embodiments, the oligomeric backbone comprises -(CH 2 -C(O)N(R 4a )-(CH 2 ) q -N(R 4a )-(CH 2 ) q -N(R 4a )C(O)-(CH 2 ) x -C(O)N(R 4a )-A-、-(CH 2 ) x -C(O)N(R 4a )-(CH 2 CH 2 O) y(CH 2 ) x -C(O)N(R 4a )-A-or-C(O)N(R 4a )-(CH 2 ) q -N(R 4a )-(CH 2 ) q -N(R 4a )C(O)-(CH 2 ) x -A-; wherein each q is independently an integer from 2 to 10; each x is independently an integer from 1 to 6; each A is independently selected from a bond, an optionally substituted C 1 -C 12 Alkyl, optionally substituted C 6 -C 10 Arylene, optionally substituted C 3 -C 7 cycloalkylene, optionally substituted 5- to 10-membered heteroarylene, and optionally substituted 4- to 10-membered heterocycloalkylene.

[0511] In some embodiments, the oligomeric backbone comprises -(CH 2 CH 2 -O) x1 -or-(CH 2 CH 2 -O) x2 -A-(CH 2 CH 2 -O) x3 -, wherein A is an optionally substituted 4- to 10-membered heterocycloalkylene or spirocycloalkene, and each x 1 、x 2 and x 3 are independently an integer from 1 to 15.

[0512] In some embodiments, the oligomeric backbone comprises -NR 4a -(CH 2 CH 2 O) y (CH 2 ) x -or-NR 4a -(CH 2 ) q -C(O)NR 4a (CH 2 CH 2 O) y (CH 2 ) x -, wherein q is 2 to 10, x is 1 to 4, y is 1 to 50, and each R 4aare independently hydrogen or optionally substituted C 1 -C 6 In some embodiments, the oligomeric backbone comprises -NR 4a -(CH 2 CH 2 O) y (CH 2 ) x In some embodiments, the oligomeric backbone comprises -NR 4a -(CH 2 ) q -C(O)NR 4a (CH 2 CH 2 O) y (CH 2 ) x -.

[0513] In some embodiments, the oligomeric backbone comprises -(CH 2 CH 2 -O) x1 -、-(CH 2 CH 2 -O) x1 -(CH 2 CH 2 )-NH-, -NH-(CH 2 CH 2 -O) x1 -、-NH-(CH 2 CH 2 -O) x1 -(CH 2 CH 2 )-NH-、-(CH 2 CH 2 -O) x1 -(CH 2 CH 2 )-NHC(O)- or -NH-(CH 2 CH 2 -O) x1 -(CH 2 CH 2 )-NHC(O)-. In some embodiments, the oligomeric backbone comprises -NH-(CH 2 CH 2 -O) x1 - or -NH-(CH 2 CH 2 -O) x1 -(CH 2 CH 2 )-NH-. In some embodiments, the oligomeric backbone comprises -NH-(CH 2CH 2 -O) x1 -. In some embodiments, the oligomeric backbone comprises -NH-(CH 2 CH 2 -O) x1 -(CH 2 CH 2 )-NH-.

[0514] In some embodiments, the oligomeric backbone comprises polyethylene glycol (PEG). In some embodiments, the oligomeric backbone comprises 1 to 20 PEG units. In some embodiments, the oligomeric backbone comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 PEG units.

[0515] In some embodiments, A is selected from In some embodiments, A is In some embodiments, A is In some embodiments, A is

[0516] In some embodiments, A comprises a moiety having the structure:

[0517]

[0518] or a pharmaceutically acceptable salt thereof, wherein:

[0519] X 13 Absent or -C(O)-; and

[0520] R 27 is an optionally substituted C 1 -C 50 Alkyl or optionally substituted C 1 -C 50 Heteroalkyl.

[0521] In some embodiments, X 13 is -C(O)-. In some embodiments, X 13 Does not exist.

[0522] In some embodiments, R 27 It is C 1 -C 50 In some embodiments, R 27 It is C 1 -C 40 In some embodiments, R 27 It is C 1 -C 30 In some embodiments, R27 It is C 1 -C 20 In some embodiments, R 27 It is C 1 -C 10 In some embodiments, R 27 It is C 1 -C 50 In some embodiments, R 27 It is C 1 -C 40 In some embodiments, R 27 It is C 1 -C 30 In some embodiments, R 27 It is C 1 -C 20 In some embodiments, R 27 It is C 1 -C 10 Heteroalkyl. In some embodiments, the heteroalkyl is polyethylene glycol (PEG).

[0523] In some embodiments, the oligomeric backbone comprises a moiety having a structure of Formula (C-1):

[0524]

[0525] or a pharmaceutically acceptable salt thereof, wherein:

[0526] Ring F is absent or is an arylene group or a heterocycloalkylene group;

[0527] L 5 is absent, or is optionally substituted alkylene or optionally substituted alkynylene;

[0528] Y 9 and Y 10 are each independently CH or N;

[0529] s 1 and 2 are each independently 0 to 3; and

[0530] ** indicates ligation to the second terminus.

[0531] In some embodiments, Ring F is absent. In some embodiments, Ring F is C 4 -C 7 Heterocycloalkylene.

[0532] In some embodiments, Y 9 is N. In some embodiments, Y 9 It is CH.

[0533] In some embodiments, Y 10 is N. In some embodiments, Y 10 It is CH.

[0534] In some embodiments, L 5 Does not exist.

[0535] In some embodiments, L 5 It is an alkylene group or an alkynylene group.

[0536] In some embodiments, L 5 Yes-(C R1G R 1G ) x -(Alkylene) 2 -(CR 1G R 1G ) y -; wherein x and y are each independently 0 or 1; and each R 1G is hydrogen or C 1 -C 3 alkyl.

[0537] In some embodiments, the oligomeric backbone comprises a moiety having a structure of Formula (C-2):

[0538]

[0539] or a pharmaceutically acceptable salt thereof, wherein:

[0540] Y 10 , Y 11 and Y 12 are each independently N or CH.

[0541] In some embodiments, each Y 11 and Y 12 are independently N or CH; and Y 10 It is N.

[0542] In some embodiments, L 5 It is C 1 -C 3 Alkylene or C 1 -C 3 In some embodiments, L 5 It is C 1 -C 3 In some embodiments, L 5 It is C 1 -C 3 In some embodiments, L 5 Yes-CH 2 -、-CH 2 CH2 -, -C≡C- or -C≡CC≡C-. In some embodiments, L 5 Yes-CH 2 -or-CH 2 CH 2 -. In some embodiments, L 5 is -C≡C-. In some embodiments, L 5 It is -C≡CC≡C-.

[0543] In some embodiments, the oligomeric backbone comprises a moiety having a structure of Formula (C-3):

[0544]

[0545] or a pharmaceutically acceptable salt thereof, wherein:

[0546] s 1 and 2 each independently 0 to 3;

[0547] r 1 is an integer from 1 to 3;

[0548] R 26 is an optionally substituted C 1 -C 20 Alkylene or optionally substituted C 2 -C 20 heteroalkylene;

[0549] Each R 1G are independently hydrogen or C 1 -C 3 Alkyl; and

[0550] ** indicates ligation to the second terminus.

[0551] In some embodiments, R 26 is an optionally substituted C 1 -C 20 In some embodiments, R 26 It's PEG.

[0552] In some embodiments, each R 1G are independently hydrogen. In some embodiments, R 1G Independently C 1 -C 3 In some embodiments, C 1 -C 3 Alkyl is methyl, ethyl or propyl. In some embodiments, each R 1G is independently methyl.

[0553] In some embodiments, s1 and 2 Each independently is 0, 1 or 2. In some embodiments, s 1 and 2 Each is independently 0. In some embodiments, s 1 and 2 Each independently is 1.

[0554] In some embodiments, r 1 is 1 or 2. In some embodiments, r 1 is 1. In some embodiments, r 1 Serves 2.

[0555] In some embodiments, the oligomeric backbone comprises:

[0556]

[0557] In some embodiments, the oligomeric backbone is linked to a first terminus and / or a second terminus having a group selected from: -C(O)-, -NR 1a -、-C(O)NR 1a -、-NR 1a C(O)-、-C(O)NR 1a C 1 -C 4 Alkyl-, -NR 1a C(O)-C 1 -C 4 Alkyl-, -C(O)O-, -OC(O)-, -O-, -S-, -S(O)-, -S(O) 2 -、-S(O) 2 NR 1a -、-NR 1a S(O) 2 -、-P(O)OH-、-((CH 2 ) x -O)-、-((CH 2 ) y -NR 1a )-, optionally substituted C 1 -C 12 Alkylene, optionally substituted C 2 -C 10 Alkenylene, optionally substituted C 2 -C 10 Alkyne, optionally substituted C 6 -C 10 Arylene, optionally substituted C 3 -C 7cycloalkylene, optionally substituted 5- to 10-membered heteroarylene, and optionally substituted 4- to 10-membered heterocycloalkylene, wherein each x is independently 1 to 4, each y is independently 1 to 4, and each R 1a are independently hydrogen or optionally substituted C 1 -C 6 alkyl.

[0558] In some embodiments, the oligomeric backbone is linked to a first terminus having a group selected from: -O-, -C(O)-, -NR 1a -、C 1 -C 12 Alkyl, -C(O)NR 1a -and-NR 1a In some embodiments, the oligomeric backbone is connected to a moiety selected from -O- or -NR 1a - is connected to the first end of the group.

[0559] In some embodiments, the oligomeric backbone is linked to a second terminus having a group selected from: -C(O)-, -NR 1a -、-C(O)NR 1a -、-NR 1a C(O)-、-((CH 2 ) x -O)-、-((CH 2 ) y -NR 1a )-, -O-, optionally substituted C 1 -C 12 Alkyl, optionally substituted C 6 -C 10 Arylene, optionally substituted C 3 -C 7 cycloalkylene, optionally substituted 5- to 10-membered heteroarylene, and optionally substituted 4- to 10-membered heterocycloalkylene, wherein each x is independently 1 to 4, each y is independently 1 to 4, and each R 1a are independently hydrogen or optionally substituted C 1 -C 6 alkyl.

[0560] In some embodiments, the oligomeric backbone is linked to a second terminus having a group selected from: -O-, -C(O)-, -NR 1a -、C 1 -C 12 Alkyl, -C(O)NR 1a -and-NR 1a In some embodiments, the oligomeric backbone is connected to a moiety selected from -O- or -NR 1aIn some embodiments, the oligomer backbone is connected to the second end of the group having -O-. In some embodiments, the oligomer backbone is connected to the second end of the group having -NR 1a In some embodiments, the oligomeric backbone is linked to a second terminus having -NH-.

[0561] In some embodiments, non-limiting examples of transcriptional modulator compounds described herein are presented below in Table 4 (next page).

[0562]

[0563]

[0564]

[0565]

[0566]

[0567]

[0568]

[0569]

[0570]

[0571]

[0572]

[0573]

[0574]

[0575]

[0576]

[0577]

[0578]

[0579]

[0580]

[0581]

[0582]

[0583]

[0584]

[0585]

[0586]

[0587] As used herein, two embodiments are "mutually exclusive" when one embodiment is defined as something different from another embodiment. For example, the embodiment where two groups combine to form a cycloalkyl is mutually exclusive with the embodiment where one group is ethyl and the other group is hydrogen. Similarly, the embodiment where one group is CH 2 The embodiment where the same group is NH is mutually exclusive.

[0588] How to use

[0589] In another aspect, provided herein is a method of treating an individual having a disorder with an expanded nucleotide repeat sequence, such nucleotide repeat sequence comprising CAG, the method comprising administering a transcriptional regulator molecule having a first end, a second end, and an oligomeric backbone, wherein

[0590] (a) the first end comprises a DNA binding portion, and the DNA binding portion is capable of binding to a nucleotide repeat sequence comprising CAG;

[0591] (b) the second end comprises a protein binding portion, the protein binding portion being capable of binding to a regulatory molecule that regulates the expression of a gene having an expanded nucleotide repeat sequence; and

[0592] (c) the oligomeric backbone connects the first end and the second end.

[0593] In another aspect, provided herein is a method of reducing expression of a gene having an expanded nucleotide repeat sequence such as CAG in a cell, the method comprising contacting the cell with a transcriptional regulator molecule having a first end, a second end, and an oligomeric backbone, wherein

[0594] (a) the first end comprises a DNA binding portion, and the DNA binding portion is capable of binding to a nucleotide repeat sequence comprising CAG;

[0595] (b) the second end comprises a protein binding portion, the protein binding portion being capable of binding to a regulatory molecule that regulates the expression of a gene having an expanded nucleotide repeat sequence; and

[0596] (c) the oligomeric backbone connects the first end and the second end.

[0597] In some embodiments, the expanded nucleotide repeat disorder is an expanded CAG repeat disorder.

[0598] In some embodiments, the expanded nucleotide repeat sequence disorder is Huntington's disease (HD). In some embodiments, the expanded nucleotide repeat sequence disorder is a Huntington's disease-like syndrome. In some embodiments, the expanded nucleotide repeat sequence disorder is juvenile Huntington's disease.

[0599] In some embodiments, the expanded nucleotide repeat sequence has at least about 36 repeats, at least about 40 repeats, at least about 50 repeats, at least about 60 repeats, at least about 70 repeats, at least about 80 repeats, at least about 90 repeats, at least about 100 repeats, at least about 110 repeats, at least about 120 repeats, or more.

[0600] In some embodiments, the expanded nucleotide repeat sequence comprises CAG.

[0601] In some embodiments, the method reduces the expression of a gene having an expanded nucleotide repeat sequence. In some embodiments, the expression is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95% or more compared to an untreated individual.

[0602] In some embodiments, the gene is huntingtin (HTT).

[0603] In another aspect, provided herein is a method of treating Huntington's disease (HD) in a patient in need thereof, the method comprising administering to the patient a transcriptional regulator molecule having a first end, a second end, and an oligomeric backbone, wherein

[0604] (a) the first end comprises a DNA binding portion, and the DNA binding portion is capable of binding to a nucleotide repeat sequence comprising CAG;

[0605] (b) the second end comprises a protein binding portion, the protein binding portion being capable of binding to a regulatory molecule that regulates the expression of a gene having an expanded nucleotide repeat sequence; and

[0606] (c) the oligomeric backbone connects the first end and the second end; and

[0607] wherein the DNA binding moiety comprises -NH-QC(O)-, wherein Q is an optionally substituted C 6-10 arylene, an optionally substituted 4- to 10-membered heterocyclylene, an optionally substituted 5- to 10-membered heteroarylene, or an optionally substituted alkylene.

[0608] In some embodiments, the DNA binding moiety comprises a polyamide.

[0609] In some embodiments, the DNA binding moiety comprises a polyamide having one or more subunits selected from:

[0610]

[0611]

[0612] -NH-benzopyrazinylene-C(O)-, -NH-phenylene-C(O)-, -NH-pyridinylene-C(O)-, -NH-piperidinylene-C(O)-, -NH-pyrimidinylene-C(O)-, -NH-anthracenylene-C(O)-, -NH-quinolinylene-C(O)-, and wherein each R' is independently hydrogen, optionally substituted C 1 -C 20 Alkyl C 1 -C 20 Heteroalkyl, C 1 -C 20 Haloalkyl or C 1 -C 20 Alkylamino; and Z is H, NH 2 , C 1 -C 6 Alkyl, C 1 -C 6 Haloalkyl or C 1 -C 6 Alkyl-NH 2 .

[0613] In some embodiments, the DNA binding moiety comprises the structure of any one of Formula (A-1) to Formula (A-13).

[0614] In some embodiments, the methods reduce one or more symptoms of Huntington's disease.

[0615] In some embodiments, the one or more symptoms are selected from chorea, cognitive impairment, sexual dysfunction, eye movement abnormalities, olfactory abnormalities, aggression, agitation, anxiety, apathy, bradykinesia, slow thinking, clumsiness, delusions, depression, difficulty walking, disinhibition, catatonia, gait imbalance, muscle weakness, hallucinations, hostility, hypokinesia, irritability, memory impairment, myoclonus, obsessive-compulsive behavior, poor fine motor coordination, epilepsy, dysphonia, staring, weight loss, abnormal cholesterol metabolism, abnormal white matter, alcoholism, Babinski sign, caudate nucleus atrophy, brain atrophy, apnea, clonus, striatal degeneration, excessive daytime sleepiness, impaired visual-spatial constructive cognition, inability to walk, insomnia, mutism, oropharyngeal dysphagia, rigidity, suicidal ideation, cerebellar atrophy, dementia, gait ataxia, gliosis, hyperreflexia, neuronal loss, or personality changes.

[0616] Pharmaceutical compositions and administration

[0617] In some embodiments, provided herein are compositions comprising a therapeutically effective amount of a transcriptional regulator molecule described herein (also referred to herein as an "agent").

[0618] Pharmaceutical compositions can be formulated using one or more physiologically acceptable carriers, including excipients and adjuvants that facilitate the processing of medicaments into pharmaceutically used preparations. Appropriate formulations depend on the selected route of administration. An overview of pharmaceutical compositions is found in, for example, Remington: The Science and Practice of Pharmacy, 19th edition (Easton, Pa., Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, HA and Lachman, L., eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, 7th edition (Lippincott Williams and Wilkins, 1999).

[0619] The compositions and methods disclosed herein can be used to treat individuals in need. In certain embodiments, the individual is a mammal, such as a human, or a non-human mammal. When administered to an animal, such as a human, the composition or medicament is preferably administered in the form of a pharmaceutical composition, which comprises, for example, a medicament and a pharmaceutically acceptable carrier or excipient. Pharmaceutically acceptable carriers are well known in the art and include, for example, aqueous solutions, such as water or physiologically buffered saline, or other solvents or vehicles, such as glycols; glycerol; oils, such as olive oil; or injectable organic esters. In a preferred embodiment, when such pharmaceutical compositions are used for human administration, especially for invasive administration routes, such as routes that avoid transport or diffusion through epithelial barriers, such as injection or implantation, the aqueous solution is pyrogen-free or substantially pyrogen-free. The selected excipient can, for example, achieve delayed release of the agent or selectively target one or more cells, tissues or organs. The pharmaceutical composition can be in the form of a unit dosage form, such as a tablet, capsule, granule, lyophilized agent for reconstitution, powder, solution, slurry, suppository, injection, etc. The composition may also be presented in a transdermal delivery system, such as a skin patch. The composition may also be presented in a solution suitable for topical administration, such as eye drops.

[0620] Pharmaceutically acceptable excipients may contain physiologically acceptable agents, which are used, for example, to stabilize compounds such as pharmaceutical agents, increase solubility, or increase absorption. Such physiologically acceptable agents include, for example, carbohydrates such as glucose, sucrose, or dextran; antioxidants such as ascorbic acid or glutathione; chelating agents, low molecular weight proteins, or other stabilizers or excipients. The selection of pharmaceutically acceptable excipients including physiologically acceptable agents depends, for example, on the route of administration of the composition. The formulation or pharmaceutical composition may be a self-emulsifying drug delivery system or a self-microemulsifying drug delivery system. The pharmaceutical composition (formulation) may also be a liposome or other polymer matrix, into which, for example, a compound of the present invention may be incorporated. Liposomes are physiologically acceptable and metabolizable non-toxic carriers that are relatively easy to prepare and administer, for example, comprising phospholipids or other lipids.

[0621] The pharmaceutical composition (preparation) can be administered to a subject by any of a variety of routes of administration, including, for example, oral administration, such as a drenching solution in the form of an aqueous or non-aqueous solution or suspension, tablets, capsules (including dispersible capsules and gelatin capsules), boluses, powders, granules, pastes applied to the tongue; absorption through the oral mucosa, such as sublingually; anal, rectal or vaginal administration, such as in the form of a pessary, cream or foam; parenteral, including intramuscular, intravenous, subcutaneous or intrathecal, such as in the form of a sterile solution or suspension; nasal; intraperitoneal; subcutaneous; transdermal, such as in the form of a patch applied to the skin; and topical, such as in the form of a cream, ointment or spray applied to the skin, or in the form of eye drops. The compound may also be formulated for inhalation. In certain embodiments, the compound may simply be dissolved or suspended in sterile water.

[0622] The pharmaceutical composition can be a sterile aqueous solution or a non-aqueous solution, a suspension or an emulsion, such as a microemulsion. The excipients described herein are examples and do not constitute a limitation. An effective amount or therapeutically effective amount refers to an amount of one or more agents administered to a subject in a single dose or as part of a series of doses to effectively produce the desired therapeutic effect.

[0623] The subject can generally monitor the effectiveness of treatment using assays and methods suitable for the condition being treated, which assays will be familiar to those of ordinary skill in the art and are described herein. The pharmacokinetics of an agent or one or more metabolites thereof administered to a subject can be monitored by determining the amount of the agent or metabolite in a biological fluid, such as blood, blood components (e.g., serum), and / or urine, and / or other biological samples or biological tissues from the subject. Any method of detecting an agent implemented in the art and described herein can be used to measure the amount of an agent or metabolite during the course of treatment.

[0624] The dosage of the medicaments described herein for treating diseases or conditions may depend on the condition of the subject, i.e., the stage of the disease, the severity of the symptoms caused by the disease, general health, and age, sex, and weight, as well as other factors that are apparent to the technicians in the medical field. The pharmaceutical composition can be administered in a manner suitable for the disease to be treated as determined by the technicians in the medical field. In addition to the factors described herein and above regarding the use of medicaments to treat diseases or conditions, the suitable duration and frequency of medicament administration may also be determined or adjusted by factors such as the patient's condition, the type and severity of the patient's disease, the specific form of the active ingredient, and the method of administration. Experimental models and / or clinical trials can generally be used to determine the optimal dose of the medicament. The optimal dose may depend on the subject's body mass, body weight, or blood volume. It is generally preferred to use the minimum dose sufficient to provide an effective therapy. The design and execution of the preclinical and clinical studies of the medicaments described herein (including when administered for preventive benefits) are completely within the technical scope of the technicians in the relevant field. When two or more medicaments are administered to treat a disease or condition, the optimal dose of each medicament may be different, such as less than the dose when any medicament is administered alone as a monotherapy. In some specific embodiments, two kinds of drug combinations can play a synergistic or additive effect, and any medicament can be used less than the amount used when used alone. The amount of the medicament that can be used every day can be, for example, between about 0.01mg / kg and 100mg / kg, for example, between about 0.1 to 1mg / kg, between about 1 to 10mg / kg, between about 10 to 50mg / kg, between about 50 to 100mg / kg body weight. In other embodiments, the amount of the medicament that can be used every day is between about 0.01mg / kg and 1000mg / kg, between about 100 to 500mg / kg or between about 500 to 1000mg / kg body weight. The optimum dose for disease to be treated or illness every day or each treatment process can be different, and can also change with route of administration and treatment regimen.

[0625] The pharmaceutical composition comprising the agent can be formulated in a manner suitable for the delivery method using techniques commonly practiced in the art. The composition can be in solid form, such as tablets, capsules; semi-solid form, such as gel; liquid or gaseous form, such as aerosol. In other embodiments, the pharmaceutical composition is administered in the form of a bolus infusion.

[0626] Pharmaceutically acceptable excipients are well known in the pharmaceutical field and are described, for example, in Rowe et al., Handbook of Pharmaceutical Excipients: A Comprehensive Guide to Uses, Properties, and Safety, 5th edition, 2006; and Gennaro, 21st edition, Mack Pub. Co., Easton, PA (2005). Exemplary pharmaceutically acceptable excipients include sterile saline and phosphate buffered saline at physiological pH. Preservatives, stabilizers, dyes, buffers, etc. may be provided in the pharmaceutical composition. In addition, antioxidants and suspending agents may also be used. In general, the type of excipient is selected based on the mode of administration and the chemical composition of the active ingredient. Alternatively, the compositions described herein may be formulated as lyophilizates. The compositions described herein may be lyophilized or otherwise formulated as lyophilized products using one or more suitable excipient solutions to dissolve and / or dilute the medicament of the composition when administered. In other embodiments, the agent may be encapsulated within a liposome using techniques known and practiced in the art. In certain specific embodiments, the agent is not formulated within a liposome for application to a stent for treatment of highly obstructed but not completely obstructed arteries. The pharmaceutical composition may be formulated for any suitable mode of administration described herein and in the art.

[0627] Pharmaceutical compositions, such as those for oral administration or for injection, infusion, subcutaneous delivery, intramuscular delivery, intraperitoneal delivery or other methods, may be in liquid form. Liquid pharmaceutical compositions may include, for example, one or more of the following: sterile diluents, such as water, physiological saline solution (preferably physiological saline), Ringer's solution, isotonic sodium chloride, non-volatile oils that can serve as solvents or suspension media, polyethylene glycol, glycerol, propylene glycol or other solvents; antibacterial agents; antioxidants; chelating agents; buffers and agents for adjusting tension, such as sodium chloride or dextrose. Parenteral compositions may be packaged in ampoules, disposable syringes or multi-dose vials made of glass or plastic. Physiological saline is preferably used, and injectable pharmaceutical compositions are preferably sterile. In another embodiment, in order to treat ocular conditions or diseases, liquid pharmaceutical compositions may be applied to the eyes in the form of eye drops. Liquid pharmaceutical compositions may be delivered orally.

[0628] For oral formulations, at least one of the medicaments described herein can be used alone or in combination with suitable additives to make tablets, powders, granules or capsules, and if necessary, used in combination with diluents, buffers, wetting agents, preservatives, coloring agents and flavoring agents. The medicament can be formulated with a buffer so that the compound can resist the low pH of the gastric environment, and / or formulated with an enteric coating. The medicament included in the pharmaceutical composition can be formulated for oral delivery together with flavoring agents, such as in a liquid, solid or semisolid formulation and / or with an enteric coating.

[0629] Pharmaceutical compositions comprising any of the agents described herein can be formulated for sustained or slow release, also referred to as timed release or controlled release. Such compositions can generally be prepared using well-known techniques and administered by, for example, oral, rectal, intradermal or subcutaneous implantation or by implantation at a desired target site. Sustained release formulations may contain compounds dispersed in a carrier matrix and / or contained in a reservoir surrounded by a rate-controlling membrane. The excipients used in such formulations are biocompatible and may also be biodegradable; formulations preferably provide a relatively constant content of active ingredient release. The amount of the agent contained in the sustained release formulation depends on the implantation site, the rate of release, and the expected duration and the nature of the condition, disease or illness to be treated or prevented.

[0630] In certain embodiments, the pharmaceutical composition comprising the medicament is formulated for transdermal, intradermal or topical administration. The composition can be applied in the form of powder / talcum or other solid, liquid, spray, aerosol, ointment, foam, cream, gel, paste using a syringe, bandage, transdermal patch, insert or syringe-like applicator. This is preferably applied topically or directly injected into the skin near the treated area or the treated area in the form of a controlled release formulation or a sustained release formulation, such as intradermal or subcutaneous injection. The active composition can also be delivered via iontophoresis. Preservatives can be used to prevent the growth of fungi and other microorganisms. Suitable preservatives include but are not limited to benzoic acid, butyl parahydroxybenzoate, ethyl parahydroxybenzoate, methyl parahydroxybenzoate, propyl parahydroxybenzoate, sodium benzoate, sodium propionate, benzalkonium chloride, benzyl chloride, benzyl alcohol, cetyl pyridinium chloride, chlorobutanol, phenol, phenylethyl alcohol, thimerosal and combinations thereof.

[0631] The pharmaceutical composition comprising the medicament can be formulated as an emulsion for topical application. The emulsion contains a liquid distributed in a second liquid body. The emulsion can be a water-in-oil emulsion or an oil-in-water emulsion. Either or both of the oil phase and the aqueous phase can contain one or more surfactants, emulsifiers, emulsion stabilizers, buffers and other excipients. The oil phase can contain other oily pharmaceutically approved excipients. Suitable surfactants include, but are not limited to, anionic surfactants, nonionic surfactants, cationic surfactants and amphoteric surfactants. The composition for topical application can also include at least one suitable suspending agent, antioxidant, chelating agent, softener or moisturizer.

[0632] Ointments and creams can be formulated, for example, with aqueous or oily bases and with the addition of suitable thickeners and / or gelling agents. Lotions can be formulated with aqueous or oily bases and generally also contain one or more emulsifiers, stabilizers, dispersants, suspending agents, thickeners or coloring agents. Liquid sprays can be self-pressurized packaging, for example, delivered via a specially formed closure. Oil-in-water emulsions can also be used in compositions, patches, bandages and products. These systems are semisolid emulsions, microemulsions or foam emulsion systems.

[0633] definition

[0634] As used herein, the following terms have the indicated meanings.

[0635] It is understood that certain group naming conventions may include monovalent groups or divalent groups depending on the context. For example, when a substituent requires two points of attachment to the rest of the molecule, it is understood that the substituent is a divalent group. For example, a substituent identified as an alkyl group that requires two points of attachment includes a divalent group, such as -CH 2 -、-CH 2 CH 2 -、-CH 2 CH(CH 3 )CH 2 - etc. Other group naming conventions explicitly indicate that the group is a divalent group, such as "alkylene", "alkenylene", "arylene", "heteroarylene".

[0636] When exposing a range of values, and using "n 1…… to n 2 " or "in n 1…… With n 2 The expression "between" is used, where n 1 and n 2When it is a number, unless otherwise specified, this notation is intended to include the number itself and the range therebetween. This range can be an integer value or a continuous value between the end values ​​and includes the end values. For example, the range of "2 to 6 carbons" is intended to include two, three, four, five and six carbons, because carbon appears in integer units. For example, the comparison range "1 to 3 μM (micromolar concentration)" (which is intended to include 1 μM, 3 μM and all values ​​therebetween) is compared with any number of significant figures (e.g., 1.255 μM, 2.1 μM, 2.9999 μM, etc.).

[0637] As used herein, the term "about" is intended to qualify the numerical value it modifies, expressing such value as a variable within a margin of error. When a specific margin of error, such as the standard deviation of a mean value given in a data graph or table, is not recited, the term "about" should be understood to mean the range encompassing the stated value and the range included by rounding of the stated number, taking into account significant figures.

[0638] The term "polyamide" refers to a polymer in which linkable units are chemically bonded via amide (i.e., CONH) linkages; optionally, the polyamide includes a chemical probe conjugated thereto. Polyamides can be synthesized by stepwise condensation of formic acid (COOH) with amines (RR'NH) using methods known in the art. Alternatively, polyamides can be formed in vitro using enzyme reactions or by fermentation using microorganisms.

[0639] The term "linkable unit" refers to methylimidazole, methylpyrrole and straight and branched aliphatic functional groups (e.g., methylene, ethylene, propylene, butylene, etc.) optionally containing nitrogen substituents, and chemical derivatives thereof. The aliphatic functional group of the linkable unit can be provided, for example, by condensing B-alanine or dimethylaminopropylamine during the synthesis of polyamide using methods well known in the art.

[0640] The term "linker" or "oligomeric backbone" refers to a chain of at least 10 consecutive atoms. In certain embodiments, the linker contains no more than 20 non-hydrogen atoms. The term linker and oligomeric backbone are used interchangeably. In some embodiments, the linker contains no more than 40 non-hydrogen atoms. In some embodiments, the linker contains no more than 60 non-hydrogen atoms. In certain embodiments, the linker contains atoms selected from C, H, N, O and S. In some embodiments, each non-hydrogen atom is chemically bonded to 2 adjacent atoms in the linker, or to one adjacent atom in the linker and the end of the linker. In some embodiments, the linker forms an amide bond with at least one of the two other groups to which it is connected. In certain embodiments, the linker forms an ester bond or an ether bond with at least one of the two other groups to which it is connected. In some embodiments, the linker forms a thioester or thioether bond with at least one of the two other groups to which it is connected. In some embodiments, the linker forms a direct carbon-carbon bond with at least one of the two other groups to which it is connected. In some embodiments, the linker forms an amine or amide bond with at least one of the two other groups to which it is connected. In some embodiments, the linker comprises -(CH 2 OCH 2 In some embodiments, the linker comprises -(CH(CH 3 )OCH 2 In some embodiments, the linker comprises -(CH 2 NR N CH 2 ) unit, R N =C 1-4 In some embodiments, the linker comprises an arylene, cycloalkylene, or heterocycloalkylene moiety.

[0641] The term "spacer" refers to a chain of at least 5 consecutive atoms. In some embodiments, the spacer contains no more than 10 non-hydrogen atoms. In some embodiments, the spacer contains atoms selected from C, H, N, O, and S. In some embodiments, the spacer forms an amide bond with the two other groups to which it is attached. In certain embodiments, the spacer comprises -(CH 2 OCH 2 In some embodiments, the spacer comprises -(CH 2 NR N CH 2 )-unit, R N =C 1-4 In some embodiments, the spacer contains at least one positive charge at physiological pH.

[0642] The term "turn component" refers to a chain of about 4 to 10 consecutive atoms. In some embodiments, the turn component contains atoms selected from C, H, N, O, and S. In some embodiments, the turn component forms an amide bond with the two other groups to which it is attached. In some embodiments, the turn component contains at least one positive charge at physiological pH.

[0643] The terms "nucleic acid" and "nucleotide" refer to ribonucleotides and deoxyribonucleotides, and analogs thereof, which are well known in the art.

[0644] The term "oligonucleotide sequence" refers to a plurality of nucleic acids of defined sequence and length (eg, 2, 3, 4, 5, 6 or even more nucleotides). The term "oligonucleotide repeat sequence" refers to a continuous stretch of an oligonucleotide sequence.

[0645] The term "transcription" as well known in the art refers to the synthesis of RNA (i.e., ribonucleic acid) using RNA polymerase guided by DNA. The term "regulating transcription" refers to changes in transcription levels, which can be measured by methods well known in the art, such as assays of transcript mRNA. In certain embodiments, regulation is to increase transcription. In other embodiments, regulation is to reduce transcription.

[0646] The term "acyl" as used herein, alone or in combination, refers to a carbonyl group attached to an alkenyl, alkyl, aryl, cycloalkyl, heteroaryl, heterocycle or any other moiety, wherein the atom attached to the carbonyl group is carbon. "Acetyl" refers to -C(O)CH 3 "Alkylcarbonyl" or "alkanoyl" refers to an alkyl group attached to the parent molecular moiety through a carbonyl group. Examples of such groups include methylcarbonyl and ethylcarbonyl. Examples of acyl groups include formyl, alkanoyl and aroyl.

[0647] The term "alkenyl" used herein, alone or in combination, refers to a straight or branched hydrocarbon group having one or more double bonds and containing 2 to 20 carbon atoms. In certain embodiments, the alkenyl group will contain 2 to 6 carbon atoms. The term "alkenylene" refers to a carbon-carbon double bond system connected at two or more positions, such as vinylene [(-CH=CH-), (-C::C-)]. Examples of suitable alkenyl groups include vinyl, propenyl, 2-methylpropenyl, 1,4-butadienyl, etc. Unless otherwise indicated, the term "alkenyl" may include "alkenylene".

[0648] The term "alkoxy" as used herein, alone or in combination, refers to an alkyl ether radical, wherein the term alkyl is as defined below. Examples of suitable alkyl ether radicals include methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, and the like.

[0649] The term "alkyl" as used herein, alone or in combination, refers to a straight or branched chain alkyl group containing 1 to 20 carbon atoms. In certain embodiments, the alkyl group will contain 1 to 10 carbon atoms. In other embodiments, the alkyl group will contain 1 to 8 carbon atoms. The alkyl group may be optionally substituted as defined herein. Examples of alkyl groups include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, hexyl, octyl, nonyl, etc. The term "alkylene" as used herein, alone or in combination, refers to a saturated aliphatic group derived from a straight or branched chain saturated hydrocarbon attached at two or more positions, such as a methylene group (-CH 2 -). Unless otherwise specified, the term "alkyl" may include "alkylene".

[0650] The term "alkylamino" as used herein, alone or in combination, refers to an alkyl group attached to the parent molecular moiety through an amino group. Suitable alkylamino groups can be mono- or di-alkylated to form groups such as N-methylamino, N-ethylamino, N,N-dimethylamino, N,N-ethylmethylamino, and the like.

[0651] The term "alkylene" as used herein, alone or in combination, refers to an alkenyl group wherein one carbon atom of the carbon-carbon double bond belongs to the portion to which the alkenyl group is attached.

[0652] The term "alkylthio" as used herein, alone or in combination, refers to an alkylthioether (RS-) group, wherein the term alkyl is as defined above and wherein the sulfur may undergo mono- or di-oxidation. Examples of suitable alkylthioether groups include methylthio, ethylthio, n-propylthio, isopropylthio, n-butylthio, isobutylthio, sec-butylthio, tert-butylthio, methanesulfonyl, ethanesulfinyl, and the like.

[0653] The term "alkynyl" used herein alone or in combination refers to a straight or branched hydrocarbon group having one or more triple bonds and containing 2 to 20 carbon atoms. In certain embodiments, the alkynyl comprises 2 to 6 carbon atoms. In other embodiments, the alkynyl comprises 2 to 4 carbon atoms. The term "alkynylene" refers to a carbon-carbon triple bond connected at two positions, such as ethynylene (-C:::C-, -C≡C-). The example of alkynyl includes ethynyl, propynyl, hydroxypropynyl, butyn-1-yl, butyn-2-yl, pentyn-1-yl, 3-methylbutyn-1-yl, hexyn-2-yl, etc. Unless otherwise indicated, the term "alkynyl" may include "alkynylene".

[0654] The terms "amide" and "carbamoyl" as used herein, alone or in combination, refer to an amino group as described below attached to the parent molecular moiety through a carbonyl group, or vice versa. The term "C-amide" as used herein, alone or in combination, refers to a -C(O)N(RR') group, wherein the indicated R and R' are as defined herein or as defined by a specifically enumerated "R". The term "N-amide" as used herein, alone or in combination, refers to a RC(O)N(R')- group, wherein the indicated R and R' are as defined herein or as defined by a specifically enumerated "R" group. The term "acylamino" as used herein, alone or in combination, encompasses an acyl group attached to the parent moiety through an amino group. Examples of "acylamino" are acetamido (CH 3 C(O)NH-).

[0655] The term "amide" as used herein, alone or in combination, refers to -C(O)NRR', wherein R and R' are independently selected from hydrogen, alkyl, acyl, heteroalkyl, aryl, cycloalkyl, heteroaryl, and heterocycloalkyl, any of which itself may be optionally substituted. In addition, R and R' may be combined to form a heterocycloalkyl, either of which may be optionally substituted. Amides may be formed by direct condensation of carboxylic acids with amines or by using acid chlorides. In addition, coupling reagents are known in the art and include carbodiimide-based compounds such as DCC and EDCI.

[0656] The term "amino" as used herein, alone or in combination, refers to -NRR', wherein R and R' are independently selected from hydrogen, alkyl, acyl, heteroalkyl, aryl, cycloalkyl, heteroaryl and heterocycloalkyl, any of which itself may be optionally substituted. In addition, R and R' may be combined to form a heterocycloalkyl, any of which may be optionally substituted.

[0657] The term "aryl" as used herein, alone or in combination, means a carbocyclic aromatic system containing one, two or three rings, wherein such polycyclic systems are fused together. The term "aryl" encompasses aromatic groups such as phenyl, naphthyl, anthracenyl and phenanthrenyl. The term "arylene" encompasses aromatic groups such as phenylene, naphthylene, anthracenylene and phenanthrenylene.

[0658] The term "arylalkenyl" or "aralkenyl," as used herein, alone or in combination, refers to an aryl group attached to the parent molecular moiety through an alkenyl group.

[0659] The term "arylalkoxy" or "aralkoxy," as used herein, alone or in combination, refers to an aryl group attached to the parent molecular moiety through an alkoxy group.

[0660] The term "arylalkyl" or "aralkyl," as used herein, alone or in combination, refers to an aryl group attached to the parent molecular moiety through an alkyl group.

[0661] The term "arylalkynyl" or "aralkynyl," as used herein, alone or in combination, refers to an aryl group attached to the parent molecular moiety through an alkynyl group.

[0662] The term "arylalkanoyl" or "aralkanoyl" or "aroyl", as used herein, alone or in combination, refers to an acyl radical derived from an aryl-substituted alkanoic acid, such as benzoyl, naphthoyl, phenylacetyl, 3-phenylpropionyl(hydrocinnamoyl), 4-phenylbutyroyl, (2-naphthyl)acetyl, 4-chlorohydrocinnamoyl, and the like.

[0663] The term aryloxy, as used herein, alone or in combination, refers to an aryl group attached to the parent molecular moiety through an oxy group.

[0664] The terms "benzo" and "benz", as used herein, alone or in combination, refer to a divalent radical C derived from benzene. 6 H 4 =. Examples include benzothiophene and benzimidazole.

[0665] The term "carbamate," as used herein, alone or in combination, refers to an ester of carbamic acid (-NHCOO-) which may be attached to the parent molecular moiety either from the nitrogen or the acid terminus, and which may be optionally substituted as defined herein.

[0666] The term "O-carbamyl," as used herein, alone or in combination, refers to a -OC(O)NRR' group, where R and R' are as defined herein.

[0667] The term "N-carbamyl," as used herein, alone or in combination, refers to a ROC(O)NR'- group, with R and R' as defined herein.

[0668] As used herein, the term "carbonyl" when used alone includes formyl [-C(O)H] and when used in combination is a -C(O)- group.

[0669] As used herein, the term "carboxyl" or "carboxy" refers to -C(O)OH or the corresponding "carboxylate" anion, such as in a carboxylate. "O-carboxyl" refers to a RC(O)O- group, where R is as defined herein. "C-carboxyl" refers to a -C(O)OR group, where R is as defined herein.

[0670] The term "cyano," as used herein, alone or in combination, refers to -CN.

[0671] The term "cycloalkyl" or alternatively "carbocycle" used herein alone or in combination refers to a saturated or partially saturated monocyclic, bicyclic or tricyclic alkyl, wherein each ring portion contains 3 to 12 carbon atom ring members and it may be optionally a benzo-fused ring system, which is optionally substituted as defined herein. In certain embodiments, the cycloalkyl will contain 5 to 7 carbon atoms. Examples of such cycloalkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, tetrahydronaphthyl, dihydroindenyl, octahydronaphthyl, 2,3-dihydro-1H-indenyl, adamantyl, etc. As used herein, "bicyclic" and "tricyclic" are intended to include fused ring systems, such as decahydronaphthalene, octahydronaphthalene, and both polycyclic (multi-center) saturated or partially unsaturated types. The latter isomer is generally exemplified by bicyclo[1,1,1]pentane, camphor, adamantane and bicyclo[3,2,1]octane.

[0672]

[0063] The term "ester," as used herein, alone or in combination, refers to a carboxyl group bridging two moieties linked at carbon atoms.

[0673] The term "ether," as used herein, alone or in combination, refers to an oxy group bridging two moieties linked at carbon atoms.

[0674]

[0046] The term "halo" or "halogen," as used herein, alone or in combination, refers to fluoro, chloro, bromo or iodo.

[0675] The term "haloalkoxy," as used herein, alone or in combination, refers to a haloalkyl group attached to the parent molecular moiety through an oxygen atom.

[0676] The term "haloalkyl" used herein alone or in combination refers to an alkyl group having the meaning defined above, wherein one or more hydrogens are replaced by halogens. Monohaloalkyl, dihaloalkyl and polyhaloalkyl are particularly included. Monohaloalkyl, for example, may contain iodine, bromine, chlorine or fluorine atoms in the group. Dihaloalkyl and polyhaloalkyl may have a combination of two or more identical halogen atoms or different halogens. Examples of haloalkyl include fluoromethyl, difluoromethyl, trifluoromethyl, chloromethyl, dichloromethyl, trichloromethyl, pentafluoroethyl, heptafluoropropyl, difluorochloromethyl, dichlorofluoromethyl, difluoroethyl, difluoropropyl, dichloroethyl and dichloropropyl. "Haloalkylene" refers to a haloalkyl group connected at two or more positions. Examples include fluoromethylene (-CFH-), difluoromethylene (-CF 2 -), chloromethylene (-CHCl-), etc.

[0677] The term "heteroalkyl" as used herein, alone or in combination, refers to a stable straight or branched chain, or a combination thereof, which is fully saturated or contains 1 to 3 degrees of unsaturation, and which consists of the specified number of carbon atoms and one to three heteroatoms selected from N, O and S, and wherein the N and S atoms may be optionally oxidized and the N heteroatom may be optionally quaternized. The heteroatom may be located at any interior position of the heteroalkyl group. Up to two heteroatoms may be consecutive, such as -CH2 -NH-OCH 3 .

[0678] The term "heteroaryl" as used herein, alone or in combination, refers to a 3 to 15 membered unsaturated heteromonocyclic or fused monocyclic, bicyclic or tricyclic ring system, wherein at least one fused ring is an aromatic ring containing at least one atom selected from N, O and S. In certain embodiments, the heteroaryl will contain 1 to 4 heteroatoms as ring members. In other embodiments, the heteroaryl will contain 1 to 2 heteroatoms as ring members. In certain embodiments, the heteroaryl will contain 5 to 7 atoms. The term also includes fused polycyclic groups, wherein a heterocyclic ring is fused to an aryl ring, wherein a heteroaryl ring is fused to another heteroaryl ring, wherein a heteroaryl ring is fused to a heterocycloalkyl ring, or wherein a heteroaryl ring is fused to a cycloalkyl ring. Examples of heteroaryl groups include pyrrolyl, pyrrolinyl, imidazolyl, pyrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazolyl, pyranyl, furanyl, thienyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thiadiazolyl, isothiazolyl, indolyl, isoindolyl, indolizinyl, benzimidazolyl, quinolyl, isoquinolyl, quinoxalinyl, quinazolinyl, indazolyl, benzotriazolyl, benzodioxolyl, benzopyranyl, benzoxazolyl, benzoxadiazolyl, benzothiazolyl, benzothiadiazolyl, benzofuranyl, benzothienyl, chromonyl, coumarinyl, benzopyranyl, tetrahydroquinolyl, tetrazolopyridazinyl, tetrahydroisoquinolyl, thienopyridinyl, furopyridinyl, pyrrolopyridinyl, and the like. Exemplary tricyclic heterocyclic groups include carbazolyl, benzindolyl, phenanthrolinyl, dibenzofuranyl, acridinyl, phenanthridinyl, xanthenyl, and the like.

[0679] The terms "heterocycloalkyl" and "heterocycle" used herein, alone or in combination, each refer to a saturated, partially unsaturated or fully unsaturated (but non-aromatic) monocyclic, bicyclic or tricyclic heterocyclic group containing at least one heteroatom as a ring member, wherein each of the heteroatoms may be independently selected from nitrogen, oxygen and sulfur. In certain embodiments, the heterocycloalkyl will contain 1 to 4 heteroatoms as ring members. In other embodiments, the heterocycloalkyl will contain 1 to 2 heteroatoms as ring members. In certain embodiments, the heterocycloalkyl will contain 3 to 8 ring members in each ring. In other embodiments, the heterocycloalkyl will contain 3 to 7 ring members in each ring. In other embodiments, the heterocycloalkyl will contain 5 to 6 ring members in each ring. "Heterocycloalkyl" and "heterocycle" are intended to include sulfones, sulfoxides, N-oxides of tertiary nitrogen ring members, and carbocyclic fused and benzofused ring systems; in addition, the two terms also include systems in which heterocycles are fused to aryl groups as defined herein, or additional heterocyclic groups. Examples of heterocyclic groups include tetrahydroisoquinoline, aziridinyl, azetidinyl, 1,3-benzodioxolyl, dihydroisoindolyl, dihydroisoquinolinyl, dihydrocinnolinyl, dihydrobenzodioxinyl, dihydro[1,3]oxazolo[4,5-b]pyridinyl, benzothiazolyl, dihydroindolyl, dihydropyridinyl, 1,3-dioxanyl, 1,4-dioxanyl, 1,3-dioxolanyl, isoindolyl, morpholinyl, piperazinyl, pyrrolidinyl, tetrahydropyridinyl, piperidinyl, thiomorpholinyl, etc. Unless specifically prohibited, the heterocyclic group may be optionally substituted.

[0680] The term "hydrazino," as used herein, alone or in combination, refers to two amino groups linked by a single bond, ie, -NN-.

[0681] The term "hydroxy," as used herein, alone or in combination, refers to -OH.

[0682] The term "hydroxyalkyl," as used herein, alone or in combination, refers to a hydroxy group attached to the parent molecular moiety through an alkyl group.

[0683] The term "imino," as used herein, alone or in combination, refers to =N-.

[0684] The term "iminohydroxy," as used herein, alone or in combination, refers to =N(OH) and =NO-.

[0685] The phrase "in the backbone" refers to the longest continuous or adjacent chain of carbon atoms starting at the point of attachment of a group to the compound or molecule of any of the formulae disclosed herein.

[0686] The term "isocyanato" refers to a -NCO group.

[0687] The term "isothiocyanato" refers to a -NCS group.

[0688] The term "mercaptyl," as used herein, alone or in combination, refers to an RS- group, with R as defined herein.

[0689] The term "nitro" as used herein, alone or in combination, refers to -NO 2 .

[0690] The term "oxy" or "oxa," as used herein, alone or in combination, refers to -O-.

[0691] The term "oxo," as used herein, alone or in combination, refers to =0.

[0692] The term "perhaloalkoxy" refers to an alkoxy group in which all of the hydrogen atoms are replaced by halogen atoms.

[0693] The term "perhaloalkyl," as used herein, alone or in combination, refers to an alkyl group in which all of the hydrogen atoms are replaced by halogen atoms.

[0694] The terms "sulfonate," "sulfonic acid," and "sulfonic acid," as used herein, alone or in combination, refer to -SO 3 H group and when a sulfonic acid is used to form a salt, it refers to its anion.

[0695] The term "thio," as used herein, alone or in combination, refers to -S-.

[0696] The term "sulfinyl," as used herein, alone or in combination, refers to -S(O)-.

[0697] The term "sulfonyl" as used herein, alone or in combination, refers to -S(O) 2 -.

[0698] The term "N-sulfonamido" refers to RS(=O) 2 An NR'-group, wherein R and R' are as defined herein.

[0699] The term "S-sulfonamido" refers to -S(=O) 2 NRR' group, wherein R and R' are as defined herein.

[0700]

[0043] The terms "thia" and "thio," as used herein, alone or in combination, refer to an -S- group or an ether wherein the oxygen is replaced by sulfur. The oxygenated derivatives of the thio group, i.e., sulfinyl and sulfonyl, are included within the definition of thia and thio.

[0701] The term "thiol," as used herein, alone or in combination, refers to a -SH group.

[0702] As used herein, the term "thiocarbonyl" when used alone includes thiocarbonyl -C(S)H and when used in combination is a -C(S)- group.

[0703] The term "N-thiocarbamyl" refers to a ROC(S)NR'- group, where R and R' are as defined herein.

[0704] The term "O-thiocarbamyl" refers to a -OC(S)NRR' group, where R and R' are as defined herein.

[0705] The term "thiocyanato" refers to a -CNS group.

[0706] The term "trihalomethanesulfonamide" refers to X 3 CS(O) 2 An NR- group, wherein X is halogen and R is as defined herein.

[0707] The term "trihalomethanesulfonyl" refers to X 3 CS(O) 2 - group, wherein X is halogen.

[0708] The term "trihalomethoxy" refers to 3 A CO- group wherein X is a halogen.

[0709] The term "trisubstituted silyl" as used herein, alone or in combination, refers to a silicone group substituted in three free valencies with groups listed herein under the definition of substituted amino. Examples include trimethylsilyl, tert-butyldimethylsilyl, triphenylsilyl, and the like.

[0710] Any definition herein may be used in combination with any other definition to describe a composite structural group. By convention, the trailing element of any such definition is the one that is connected to the parent group. For example, the composite group alkylamido will represent an alkyl group that is connected to the parent molecule through an amide group, and the term alkoxyalkyl will represent an alkoxy group that is connected to the parent molecule through an alkyl group.

[0711] When a group is defined as "absent", it means that the group does not exist.

[0712] The term "optionally substituted" means that the preceding group may be substituted or unsubstituted. When substituted, the substituents of the "optionally substituted" group may include, but are not limited to, one or more substituents independently selected from the following groups or specifically designated groups, alone or in combination: alkyl, alkenyl, alkynyl, alkanoyl, heteroalkyl, heterocycloalkyl, haloalkyl, haloalkenyl, haloalkynyl, perhaloalkyl, perhaloalkoxy, cycloalkyl, phenyl, aryl, aryloxy, alkoxy, haloalkoxy, oxo, acyloxy, carbonyl, carboxyl, alkylcarbonyl, carboxyl ester, carboxamido, cyano, hydrogen, halogen, hydroxyl, amino, lower alkylamino, arylamino, amide, nitro, thiol, alkylthio, haloalkylthio, perhaloalkylthio, arylthio, sulfonate, sulfonic acid, trisubstituted silane, N- 3 ,SH,SCH 3 、C(O)CH 3 , CO 2 CH 3 , CO 2 H, pyridyl, thiophene, furyl, carbamate and urea. Where structurally feasible, two substituents may be linked together to form a fused five-, six- or seven-membered carbocyclic or heterocyclic ring consisting of zero to three heteroatoms, for example to form methylenedioxy or ethylenedioxy. The optionally substituted group may be unsubstituted (e.g., -CH 2 CH 3 ), is completely replaced (e.g. -CF 2 CF 3 ), is substituted by a single (e.g. -CH 2 CH 2 F) or substituted at any level between full substitution and monosubstitution (e.g., -CH 2 CF 3 ). When substituents are described without describing the qualification conditions for substitution, both substituted and unsubstituted forms are encompassed. Where substituents are defined as "substituted", substituted forms are particularly desirable. In addition, different sets of optional substituents for a particular moiety may be defined as desired; in these cases, the optional substitutions will be according to the definition that usually follows the phrase "optionally substituted".

[0713] As used herein, a substituted group is derived from an unsubstituted parent group in which one or more hydrogen atoms have been exchanged for another atom or group. Unless otherwise specified, when a group is considered to be "substituted", it means that the group is substituted with one or more substituents independently selected from the following: 1 -C 6 Alkyl, C 1 -C 6 Alkenyl, C 1-C 6 Alkynyl, C 1 -C 6 Heteroalkyl, C 3 -C 7 Carbocyclic group (optionally substituted with halogen, C 1 -C 6 Alkyl, C 1 -C 6 Alkoxy, C 1 -C 6 Haloalkyl and C 1 -C 6 Haloalkoxy substitution), C 3 -C 7 Carbocyclyl-C 1 -C 6 Alkyl (optionally substituted with halogen, C 1 -C 6 Alkyl, C 1 -C 6 Alkoxy, C 1 -C 6 Haloalkyl and C 1 -C 6 haloalkoxy), 3 to 10 membered heterocyclic group (optionally substituted with halogen, C 1 -C 6 Alkyl, C 1 -C 6 Alkoxy, C 1 -C 6 Haloalkyl and C 1 -C 6 haloalkoxy substituted), 3 to 10 membered heterocyclyl-C 1 -C 6 Alkyl (optionally substituted with halogen, C 1 -C 6 Alkyl, C 1 -C 6 Alkoxy, C 1 -C 6 Haloalkyl and C 1 -C 6 haloalkoxy), aryl (optionally substituted with halogen, C 1 -C 6 Alkyl, C 1 -C 6 Alkoxy, C 1 -C 6 Haloalkyl and C 1 -C 6 Haloalkoxy substituted), aryl (C 1 -C 6 ) alkyl (optionally substituted with halogen, C 1 -C 6 Alkyl, C 1 -C6 Alkoxy, C 1 -C 6 Haloalkyl and C 1 -C 6 haloalkoxy), 5- to 10-membered heteroaryl (optionally substituted with halogen, C 1 -C 6 Alkyl, C 1 -C 6 Alkoxy, C 1 -C 6 Haloalkyl and C 1 -C 6 haloalkoxy substituted), 5 to 10 membered heteroaryl (C 1 -C 6 ) alkyl (optionally substituted with halogen, C 1 -C 6 Alkyl, C 1 -C 6 Alkoxy, C 1 -C 6 Haloalkyl and C 1 -C 6 haloalkoxy substituted), halogen, cyano, hydroxyl, C 1 -C 6 Alkoxy, C 1 -C 6 Alkoxy (C 1 -C 6 ) alkyl (ie, ether), aryloxy, sulfhydryl (mercapto), halide (C 1 -C 6 )alkyl (e.g. -CF 3 ), halogen (C 1 -C 6 ) alkoxy (e.g. -OCF 3 ), C 1 -C 6 Alkylthio, arylthio, amino, amino (C 1 -C 6 )alkyl, nitro, O-carbamoyl, N-carbamoyl, O-thiocarbamoyl, N-thiocarbamoyl, C-amide, N-amide, S-sulfonamido, N-sulfonamido, C-carboxyl, O-carboxyl, acyl, cyano, isocyanato, thiocyanato, isothiocyanato, sulfinyl, sulfonyl, and oxo (=O). Whenever it is described that a group is "optionally substituted", the group may be substituted by the above-mentioned substituents.

[0714] Unless otherwise defined, the term R or the term R', when occurring alone and in the absence of a specified number, refers to a moiety selected from the group consisting of hydrogen, alkyl, cycloalkyl, heteroalkyl, aryl, heteroaryl, and heterocycloalkyl, any of which is optionally substituted. Such R and R' groups are understood to be optionally substituted as defined herein. Regardless of whether the R group has a number designation, each R group (including R, R', and R') is n , wherein n=(1, 2, 3 ... n)), each substituent and each term should be understood to be independent of each other when selected from the group. If any variable, substituent or term (e.g., aryl, heterocycle, R, etc.) appears more than once in a formula or general structure, its definition at each occurrence is independent of the definition at each other occurrence. Those skilled in the art will further recognize that certain groups may be connected to the parent molecule or may occupy a position in the element chain from either end of the writing. For example, an asymmetric group (such as -C(O)N(R)-) may be connected to the parent part at carbon or nitrogen.

[0715] There are asymmetric centers in the compounds or molecules disclosed herein. Depending on the configuration of the substituents around the chiral carbon atom, these centers are represented by the symbols "R" or "S". It should be understood that the present disclosure encompasses all stereochemical isomeric forms, including diastereoisomers, enantiomers and epimers, as well as d-type isomers and 1-type isomers, and mixtures thereof. Individual stereoisomers of compounds or molecules can be synthesized from commercially available starting materials containing chiral centers, or by preparing a mixture of enantiomeric products, followed by separation, such as conversion into a mixture of diastereoisomers, followed by separation or recrystallization, chromatography techniques, direct separation of enantiomers on a chiral chromatographic column, or any other appropriate method known in the art. The starting compound or molecule of a specific stereochemistry is commercially available, or can be prepared and resolved by techniques known in the art. In addition, the compounds or molecules disclosed herein can exist in the form of geometric isomers. The present disclosure includes all cis, trans, syn, anti, E and Z isomers, and suitable mixtures thereof. In addition, compounds or molecules may exist as tautomers; all tautomers are provided by the present disclosure. In addition, compounds or molecules disclosed herein may exist in unsolvated form and in solvated form with pharmaceutically acceptable solvents such as water, ethanol, etc. In general, solvated forms are considered to be equivalent to unsolvated forms.

[0716] The term "bond" refers to a covalent bond between two atoms, or between two moieties when the atoms joined by the bond are considered to be part of a larger substructure. Unless otherwise specified, a bond may be a single bond, a double bond, or a triple bond. A dashed line between two atoms in a molecular diagram indicates that an additional bond may or may not be present at that location.

[0717] As used herein, the term "disease" is generally intended to be synonymous with and used interchangeably with the terms "disorder," "syndrome," and "condition" (as in medical condition), as these all reflect an abnormal condition of the human or animal body or a part thereof that impairs normal function, usually manifests itself in varying signs and symptoms, and results in a shortened life span or reduced quality of life in humans or animals.

[0718] The term "combination therapy" means the administration of two or more therapeutic agents to treat the therapeutic conditions or disorders described in the present disclosure. Such administration encompasses the co-administration of these therapeutic agents in a substantially simultaneous manner, such as in a single capsule with a fixed ratio of active ingredients or in multiple separate capsules for each active ingredient. In addition, such administration also encompasses the use of each type of therapeutic agent in a sequential manner. In either case, the treatment regimen will provide a beneficial effect of the drug combination in treating the conditions or disorders described herein.

[0719] The phrase "therapeutically effective" is intended to qualify the amount of active ingredient used to treat a disease or condition or to achieve a clinical indicator.

[0720] The term "therapeutically acceptable" refers to compounds or molecules (or salts, tautomers, zwitterionic forms, etc.) that are suitable for use in contact with patient tissues without undue toxicity, irritation and allergic response, meet a reasonable benefit / risk ratio, and are effective for their intended use.

[0721] As used herein, reference to "treating" a patient is intended to include prevention. Treatment may also be preemptive in nature, i.e., it may include preventing a disease. Preventing a disease may involve being completely free from the effects of the disease, such as in the case of preventing infection by a pathogen, or may involve preventing the progression of a disease. For example, preventing a disease may not mean completely eliminating any effects associated with the disease at any level, but may mean preventing symptoms of the disease at a clinically significant or detectable level. Preventing a disease may also mean preventing the disease from progressing to an advanced stage of the disease.

[0722] The term "patient" is generally synonymous with the term "subject" and includes all mammals, including humans. Examples of patients include humans; livestock, such as cows, goats, sheep, pigs, and rabbits; and companion animals, such as dogs, cats, rabbits, and horses. Preferably, the patient is a human.

[0723] The term "contacting" refers to bringing a compound (eg, a transcriptional regulator molecule of the present disclosure) into proximity with a desired target gene. Contacting can result in binding to the target moiety or in causing a conformational change in the target moiety.

[0724] The compounds or molecules disclosed herein may exist in the form of therapeutically acceptable salts. The present disclosure includes compounds or molecules listed above in the form of salts, including acid addition salts. Suitable salts include salts formed from organic and inorganic acids. Such acid addition salts will generally be pharmaceutically acceptable. However, in the preparation and purification of the compounds or molecules discussed, salts of non-pharmaceutically acceptable salts may also have utility. Base addition salts may also be formed and these salts are pharmaceutically acceptable. A more comprehensive discussion of the preparation and selection of salts may refer to "Pharmaceutical Salts: Properties, Selection, and Use" (Stahl, P. Heinrich. Wiley-VCHA, Zurich, Switzerland, 2002).

[0725] Base addition salts can be prepared during the final isolation and purification of the compound or molecule by reacting the carboxyl group with a suitable base, such as a hydroxide, carbonate or bicarbonate of a metal cation, or with ammonia or an organic primary, secondary or tertiary amine. The cations of therapeutically acceptable salts include lithium, sodium, potassium, calcium, magnesium and aluminum ions, and non-toxic quaternary amine cations, such as ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, diethylamine, ethylamine, tributylamine, pyridine, N,N-dimethylaniline, N-methylpiperidine, N-methylmorpholine, dicyclohexylamine, procaine, benzhydrylamine, N,N-dibenzylphenethylamine, 1-ephenamine and N,N'-dibenzylethylenediamine. Other representative organic amines suitable for forming base addition salts include ethylenediamine, ethanolamine, diethanolamine, piperidine and piperazine.

[0726] Other carrier materials and modes of administration known in the pharmaceutical art may also be used. The pharmaceutical compositions of the present disclosure may be prepared by any well-known pharmaceutical techniques, such as effective formulation and administration procedures. Preferred unit dose formulations are formulations containing an effective dose described below or an appropriate portion thereof of the active ingredient.

[0727] It will be understood that in addition to the ingredients particularly mentioned above the formulations described above may include other agents conventional in the art having regard to the type of formulation in question, for example formulations suitable for oral administration may include flavoring agents.

[0728] The amount of active ingredient that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration.

[0729] Compounds or molecules can be administered in various modes, such as orally, topically or by injection. The exact amount of the compound administered to the patient will be the responsibility of the attending physician. The specific dosage level of any particular patient will depend on a variety of factors, including the activity of the specific compound used, age, body weight, general health, sex, diet, administration time, administration route, excretion rate, drug combination, the exact condition treated, and the severity of the indication or condition treated. In addition, the route of administration can vary depending on the condition and its severity. The above considerations for effective formulation and administration procedures are well known in the art and are described in standard textbooks.

[0730] The present disclosure includes salts of the compounds described herein, particularly pharmaceutically acceptable salts. Compounds of the present invention having sufficient acidity, sufficient basicity, or both functional groups can react with any of a variety of inorganic bases and inorganic and organic acids to form salts. Alternatively, compounds that are inherently charged, such as those having quaternary nitrogen, can form salts with suitable counterions, such as halides, such as bromide, chloride, or fluoride, particularly bromide.

[0731] Chemical entities with carbon-carbon double bonds or carbon-nitrogen double bonds can exist in Z- or E-form (or cis- or trans-form). In addition, some chemical entities can exist in various tautomeric forms. Unless otherwise stated, the compounds described herein are also intended to include all Z-forms, E-forms, and tautomeric forms.

[0732] "Tautomers" refer to molecules in which a proton may shift from one atom of a molecule to another atom of the same molecule. In certain embodiments, the compounds presented herein exist as tautomers. In situations where tautomerization may occur, there will be a chemical equilibrium of tautomers. The exact ratio of tautomers depends on several factors, including physical state, temperature, solvent, and pH. Some examples of tautomeric equilibrium include:

[0733]

[0734] In some embodiments, the compounds disclosed herein are used in different isotopically enriched forms, such as 2 H. 3 H. 11 C. 13 C and / or 14C content. In a specific embodiment, the compound is deuterated at at least one position. Such deuterated forms can be prepared by the procedures described in U.S. Pat. Nos. 5,846,514 and 6,334,997. As described in U.S. Pat. Nos. 5,846,514 and 6,334,997, deuteration can improve metabolic stability and / or efficacy, thereby increasing the duration of drug action.

[0735] Unless otherwise stated, compounds described herein are intended to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, the replacement of a hydrogen by a deuterium or tritium or a carbon by a 13 C or 14 Compounds having the present structures other than C-enriched carbon substitutions are within the scope of this disclosure.

[0736] The compounds of the present disclosure optionally contain unnatural proportions of atomic isotopes at one or more atoms that constitute the compound. For example, the compound may be labeled with an isotope, such as deuterium ( 2 H), tritium ( 3 H), iodine-125 ( 125 I) or carbon-14 ( 14 C) Use 2 H. 11 C. 13 C. 14 C. 15 C. 12 N. 13 N. 15 N. 16 N. 16 O. 17 O. 14 F. 15 F. 16 F. 17 F. 18 F. 33 S. 34 S. 35 S. 36 S. 35 Cl, 37 Cl, 79 Br, 81 Br and 125 Isotopic substitutions are included. All isotopic variations of the compounds of the present invention, whether radioactive or not, are included within the scope of the present invention. In some embodiments, when isotopic variations are described, the remaining atoms of the compound may optionally contain an unnatural portion of atomic isotopes.

[0737] In certain embodiments, some or all of the compounds disclosed herein 1 H atoms are 2H atom replacement. Methods for synthesizing deuterium containing compounds are known in the art and include, by way of non-limiting example only, the following synthetic methods.

[0738] Deuterium substituted compounds are synthesized using various methods such as those described in Dean, Dennis C., ed., Recent Advances in the Synthesis and Applications of Radiolabeled Compounds for Drug Discovery and Development. [In: Current Drug Design (Curr., Pharm. Des.), 2000; 6 (10)] 2000, p. 110; George W.; Varma, Rajender S., The Synthesis of Radiolabeled Compounds via Organometallic Intermediates, Tetrahedron, 1989, 45 (21), 6601-21; and Evans, E. Anthony., Synthesis of radiolabeled compounds. compounds), Journal of Radioanalytical Chemistry (J. Radioanal. Chem.), 1981, 64(1-2), 9-32.

[0739] Deuterated starting materials are readily available and are subjected to the synthetic methods described herein to provide the synthesis of deuterated compounds. A large number of deuterated reagents and molecular building blocks are commercially available from chemical suppliers, such as Aldrich Chemical Company.

[0740] In some cases, the compounds described herein may exist as diastereomers, enantiomers, or other stereoisomeric forms. When absolute stereochemistry is not specified, the compounds presented herein include all diastereomers, enantiomers, and epimeric forms, as well as appropriate mixtures thereof. The separation of stereoisomers may be performed by chromatography or by forming diastereomers and utilizing recrystallization or chromatography separation or any combination thereof. (Jean Jacques, Andre Collet, Samuel H. Wilen, "Enantiomers, Racemates and Resolutions", John Wiley And Sons, Inc., 1981, incorporated herein by reference with respect to the disclosure). Stereoisomers may also be obtained by stereoselective synthesis.

[0741] The methods and compositions described herein include the use of amorphous forms as well as crystalline forms (also referred to as polymorphs). The compounds described herein may be in the form of pharmaceutically acceptable salts. In some embodiments, active metabolites of these compounds having the same type of activity are also included within the scope of the present disclosure. In addition, the compounds described herein may exist in unsolvated form as well as in solvated form with pharmaceutically acceptable solvents such as water, ethanol, etc. The solvated forms of the compounds presented herein are also considered to be disclosed herein.

[0742] Examples

[0743] The following examples are given for the purpose of illustrating various embodiments of the present invention and are not intended to limit the present invention in any way. The present examples and the methods described herein are representatives of currently preferred embodiments, are illustrative and are not intended to be limiting of the scope of the present invention. Those skilled in the art will know that changes and other uses thereof are encompassed within the scope of the spirit of the present invention as defined by the scope of the claims.

[0744] Compound synthesis

[0745] The compounds of the present disclosure can be prepared using the methods described in the general synthesis schemes and experimental procedures described in detail below. The general synthesis schemes and experimental procedures are provided for illustrative purposes and are not intended to be limiting. The starting materials used to prepare the compounds of the present disclosure can be commercially available or can be prepared using conventional methods known in the art.

[0746] Synthetic chemistry transformations and methods for synthesizing the compounds described herein are known in the art and include, for example, those described in R. Larock, Comprehensive Organic Transformations (1989); T. W. Greene and PGM Wuts, Protective Groups in Organic Synthesis, 2nd ed. (1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis (1995).

[0747] The following examples are intended to illustrate, but not limit, the disclosed embodiments. Scheme A describes the steps involved in preparing a polyamide, attaching the polyamide to an oligomeric backbone, and then attaching a ligand to the other end of the oligomeric backbone. The synthesis can be used to prepare transcriptional regulator molecules such as those listed in Table 4.

[0748] List of abbreviations

[0749] Ac 2 O = acetic anhydride; AcCl = acetyl chloride; AcOH = acetic acid; AIBN = azobisisobutyronitrile; aq. = aqueous / water solution; Bu 3 SnH = tributyltin hydride; CD 3 OD = deuterated methanol; CDCl 3 = deuterated chloroform; CDI = 1,1'-carbonyldiimidazole; DBU = 1,8-diazabicyclo[5.4.0]undec-7-ene; DCM = dichloromethane; DEAD = diethyl azodicarboxylate; DIBAL-H = diisobutylaluminum hydride; DIEA = DIPEA = N,N-diisopropylethylamine; DMAP = 4-dimethylaminopyridine; DMF = N,N-dimethylformamide; DMSO-d 6 = deuterated dimethyl sulfoxide; DMSO = dimethyl sulfoxide; DPPA = diphenylphosphoryl azide; EDC.HCl = EDCI.HCl = 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride; Et 2O = diethyl ether; EtOAc = ethyl acetate; EtOH = ethanol; h = hour; HATU = 2-(1H-7-azabenzotriazol-1-yl)-1,1,3,3-tetramethyluronium methylammonium hexafluorophosphate; HMDS = hexamethyldisilazane; HOBT = 1-hydroxybenzotriazole; i-PrOH = isopropanol; LAH = lithium aluminum hydride; LiHMDS = lithium bis(trimethylsilyl)amide; MeCN = acetonitrile; MeOH = methanol; M P-carbonate resin = macroporous triethylammonium methyl polystyrene carbonate resin; MsCl = methanesulfonyl chloride; MTBE = methyl tert-butyl ether; MW = microwave irradiation; n-BuLi = n-butyllithium; NaHMDS = sodium bis(trimethylsilyl)amide; NaOMe = sodium methoxide; NaOtBu = sodium tert-butoxide; NBS = N-bromosuccinimide; NCS = N-chlorosuccinimide; NMP = N-methyl-2-pyrrolidone; Pd(Ph 3 ) 4 =Tetrakis(triphenylphosphine)palladium(0); Pd 2 (dba) 3 = tris(dibenzylideneacetone)dipalladium(0); PdCl 2 (PPh 3 ) 2 = bis(triphenylphosphine)palladium(II) dichloride; PG = protecting group; prep-HPLC = preparative high performance liquid chromatography; PyBop = (benzotriazol-1-yloxy)tripyrrolidinophosphine hexafluorophosphate; Pyr = pyridine; RT = room temperature; RuPhos = 2-dicyclohexylphosphino-2',6'-diisopropoxybiphenyl; sat. = saturated; ss = saturated solution; t-BuOH = tert-butyl alcohol; T3P = propylphosphonic anhydride; TBS = TBDMS = tert-butyldimethylsilyl; TBSCl = TBDMSCl = tert-butyldimethylchlorosilane; TEA = Et 3 N = triethylamine; TFA = trifluoroacetic acid; TFAA = trifluoroacetic anhydride; THF = tetrahydrofuran; Tol = toluene; TsCl = toluenesulfonyl chloride; XPhos = 2-dicyclohexylphosphino-2',4',6'-triisopropylbiphenyl.

[0750] Synthesis of representative polyamides

[0751] Example 1. Synthesis of DNA Binding Moiety PA-004 Solution 1.

[0752]

[0753]

[0754] Step 1: Synthesis of methyl 3-[(4-[3-[(tert-butoxycarbonyl)amino]propionamido]-1-methylimidazol-2-yl)formamido]propanoate

[0755] 4-[3-[(tert-butoxycarbonyl)amino]propionamido]-1-methylimidazole-2-carboxylic acid (11.00 g, 35.22 mmol, 1.00 equivalent), DMF (300.00 mL) were added to a 1000 ml flask, the mixture was cooled to 0 ° C, HATU (20.09 g, 52.83 mmol, 1.50 equivalent), DIEA (18.21 g, 140.88 mmol, 4.00 equivalent) were then added dropwise, the mixture was stirred for 10 minutes, 3-aminopropionic acid methyl ester (3.63 g, 35.22 mmol, 1.00 equivalent) was added portionwise. The reaction was stirred at room temperature for 1.0 hour. The reaction mixture was poured into water / ice (600 mL), the solid was filtered out and dried in vacuo. The aqueous phase was extracted by EA (3×200 mL), and the organic phase was combined and filtered through H 2 O (1 × 200 mL) and NaCl (1 × 200 mL), and washed with anhydrous Na 2 SO 4 The mixture was dried. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by eluting with pure EA through a silica gel column. The fractions were combined and concentrated. Methyl 3-[(4-[3-[(tert-butoxycarbonyl)amino]propionamido]-1-methylimidazol-2-yl)formamido]propanoate (13.00 g, 87.95%) was obtained as a yellow solid. LC / MS: C 17 H 27 N 5 O 6 Calculated mass: 397.20, found: 398.20 [M+H] + .

[0756] Step 2: Synthesis of methyl 3-[[4-(3-aminopropionamido)-1-methylimidazol-2-yl)formamido]propanoate hydrochloride

[0757] The procedure was the same as for methyl 4-[4-(3-aminopropionamido)-1-methylimidazol-2-amido]-1-methylpyrrole-2-carboxylate hydrochloride, but the reaction time was 1.0 hour. Using 11.00 g of 3-[(4-[3-[(tert-butoxycarbonyl)amino]propionamido]-1-methylimidazol-2-yl)formamido]propanoate, 11.00 g of the crude desired product was obtained as a yellow oil. LC / MS: C 12 H 19 N 5 O 4 Calculated mass: 297.14, found: 298.20 [M+H] + .

[0758] Step 3: Synthesis of 1-methyl-4-(1-methylimidazole-2-amide)pyrrole-2-carboxylic acid methyl ester

[0759] To a stirred solution of 1-methylimidazole-2-carboxylic acid (10.00 g, 79.29 mmol, 7.00 equiv) in DMF (150.00 mL) was added TBTU (38.19 g, 118.94 mmol, 1.50 equiv), 4-amino-1-methylpyrrole-2-carboxylic acid methyl ester hydrochloride (16.63 g, 87.24 mmol, 1.10 equiv) and DIEA (30.74 g, 237.88 mmol, 3.00 equiv) portionwise at 0 °C. The resulting mixture was stirred at room temperature for 17.0 hours. The reactant was poured into water / ice (450 mL). The precipitated solid was collected by filtration and washed with H 2 O (3×50 mL) and dried in vacuo. 1-Methyl-4-(1-methylimidazole-2-amido)pyrrole-2-carboxylic acid methyl ester (16.5 g, 78.37%) was obtained as a white solid. LC / MS: C 12 H 14 N 4 O 3 Calculated mass: 262.11, found: 263.15 [M+H] + .

[0760] Step 4: Synthesis of 1-methyl-4-(1-methylimidazole-2-amide)pyrrole-2-carboxylic acid

[0761] The procedure was the same as 4-[3-[(tert-butoxycarbonyl)amino]propionamido]-1-methylimidazole-2-carboxylic acid. Using 16.50 g of 1-methyl-4-(1-methylimidazole-2-amido)pyrrole-2-carboxylic acid methyl ester, 12.00 g of 1-methyl-4-(1-methylimidazole-2-amido)pyrrole-2-carboxylic acid was obtained as a white solid (76.84% yield). LC / MS: C 11 H 12 N 4 O 3 Calculated mass: 248.09, found: 249.10 [M+H] + .

[0762] Step 5: Synthesis of 1-methyl-4-[1-methyl-4-(3-[[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido]propionamido)imidazol-2-amido]pyrrole-2-carboxylic acid methyl ester

[0763] The procedure was the same as ethyl 3-[(4-[3-[(tert-butoxycarbonyl)amino]propionamido]-1-methylimidazol-2-yl)formamido]propanoate. Using 9.00 g of 1-methyl-4-(1-methylimidazol-2-amido)pyrrole-2-carboxylic acid, 14.00 g of the desired product was obtained as a yellow solid (63.54% yield). LC / MS: C 26 H 30 N 10 O 6 Calculated mass: 578.23, Found: 579.10 [M+H] + .

[0764] Step 6: Synthesis of 1-methyl-4-[1-methyl-4-(3-[[1-methyl-4-(1-methylimidazol-2-amide)pyrrol-2-yl]formamido]propionamido)imidazol-2-amide]pyrrole-2-carboxylic acid

[0765] The procedure was the same as for 4-[3-[(tert-butoxycarbonyl)amino]propionamido]-1-methylimidazole-2-carboxylic acid. Using 14.00 g of methyl 1-methyl-4-[1-methyl-4-(3-[[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido]propionamido)imidazol-2-amido]pyrrol-2-yl]formamidocarboxylate, 12.00 g of the desired product was obtained as a yellow solid (81.49% yield). LC / MS: C 25 H 28 N 10 O 6 Calculated mass: 564.22, found: 565.15 [M+H] + .

[0766] Step 7: Synthesis of ethyl 4-{4-[(tert-butoxycarbonyl)amino]butyramido}-1-methylimidazole-2-carboxylate

[0767] The procedure was the same as ethyl 4-[3-[(tert-butoxycarbonyl)amino]propionamido]-1-methylimidazole-2-carboxylate. 7.80 g of 4-[(tert-butoxycarbonyl)amino]butyric acid was obtained. 11.00 g of the desired product was obtained as a pink solid (80.70% yield). LC / MS: C 16 H 26 N 4 O 5 Calculated mass: 354.19, found: 355.15 [M+H] + .

[0768] Step 8: Synthesis of ethyl 4-(4-aminobutyramido)-1-methylimidazole-2-carboxylate

[0769] The procedure was the same as methyl 4-[4-(3-aminopropionamido)-1-methylimidazol-2-amido]-1-methylpyrrole-2-carboxylate hydrochloride. Using 9.40 g of ethyl 4-{4-[(tert-butoxycarbonyl)amino]butanamido}-1-methylimidazol-2-carboxylate, 6.20 g of the desired product was obtained as a white solid (90.89% yield). LCMS: C 11 H 18 N 4 O 3 Calculated mass: 254.14, found: 255.15 [M+H] + .

[0770] Step 9: Synthesis of 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-amido]pyrrol-2-yl}formamido)butyramido]imidazole-2-carboxylic acid ethyl ester

[0771] To a stirred solution of 1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazole-2-amido]pyrrole-2-carboxylic acid (18.20 g, 32.24 mmol, 1.00 equiv) in DMF (250.0 mL) at 0°C was added DIEA (12.50 g, 96.71 mmol, 3.00 equiv), ethyl 4-(4-aminobutyramido)-1-methylimidazole-2-carboxylate (9.02 g, 35.46 mmol, 1.10 equiv) and PyBOP (20.13 g, 38.68 mmol, 1.20 equiv). The resulting mixture was stirred at room temperature for 1.0 h. The reactant was poured into ice / water (800 mL). The precipitated solid was collected by filtration and washed with H 2 O (3×200 mL), and dried in vacuo. 24.70 g of ethyl 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-amido]pyrrol-2-yl}formamido)butanamido]imidazole-2-carboxylate was obtained as a yellow solid (95.74% yield). LC / MS: C 36 H 44 N 14 O 8 Calculated mass: 800.35, found: 801.30 [M+H] + .

[0772] Step 10: Synthesis of 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amide)pyrrol-2-yl]formamido}propionamido)imidazol-2-amide]pyrrol-2-yl}formamido)butyramido]imidazole-2-carboxylic acid

[0773] The procedure was the same as for 4-[3-[(tert-butoxycarbonyl)amino]propionamido]-1-methylimidazole-2-carboxylic acid. Using 24.00 g of ethyl 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-amido]pyrrol-2-yl}formamido)butanamido]imidazole-2-carboxylate, (23.10 g) of the desired product was obtained as a yellow solid (99.36% yield). LC / MS: C 34 H 40 N 14 O 8 Calculated mass: 772.32, found: 773.30 [M+H] + .

[0774] Step 11: Synthesis of ethyl 4-[4-[(tert-butoxycarbonyl)amino]-1-methylpyrrole-2-amide]-1-methylimidazole-2-carboxylate

[0775] To a stirred solution of 4-[(tert-butoxycarbonyl)amino]-1-methylpyrrole-2-carboxylic acid (11.50 g, 47.87 mmol, 1.00 equiv) in DMF (200.00 mL) at 0°C was added EDCI (22.94 g, 119.66 mmol, 2.50 equiv), ethyl 4-amino-1-methylimidazole-2-carboxylate (8.10 g, 47.87 mmol, 1.00 equiv) and DMAP (14.62 g, 119.66 mmol, 2.50 equiv). The resulting mixture was stirred at 35°C for 17.0 hours. After the reaction, the reactant was poured into 500 mL of ice / water. The precipitated solid was collected by filtration and washed with water (3×50 mL) and dried under vacuum. This resulted in ethyl 4-{4-[(tert-butoxycarbonyl)amino]-1-methylpyrrole-2-amido}-1-methylimidazole-2-carboxylate (16.00 g, 85.48% yield) as a pale yellow solid. LC / MS: C 18 H 25 N 5 O 5 Calculated mass: 391.19, found: 392.30 [M+H] + .

[0776] Step 12: Synthesis of ethyl 4-(4-amino-1-methylpyrrole-2-amide)-1-methylimidazole-2-carboxylate

[0777] To a stirred solution of ethyl 4-{4-[(tert-butoxycarbonyl)amino]-1-methylpyrrole-2-amido}-1-methylimidazole-2-carboxylate (16.00 g, 40.88 mmol, 1.00 equiv) in DCM (135.00 mL) was added TFA (45.00 mL) dropwise at room temperature. The resulting mixture was stirred at room temperature for 2.0 hours. The resulting mixture was concentrated in vacuo. The residue was washed with Et 2 The residual brown oil was diluted with 200 mL of 4% CO. The precipitated solid was collected by filtration and washed with Et 2 O (2 x 100 mL). The obtained solid was dried in vacuo. This gave ethyl 4-(4-amino-1-methylpyrrole-2-amido)-1-methylimidazole-2-carboxylate (16.00 g, crude product) as a brown solid. LC / MS: C 13 H 17 N 5 O 3 Calculated mass: 291.13, found: 292.15 [M+H] + .

[0778] Step 13: Synthesis of ethyl 4-(4-{3-[(tert-butoxycarbonyl)amino]propionamido}-1-methylpyrrole-2-amido)-1-methylimidazole-2-carboxylate

[0779] A solution of 4-(4-amino-1-methylpyrrole-2-amide)-1-methylimidazole-2-carboxylic acid ethyl ester (12.00 g, 41.19 mmol, 1.00 equiv) and 3-[(tert-butoxycarbonyl)amino]propionic acid (7.50 g, 39.64 mmol, 0.96 equiv), PyBOP (22.00 g, 42.28 mmol, 1.03 equiv), DIEA (45.00 g, 348.18 mmol, 8.45 equiv) in DMF (120.00 mL) was stirred at room temperature for 1.0 hour. The reactant was poured into ice water (400 mL) and the mixture was stirred for 15 minutes. The precipitated solid was collected by filtration and washed with water (3×150 mL) and dried in vacuo. The aqueous phase was extracted by EA (3×150 mL), and the combined organic phases were combined and purified by H 2 O (200 mL), washed with anhydrous Na 2 SO 4The product was dried. The solid was filtered off and the filtrate was concentrated. The residue was purified by silica gel column chromatography, eluting with PE / EA (1:8). The resulting 17.00 g of ethyl 4-(4-{3-[(tert-butoxycarbonyl)amino]propionamido}-1-methylpyrrole-2-amide)-1-methylimidazole-2-carboxylate (89.28% yield) was obtained as a yellow solid. LC / MS: C 21 H 30 N 6 O 6 Calculated mass: 462.22, found: 463.35 [M+H] + .

[0780] Step 14: Synthesis of 4-(4-{3-[(tert-butoxycarbonyl)amino]propionamido}-1-methylpyrrole-2-amido)-1-methylimidazole-2-carboxylic acid

[0781] The procedure was the same as for 4-[3-[(tert-butoxycarbonyl)amino]propionamido]-1-methylimidazole-2-carboxylic acid. Using 12.00 g of ethyl 4-(4-{3-[(tert-butoxycarbonyl)amino]propionamido}-1-methylpyrrole-2-amido)-1-methylimidazole-2-carboxylate, 10.00 g of the desired product was obtained as a white solid (88.81% yield). LC / MS: C 19 H 26 N 6 O 6 Calculated mass: 434.19, Found: 435.25 [M+H] + .

[0782] Step 15: Synthesis of ethyl 3-{[4-(4-{3-[(tert-butoxycarbonyl)amino]propionamido}-1-methylpyrrole-2-amide)-1-methylimidazol-2-yl]formamido}propanoate

[0783] A solution of 4-(4-{3-[(tert-butoxycarbonyl)amino]propionamido}-1-methylpyrrole-2-amido)-1-methylimidazole-2-carboxylic acid (10.00 g, 23.02 mmol, 1.00 equiv) and β-alanine ethyl ester hydrochloride (4.90 g, 31.90 mmol, 1.39 equiv), PyBOP (12.50 g, 24.02 mmol, 1.04 equiv), DIEA (9.00 g, 69.64 mmol, 3.03 equiv) in DMF (120.00 mL) was stirred at room temperature for 1.0 h. The reaction was quenched by adding water (500 mL) at room temperature. The resulting mixture was extracted with EtOAc (3×400 mL). The combined organic layers were washed with brine (3×200 mL) and purified by anhydrous Na 2 SO4 The mixture was dried. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography using PE / EA (1:8) as eluent to give ethyl {[4-(4-{3-[(tert-butoxycarbonyl)amino]propionamido}-1-methylpyrrole-2-amide)-1-methylimidazol-2-yl]formamido}propanoate (12.00 g, 93.80%) as a yellow solid. LC / MS: C 24 H 35 N 7 O 7 Calculated mass: 533.26, found: 534.30 [M+H] + .

[0784] Step 16: Synthesis of ethyl 3-({4-[4-(3-aminopropionamido)-1-methylpyrrole-2-amido]-1-methylimidazol-2-yl}formamido)propanoate

[0785] The procedure was the same as ethyl 4-(4-amino-1-methylpyrrole-2-amido)-1-methylimidazole-2-carboxylate. Using ethyl 3-{[4-(4-{3-[(tert-butoxycarbonyl)amino]propionamido}-1-methylpyrrole-2-amido)-1-methylimidazol-2-yl]formamido}propanoate, 12.00 g of the crude material of the desired product was obtained as a white solid. LC / MS: C 19 H 27 N 7 O 5 Calculated mass: 433.21, found: 434.25 [M+H] + .

[0786] Step 17: Synthesis of ethyl 3-[(1-methyl-4-{1-methyl-4-[3-({1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-amido]pyrrol-2-yl}formamido)butyramidyl]imidazol-2-yl}formamido)propionamido]pyrrol-2-amido}imidazol-2-yl)formamido]propanoate

[0787] The procedure was the same as 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-amido]pyrrol-2-yl}formamido)butyramido]imidazole-2-carboxylic acid ethyl ester. Using 10.00g of 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-amido]pyrrol-2-yl}formamido)butyramido]imidazole-2-carboxylic acid, 13.60g of the desired product (88.61% yield) was obtained as a yellow solid. After purification by preparative HPLC, some pure product was obtained as a light yellow solid. HRMS: C 53 H 65 N 21 O 12 Calculated mass: 1187.5122, Found: 1188.5153 [M+H] + .

[0788] Step 18: Synthesis of 3-[(1-methyl-4-{1-methyl-4-[3-({1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-amido]pyrrol-2-yl}formamido)butyramidyl]imidazol-2-yl}formamido)propionamido]pyrrol-2-amido}imidazol-2-yl)formamido]propanoic acid (PA-004)

[0789] The procedure was the same as for 4-[3-[(tert-butoxycarbonyl)amino]propionamido]-1-methylimidazole-2-carboxylic acid, but the reaction temperature was 35° C. Using 10.60 g of ethyl 3-[(1-methyl-4-{1-methyl-4-[3-({1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-amido]pyrrol-2-yl}formamido)butanamido]imidazol-2-yl}formamido)propionamido]pyrrol-2-amido}imidazol-2-yl)formamido]propanoate, 10.00 g of the desired product as a crude material was obtained as a yellow solid. LC / MS: C 51 H 61 N 21 O 12 Calculated mass: 1159.48, Found: 581.25 [M / 2+H] + .

[0790] Example 2. Synthesis of DNA Binding Moiety (PA-023)

[0791] Solution 2.

[0792]

[0793] Step 1: Synthesis of ethyl 1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazole-2-carboxylate

[0794] The procedure was the same as 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-amido]pyrrol-2-yl}formamido)butanamido]imidazole-2-carboxylic acid ethyl ester, but the reaction time was 2.0 hours. Using 1.50 g of 4-(3-aminopropionamido)-1-methylimidazole-2-carboxylic acid ethyl ester, 2.00 g of the desired product was obtained as an off-white solid (68.09% yield). LC / MS: C 21 H 26 N 8 O 5 Calculated mass: 470.20, found: 471.40 [M+H] + .

[0795] Step 2: Synthesis of 1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazole-2-carboxylic acid

[0796] The procedure was the same as for 4-[3-[(tert-butoxycarbonyl)amino]propionamido]-1-methylimidazole-2-carboxylic acid, except that the reaction temperature was room temperature and the reaction time was 2.0 hours. Using 2.00 g of ethyl 1-methyl-4-(3-{[1-methyl-4-(1-methylimidazole-2-amido)pyrrol-2-yl]formamido}propionamido)imidazole-2-carboxylate, 1.80 g of 1-methyl-4-(3-{[1-methyl-4-(1-methylimidazole-2-amido)pyrrol-2-yl]formamido}propionamido)imidazole-2-carboxylic acid was obtained as an off-white solid (95.71% yield). LC / MS: C 19 H 22 N 8 O 5 Calculated mass: 442.17, found: 443.10 [M+H] + .

[0797] Step 3: Synthesis of 4-{4-[(2S)-2-{[(9H-fluoren-9-ylmethoxy)carbonyl]amino}-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-yl]formamido}butyramido]-1-methylpyrrole-2-amido}-1-methylimidazole-2-carboxylic acid ethyl ester

[0798] The procedure was the same as 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-amido]pyrrol-2-yl}formamido)butanamido]imidazole-2-carboxylic acid ethyl ester, but the reaction time was 2.0 hours. Using 1.60 g of 4-{4-[(2S)-4-amino-2-{[(9H-fluoren-9-ylmethoxy)carbonyl]amino}butanamido]-1-methylpyrrole-2-amido}-1-methylimidazole-2-carboxylic acid ethyl ester, 1.90 g of the desired product was obtained as a light yellow solid (70.20% yield). LC / MS: C 51 H 55 N 15 O 10 Calculated mass: 1037.43, Found: 1038.45 [M+H] + .

[0799] Step 4: Synthesis of 4-[4-(4-{4-[(2S)-2-[(tert-butoxycarbonyl)amino]-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-yl]formamido}butyramido]-1-methylpyrrole-2-amido}-1-methylimidazol-2-amido)-1-methylpyrrole-2-amido]-1-methylpyrrole-2-carboxylic acid

[0800] Ethyl 4-{4-[(2S)-2-{[(9H-fluoren-9-ylmethoxy)carbonyl]amino}-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-yl]formamido}butanamido]-1-methylpyrrole-2-amido}-1-methylimidazole-2-carboxylate (1.90 g, 1.83 mmol, 1.00 equiv) and LiOH (0.22 g, 9.15 mmol, 5.00 equiv) were dissolved in MeOH (5.00 mL), THF (15.00 mL) and H 2The mixture in 2% HCl (10% HCl) was stirred at room temperature for 2 hours. The resulting mixture was used directly in the next step without further purification. LC / MS: C 34 H 41 N 15 O 8 Calculated mass: 787.33, Found: 788.40 [M+H] + .

[0801] Step 5: Synthesis of 4-{4-[(2S)-2-[(tert-butoxycarbonyl)amino]-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-yl]formamido}butyramido]-1-methylpyrrole-2-amido}-1-methylimidazole-2-carboxylic acid

[0802] To 4-{4-[(2S)-2-amino-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-yl]formamido}butanamido]-1-methylpyrrole-2-amido}-1-methylimidazole-2-carboxylic acid (1.40 g, 1.78 mmol, 1.00 equiv) was added 4-[(2S)-2-amino-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-yl]formamido}butanamido]-1-methylpyrrole-2-amido}-1-methylimidazole-2-carboxylic acid (1.40 g, 1.78 mmol, 1.00 equiv) in MeOH / THF / H 2 Di-tert-butyl dicarbonate (0.78 g, 3.55 mmol, 2.00 equiv) and DMAP (0.02 g, 0.18 mmol, 0.10 equiv) were added to the mixture in 2% CO (5.00 mL / 15.00 mL / 18.30 mL). The reaction was stirred at room temperature for 3.0 hours. H 2 O (30 mL). The mixture was filtered through a pad of celite and the solid was washed with ethyl acetate (3×30 mL) to give 4-{4-[(2S)-2-[(tert-butoxycarbonyl)amino]-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-yl]formamido}butanamido]-1-methylpyrrole-2-amido}-1-methylimidazole-2-carboxylic acid (1.20 g, 76.05% yield) as a yellow solid. LC / MS: C 39 H 49 N 15 O 10 Calculated mass: 887.38, Found: 888.45 [M+H] + .

[0803] Step 6: Synthesis of 4-[4-(4-{4-[(2S)-2-[(tert-butoxycarbonyl)amino]-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-yl]formamido}butyramido]-1-methylpyrrole-2-amido}-1-methylimidazol-2-amido)-1-methylpyrrole-2-amido]-1-methylpyrrole-2-carboxylic acid methyl ester

[0804] The procedure was the same as for ethyl 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-amido]pyrrol-2-yl}formamido)butanamido]imidazole-2-carboxylate, but the reaction time was 2.0 hours. Using 1.20 g of 4-{4-[(2S)-2-[(tert-butoxycarbonyl)amino]-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-yl]formamido}butanamido]-1-methylpyrrole-2-amido}-1-methylimidazole-2-carboxylic acid, 1.10 g of the desired product was obtained as a yellow solid (71.01% yield). LC / MS: C 52 H 63 N 19 O 12 Calculated mass: 1145.49, Found: 1146.50 [M+H] + .

[0805] Step 7: Synthesis of 4-[4-(4-{4-[(2S)-2-[(tert-butoxycarbonyl)amino]-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amide)pyrrol-2-yl]formamido}propionamido)imidazol-2-yl]formamido}butyramido]-1-methylpyrrole-2-amide}-1-methylimidazol-2-amide)-1-methylpyrrole-2-amide]-1-methylpyrrole-2-carboxylic acid (PA-023)

[0806] The procedure is the same as for 4-[4-(4-{4-[(2S)-2-[(tert-butoxycarbonyl)amino]-4-[(1-methyl-4-{1-methyl-4-[1-methyl-4-(1-methylimidazol-2-amido)pyrrole-2-amido]pyrrole-2-amido}imidazol-2-yl)formamido]butyramido]-1-methylpyrrole-2-amido}-1-methylimidazol-2-amido)-1-methylpyrrole-2-amido]-1-methylpyrrole-2-carboxylic acid. Using 1.00 g of methyl 4-[4-(4-{4-[(2S)-2-[(tert-butoxycarbonyl)amino]-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-yl]formamido}butanamido]-1-methylpyrrole-2-amido}-1-methylimidazol-2-amido)-1-methylpyrrole-2-amido]-1-methylpyrrole-2-carboxylate, 400.00 mg of the desired product was obtained as a white solid (39.16% yield). LC / MS: C 51 H 61 N 19 O 12 Calculated mass: 1131.47, Found: 1132.65 [M+H] + .

[0807] Example 3. Synthesis of DNA Binding Moiety (PA-040)

[0808] Solution 3.

[0809]

[0810] Step 1: Synthesis of ethyl 4-[4-(3-aminopropionamido)-1-methylpyrrole-2-amido]-1-methylimidazole-2-carboxylate

[0811] The procedure was the same as ethyl 4-(4-amino-1-methylpyrrole-2-amido)-1-methylimidazole-2-carboxylate (Intermediate 1-16, Example 1). Using 2.00 g of ethyl 4-(4-{3-[(tert-butoxycarbonyl)amino]propionamido}-1-methylpyrrole-2-amido)-1-methylimidazole-2-carboxylate, 2.00 g of the crude material of the desired product was obtained as a white solid. LC / MS: C 16 H 22 N 6 O 4 Calculated mass: 362.17, Found: 363.25 [M+H] + .

[0812] Step 2: Synthesis of tert-butyl N-(3-[[3-(1,3-dioxoisoindol-2-yl)propyl](methyl)amino]propyl)-N-methylcarbamate

[0813] The procedure was the same as ethyl 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-amido]pyrrol-2-yl}formamido)butanamido]imidazole-2-carboxylate (Intermediate 1-12), but the solvent was DMA. Using 3.00 g of 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-amido]pyrrol-2-yl}formamido)butanamido]imidazole-2-carboxylate, 4.30 g of the desired product was obtained as a yellow solid (96.84% yield). LC / MS: C 50 H 60 N 20 O 11 Calculated mass: 1116.48, Found: 1117.60 [M+H] + .

[0814] Step 3: Synthesis of 1-methyl-4-{1-methyl-4-[3-({1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-amido]pyrrol-2-yl}formamido)butyramido]imidazol-2-yl}formamido)propionamido]pyrrol-2-amido}imidazole-2-carboxylic acid (PA-040-OH)

[0815] The procedure was the same as Example 1 (PA-004), except that the reaction temperature was 40°C and the reaction time was 5.0 hours. Using 4.20 g of ethyl 1-methyl-4-{1-methyl-4-[3-({1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-amido]pyrrol-2-yl}formamido)butanamido]imidazol-2-yl}formamido)propionamido]pyrrol-2-amido}imidazole-2-carboxylate, 4.00 g of the desired product was obtained as a yellow solid (97.97% yield). LC / MS: C 48 H 56 N 20 O 11 Calculated mass: 1088.44, Found: 1089.55 [M+H]+ .

[0816] Example 4. Synthesis of A-27

[0817] Solution 4.

[0818]

[0819] Step 1. Synthesis of intermediate 4-1

[0820] To (S)-2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepine-6-yl)-N-(4-hydroxyphenyl)acetamide (27.00 mg, 0.05 mmol, 1.00 equiv) was added to CH 3 To a stirred solution in CN (1.50 mL) was added tert-butyl N-(86-bromo-3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,78,81,84-octahexadecan-1-yl)carbamate (80.00 mg, 0.05 mmol, 1.00 equiv) and K 2 CO 3 (22.76 mg, 0.16 mmol, 3.00 equiv). The resulting mixture was stirred at 70 °C for 17.0 h. The resulting mixture was filtered and the filter cake was washed with EtOAc (3 x 8 mL). The filtrate was concentrated under reduced pressure and analyzed by TLC plate (CH 2 Cl 2 / MeOH=8:1) was purified to give (S)-tert-butyl(86-(4-(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepine-6-yl)acetamido)phenoxy)3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,78,81,84-octadecyl)carbamate (81.00 mg, 77.40% yield) as a brown solid.

[0821] LC / MS: C 88 H 147 C1N 6 O 32 Calculated mass of S: 1866.95, Exp. value: 623.90 [M / 3+H] + .

[0822] Step 2. Synthesis of intermediate 4-2

[0823] A solution of (S)-tert-butyl(86-(4-(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepine-6-yl)acetamido)phenoxy)-3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,78,81,84-octadecyl)carbamate (70.00 mg, 0.04 mmol, 1.00 equiv) and TFA (0.20 mL) in DCM (1.00 mL) was stirred at room temperature for 1.0 h. The resulting mixture was concentrated under reduced pressure. This resulted in (S)—N-(4-((86-amino-3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,78,81,84-octadecyl)oxy)phenyl)-2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepine-6-yl)acetamide as a yellow oil (70.00 mg, crude).

[0824] LC / MS: C 83 H 139 C1N 6 O 30 Calculated mass of S: 1766.89, Exp. value: 590.60 [M / 3+H] + .

[0825] Step 3. Synthesis of A-26

[0826] To a stirred solution of 3-[(1-methyl-4-{1-methyl-4-[3-({1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propionamido)imidazol-2-amido]pyrrol-2-yl}formamido)butanamido]imidazol-2-yl}formamido)propionamido]pyrrol-2-amido}imidazol-2-yl)formamido]propanoic acid (37.80 mg, 0.03 mmol, 1.00 equiv) in DMF (1.00 mL) at 0 °C was added DIEA (25.27 mg, 0.19 mmol, 6.00 equiv) , (S)-N-(4-((86-amino-3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,78,81,84-octadecyl)oxy)phenyl)-2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepine-6-yl)acetamide (57.62 mg, 0.03 mmol, 1.00 equiv) and PyBOP (25.43 mg, 0.05 mmol, 1.50 equiv). The resulting mixture was stirred at room temperature for 1.0 hour. The resulting mixture was filtered and purified by preparative HPLC under the following conditions: column: XBridge Prep C18 OBD column, 19*150 mm, 5 μm; mobile phase A: water (10 mmol / L NH 4 HCO 3), mobile phase B: ACN; flow rate: 25 mL / min; gradient: 45% B to 65% B, 65% B in 11 minutes; wavelength: 254 nm; RT1 (minutes): 3.05; number of runs: 0. The fractions were combined and lyophilized to give (S)-N-(3-((5-((2-((1-(4-(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepine-6-yl)acetamido)phenoxy)-88-oxo-3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,78,81,84 -octadecyl-87-azonaphthalen-90-yl)carbamoyl)-1-methyl-1H-imidazol-4-yl)carbamoyl)-1-methyl-1H-pyrrol-3-yl)amino)-3-oxopropyl)-1-methyl-4-(4-(1-methyl-4-(1-methyl-4-(3-(1-methyl-4-(1-methyl-1H-imidazole-2-carboxamido)-1H-pyrrole-2-carboxamido)propionamido)-1H-imidazole-2-carboxamido)-1H-pyrrole-2-carboxamido)butyramido)-1H-imidazole-2-carboxamide (13.80 mg, 14.46%). HRMS: C 134 H 198 C1N 27 O 41 Calculated mass of S: 2908.3648, Expected mass: 2909.3729 [M+H] + .

[0827] HPLC: 99.401% purity.

[0828] Example 9. General Synthesis and Purification of Compounds of the Present Disclosure

[0829] The compounds of the present disclosure were prepared by methods similar to Example 4. The compounds were then purified by HRMS Method A or B.

[0830] Method A :Instrument: Waters Acquity Class I UPLC and Xevo G2-XSQ T for HRMS; Column: ACQUITY UPLC BEH-C18, 2.1×50 mm, 2.7 μm; Mobile phase A: H 2O (0.1% HCOOH), mobile phase B, ACN (0.1% HCOOH); flow rate: 0.4 mL / min; gradient: 10% B to 95% B in 1.5 min, hold 95% for 0.5 min, then drop to 10% B in 0.3 min, hold 10% B for 0.7 min; detector: 254 nm.

[0831] Method B :Instrument: Waters Acquity Class I UPLC and Xevo G2 XS QT for HRMS; Column: ACQUITY UPLC BEH-C18, 2.1×50 mm, 2.7 μm; Mobile phase A: H 2 O (0.1% HCOOH), mobile phase B, ACN (0.1% HCOOH); flow rate: 0.4 mL / min; gradient: 5% B to 40% B in 2.0 minutes, reach 95% in another 1.5 minutes, keep 95% for 1.5 minutes, then drop to 5% B in 0.3 minutes, and keep 5% B for another 0.7 minutes; detector: 254 nm.

[0832] Experimental data for compounds of the present disclosure purified by Method A are provided in Table 5.

[0833] Table 5. LCMS analysis of compounds of the present disclosure.

[0834]

[0835]

[0836]

[0837] Biological Examples

[0838] Example B1. Activity

[0839] Fibroblasts: A cell type derived from a patient's skin biopsy. These cells are not genetically altered, so they are used as a primary cell culture model of disease.

[0840] iPSC: Induced pluripotent stem cell, a cell type that reprograms another cell type (usually a skin cell or a blood cell) into a more embryonic-like state, allowing other cell types to develop to mimic the therapeutic effects of drugs in vitro.

[0841] SNP: Single Nucleotide Polymorphism, a variation in a single base pair in a DNA sequence

[0842] Molecular Biology Toolbox:

[0843] qPCR primer probe set:

[0844] ○ RNA input normalization was assessed using the human glyceraldehyde 3-phosphate dehydrogenase (hGAPDH) TaqMan assay (ThermoFisher Cat. No. 4351370) or the human cyclophilin (IAPP) TaqMan assay (ThermoFisher Cat. No. 4351372)

[0845] ○ Total HTT detection was assessed using the Human Htt TaqMan assay (ThermoFisher Cat. No. 4331182)

[0846] o Allele-specific detection of human HTT expression in HD cells containing SNP rs362331C / T (exon 50): For each assay, allele-specific probes detecting the SNP variant contained locked nucleic acid bases to improve allele discrimination compared to unmodified DNA probes.

[0847] ■362331-F (331 forward primer): TCTCCTCCACAGAGTTTGTGA

[0848] ■362331-R (331 reverse primer): CCTTCTTTCTGGACTAAGAAGCTG

[0849] ■362331-C probe: TCC CTC ATC+C+AC TGT GT

[0850] ■362331-T probe: CTC+A+T+C+T+A+C TGT GT

[0851] ○qPCR using Agpath ID One-Step Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) Reagents

[0852] Protein measurements were performed via western blots probed with antibody MW1 (poly Q specific) to assess the reduction of mtHTT alone. Both wtHTT and mtHTT were observed using D7F7 (aa around Pro1218). Lysates were normalized by DC, then separated on 3-8% Tris-acetate gels and transferred to nitrocellulose membranes via wet transfer. Blots were probed with the previously mentioned antibodies and complementary fluorescent secondary antibodies and were stained with Li-Cor. Imaged on the DLx imaging system.

[0853] The antibody pair of 2B7 (aa1-17) and MW1 (polyQ specific) was used to track mtHTT levels, while the pair of MAB2166 (aa181-810) and MAB5490 (aa115-129) was used to track total full-length HTT.

[0854] Screening of HD Molecular Methods: Culture GM09197 and / or GM04022 fibroblasts in T175 flasks at 37 °C and 5% CO. 2 After reaching confluence, the medium was removed, the cells were washed with 1× PBS, and the cells were cultured using TrypLE TM Dissociate cells with Express enzyme. Add medium to enzyme and collect into 15 mL conical tube and centrifuge at 500 x g for 5 minutes to pellet cells. Aspirate medium and enzyme using serological pipette. Resuspend cells in fresh medium and count using Countess 3 automated cell counter. Plate cells at 15,000 cells / well in tissue culture treated polystyrene 96-well culture dishes and incubate at 37°C and 5% CO 2 Incubate overnight at 4 °C. The next day, remove the medium using an 8-channel aspirator. Add 200 μL of medium / well back to the plate. Prepare the molecules at 1 mM and use Multidrop TM Pico 8 digital dispenser. After 48 hours of incubation with compounds, the medium in the plate was removed, the cells were washed with 1× PBS, and the cells were lysed in 40 μL / well guanidine thiocyanate buffer. RNA was isolated and purified in 382-well glass fiber column plates using chaotropic salts. ThermoFisher QuantStudio TM The 7 Flex system measures human mtHTT, wtHTT and GAPDH mRNA via RT-PCR in a 384-well format. Results for HTT levels were normalized to GAPDH mRNA levels. Normalized HTT mRNA levels were expressed relative to vehicle-treated samples to assess fold changes following molecule treatment.

[0855] Duration of action of iPSC-neurons for HD molecular approaches:Fibroblasts isolated from HD patients were reprogrammed into iPSCs, expanded in the presence of cytokines and transduced with the cytoplasmic RNA vector Sendai virus. These iPSCs expressed stem cell markers and had a normal karyotype and expressed the pluripotent markers Nanog, Tra-1-60 and SSeA-44. The iPSC-derived neuronal differentiation method followed a standard protocol for mixed cortical neuronal differentiation, resulting in immunohistochemical staining of iPS-neurons for Tuj1 and Map2. iPSC-neuronal precursor cells were seeded at 300,000 cells / well in culture-treated polystyrene 96-well dishes coated with PLO / laminin-521 and incubated at 37°C and 5% CO 2 The next day, the medium was changed to allow the neuronal precursor cells to continue maturing into neurons. Four days later, the medium was renewed and the cells were treated with a mitotic inhibitor to remove any remaining dividing cells, thereby generating a pure neuronal culture. Three days later, the medium was removed. 200 μL of medium / well was added back to the plate. The molecules were formulated to 1 mM and quantified using Multidrop TM Pico 8 digital dispenser for dispensing. After 96 hours of incubation with compound, the medium was removed and refreshed, and cells were re-treated. After 7 days of compound exposure, the medium in the plate was removed and the cells were lysed in 60 μL Ambion lysis buffer. Using PureLink TM RNA was isolated using the RNA Isolation Kit. cDNA was synthesized using the Agilent Superscript II Kit. TM The 7 Flex system measures human mtHTT, wtHTT and GAPDH mRNA via RT-PCR in a 384-well format. Results for HTT levels were normalized to GAPDH mRNA levels. Normalized HTT mRNA levels were expressed relative to vehicle-treated samples to assess fold changes following treatment with HD compounds.

[0856] The E of each compound min It is the lowest % HTT concentration observed within the compound concentration range of 0.5 nM to 1000 nM.

[0857] Representative in vitro biochemical data are presented in Tables 6 and 7, where A>90%, B is 90% to 80%, and C<80%.

[0858] Table 6. Representative biochemical data in GM09197 fibroblasts.

[0859]

[0860]

[0861] Table 7. Representative biochemical data in GM04022 fibroblasts.

[0862]

[0863] Although preferred embodiments of the present invention have been shown and described herein, it will be appreciated by those skilled in the art that these embodiments are provided by way of example only. Those skilled in the art may conceive of many variations, changes and substitutions without departing from the present invention. It should be understood that various alternatives to the embodiments of the present invention described herein may also be used to implement the present invention. It is contemplated that the appended claims define the scope of the present invention, and methods and structures within the scope of these claims and their equivalents are therefore encompassed.

Claims

1. A method of treating an individual suffering from an expanded CAG repeat disorder, the method comprising administering an effective amount of a transcriptional regulator molecule having a first end, a second end and an oligomeric backbone, wherein (a) the first end comprises a DNA binding portion, and the DNA binding portion is capable of binding to a nucleotide repeat sequence comprising CAG; (b) the second terminus comprises a protein binding portion capable of binding to a regulatory molecule that regulates expression of a gene having an expanded CAG repeat sequence; as well as (c) the oligomeric backbone connects the first end and the second end.

2. The method of claim 1, wherein the expanded CAG repeat disorder is Huntington's disease (HD).

3. The method of claim 1 or claim 2, wherein the first end comprises a polyamide.

4. The method of any one of claims 1 to 3, wherein the second terminus comprises a bromodomain binding moiety.

5. The method of any one of claims 1 to 4, wherein the second terminus comprises a portion capable of binding to a bromodomain and extra-terminal domain (BET) family member.

6. The method of claim 5, wherein the BET family member is BRD2, BRD3, BRD4 or BRDT.

7. The method of any one of claims 1 to 4, wherein the bromodomain is CBP / p300, PCAF (P300 / CBP-associated factor), CECR2 (cat eye syndrome chromosomal region candidate gene 2), BRPF (bromodomain-containing and PHD finger protein), ATAD2 / ATAD2B (chromatin remodeling protein), TRIM24 (triplet-containing motif protein 24), BAZ2 (bromodomain adjacent to zinc finger) or TAF1 (TBP-associated factor).

8. The method according to any one of claims 1 to 7, wherein the gene is huntingtin (HTT).

9. The method of any one of claims 1 to 8, wherein the expanded CAG repeat sequence has at least 36 repeat sequences.

10. The method according to any one of claims 1 to 9, wherein the expression of the gene having an expanded nucleotide repeat sequence is reduced.

11. The method of any one of claims 1 to 10, wherein the method reduces one or more symptoms of Huntington's disease.

12. The method of claim 11, wherein the one or more symptoms are selected from chorea, cognitive impairment, sexual dysfunction, eye movement abnormalities, olfactory abnormalities, aggression, agitation, anxiety, apathy, bradykinesia, slow thinking, clumsiness, delusions, depression, difficulty walking, disinhibition, catatonia, gait imbalance, muscle weakness, hallucinations, hostility, hypokinesia, irritability, memory impairment, myoclonus, obsessive-compulsive behavior, poor fine motor coordination, epilepsy, dysphonia, staring, weight loss, abnormal cholesterol metabolism, abnormal white matter, alcoholism, Babinski sign, caudate nucleus atrophy, brain atrophy, apnea, clonus, striatal degeneration, excessive daytime sleepiness, impaired visuospatial constructive cognition, inability to walk, insomnia, mutism, oropharyngeal dysphagia, rigidity, suicidal ideation, cerebellar atrophy, dementia, gait ataxia, glial degeneration, hyperreflexia, neuronal loss, or personality changes.

13. A method of reducing expression of a gene having an expanded CAG repeat sequence in a cell, the method comprising contacting the cell with an effective amount of a transcriptional regulator molecule having a first end, a second end, and an oligomeric backbone, wherein (a) the first end comprises a DNA binding portion, and the DNA binding portion is capable of binding to a nucleotide repeat sequence comprising CAG; (b) the second end comprises a protein binding portion, the protein binding portion being capable of binding to a regulatory molecule that regulates the expression of a gene having an expanded nucleotide repeat sequence; as well as (c) the oligomeric backbone connects the first end and the second end.

14. The method of claim 13, wherein the method further comprises treating an expanded CAG repeat disorder.

15. A method according to claim 13 or claim 14, wherein the first end comprises a polyamide.

16. The method of any one of claims 13 to 15, wherein the second terminus comprises a bromodomain binding moiety.

17. The method of any one of claims 13 to 16, wherein the second terminus comprises a portion capable of binding to a bromodomain and extra-terminal domain (BET) family member.

18. The method of claim 17, wherein the BET family member is BRD2, BRD3, BRD4 or BRDT.

19. The method of any one of claims 13 to 16, wherein the bromodomain is CBP / p300, PCAF (P300 / CBP-associated factor), CECR2 (cat eye syndrome chromosomal region candidate gene 2), BRPF (bromodomain-containing and PHD finger protein), ATAD2 / ATAD2B (chromatin remodeling protein), TRIM24 (triplet-containing motif protein 24), BAZ2 (bromodomain adjacent to zinc finger) or TAF1 (TBP-associated factor).

20. The method according to any one of claims 13 to 19, wherein the gene is huntingtin (HTT).

21. The method of any one of claims 14 to 20, wherein the expanded repeat disorder is Huntington's disease (HD).

22. The method of any one of claims 13 to 21, wherein the expanded CAG repeat sequence has at least 36 repeat sequences.

23. The method of any one of claims 13 to 22, wherein expression of the gene having an expanded CAG repeat sequence is reduced.

24. A transcriptional regulator molecule having a first end, a second end and an oligomeric backbone portion, wherein: (a) the first end comprises a DNA binding portion, and the DNA binding portion is capable of binding to a nucleotide repeat sequence comprising CAG; (b) the second end comprises a protein binding portion, the protein binding portion is capable of binding to a regulatory molecule, the regulatory molecule regulates the expression of a gene having the nucleotide repeat sequence; as well as (c) the oligomeric backbone connects the first end and the second end; and The DNA binding moiety comprises a structure of formula (A-1): or a pharmaceutically acceptable salt thereof, wherein: Z 1 absent, or -O- or -NH-; Each X 1 , X 2 , X 3 , X 4 , X 5 , X 6 , X 7 and X 8 are independently O, S or NR 2 ; Each Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , Y 6 , Y 7 and Y 8 are independently CH or N; W 1 is deuterium, hydrogen, optionally substituted C1-C6 alkyl, (nitro)methanediamine, (nitro)-N,N,N',N'-tetramethylmethanediamine, -C(O)-NR 1A R 1B 、-NR 1A -C(O)-NR 1A R 1B , -Z B -P(O)(OR 1A 2. -Z B -(CH2) p -P(O)(OR 1A 2. -Z B -(CH2) p3 -OP(O)(OR 1A )2, where Z B is -N- or -O-; p3 is an integer from 1 to 10; W 2 is an optionally substituted C1-C6 alkyl or -C(O)-NR 1A R 1B ; Each R 1 are independently hydrogen, deuterium, halogen, amino, cyano, optionally C1-C 20 Alkyl or C1-C 20 Heteroalkyl or -NHC(O)R 1A ;or Two R on the same atom or adjacent atoms 1 and the atoms to which they are attached are taken together to form an optionally substituted 3- to 6-membered carbocyclic or 3- to 6-membered heterocyclic ring; Each R 2 are independently hydrogen, deuterium, optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, optionally substituted C1-C 20 haloalkyl or optionally substituted C1-C 20 Alkylamino; Each R 1A are independently hydrogen, deuterium or an optionally substituted C1-C 20 alkyl; Each R 1B are independently hydrogen, deuterium, an optionally substituted 5-membered heteroaryl, an optionally substituted C1-C 20 Alkyl, optionally substituted C2-C 10 Heteroalkyl or (AA) p2 ,in Each AA is an amino acid; p2 is an integer from 1 to 10; j1 is 0 or 1; n0 is 0 or 1; m1 and n1 are each independently an integer from 0 to 3; p1 is 2 or 3, provided that when Z 1 is O or NH, p1 is 2, and when Z 1 When it does not exist, p1 is 3; and Where W 1 or W 2 One of the two is connected to the oligomeric backbone.

25. The transcriptional regulator molecule of claim 24, wherein the DNA binding portion comprises a structure of formula (A-2) or a pharmaceutically acceptable salt thereof:

26. The transcriptional regulator molecule according to claim 24 or 25, or a pharmaceutically acceptable salt thereof, wherein each R 1 It's hydrogen.

27. A transcriptional regulator molecule according to any one of claims 24 to 26, or a pharmaceutically acceptable salt thereof, wherein W 2 Yes-C(O)NR 1A R 1B , where R 1A is hydrogen and R 1B is an alkyl group optionally substituted with an oxo group (=O); and wherein W 2 Attached to the oligomeric backbone.

28. The transcriptional regulator molecule of claim 24, wherein the DNA binding portion comprises a structure of formula (A-4) or a pharmaceutically acceptable salt thereof:

29. The transcriptional regulator molecule of claim 24, wherein the DNA binding portion comprises a structure of formula (A-6) or a pharmaceutically acceptable salt thereof:

30. The transcriptional regulator molecule of any one of claims 24 to 29, or a pharmaceutically acceptable salt thereof, wherein ml is 0 or 1 and p1 is 2.

31. A transcriptional regulator molecule according to any one of claims 24 to 30, or a pharmaceutically acceptable salt thereof, wherein Y 2 , Y 4 and Y 7 are each independently N; and Y 1 and Y 3 Each is independently CH.

32. The transcriptional regulator molecule according to any one of claims 24 to 31, or a pharmaceutically acceptable salt thereof, wherein n1 is 0.

33. The transcriptional regulator molecule according to any one of claims 24 to 31, or a pharmaceutically acceptable salt thereof, wherein n1 is 1.

34. The transcriptional regulator molecule according to any one of claims 24 to 33, or a pharmaceutically acceptable salt thereof, wherein j1 is 0.

35. The transcriptional regulator molecule according to any one of claims 24 to 33, or a pharmaceutically acceptable salt thereof, wherein j1 is 1.

36. A transcriptional regulator molecule according to any one of claims 24 to 31 or 33 to 35, or a pharmaceutically acceptable salt thereof, wherein Y 6 It is CH.

37. The transcriptional regulator molecule of claim 24 or a pharmaceutically acceptable salt thereof, wherein X 1 , X 2 , X 3 , X 4 , X 5 , X 6 and X 7 Each independently is -NR 2 .

38. The transcriptional regulator molecule of claim 24, wherein the DNA binding portion comprises a structure of formula (A-8): or a pharmaceutically acceptable salt thereof, wherein: Y 8 is CH or N; and R 2A , R 2B , R 2C , R 2D , R 2E , R 2F and R 2G are independently hydrogen, deuterium, an optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, optionally substituted C1-C 20 haloalkyl or optionally substituted C1-C 20 Alkylamino.

39. The transcriptional regulator molecule of claim 24, wherein the DNA binding portion comprises a structure of formula (A-9): or a pharmaceutically acceptable salt thereof, wherein: Y 8 is CH or N; and R 2A , R 2B , R 2D , R 2E , R 2F and R 2G are independently hydrogen, deuterium, an optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, optionally substituted C1-C 20 haloalkyl or optionally substituted C1-C 20 Alkylamino.

40. The transcriptional regulator molecule of claim 24, wherein the DNA binding portion comprises a structure of formula (A-10): or a pharmaceutically acceptable salt thereof, wherein: Y 8 is CH or N; and R 2A , R 2B , R 2C , R 2D , R 2E , R 2F and R 2G are independently hydrogen, deuterium, an optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, optionally substituted C1-C 20 haloalkyl or optionally substituted C1-C 20 Alkylamino.

41. A transcriptional regulator molecule according to any one of claims 24 to 40, or a pharmaceutically acceptable salt thereof, wherein Y 8 It is N.

42. A transcriptional regulator molecule according to any one of claims 38 to 40, or a pharmaceutically acceptable salt thereof, wherein R 2A , R 2B , R 2C , R 2D , R 2E , R 2F and R 2G are each independently hydrogen, optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 haloalkyl or optionally substituted C1-C 20 Heteroalkyl.

43. The transcriptional regulator molecule of claim 42, or a pharmaceutically acceptable salt thereof, wherein R 2A , R 2B , R 2C , R 2D , R 2E , R 2F and R 2G are each independently an optionally substituted C1-C 20 alkyl.

44. The transcriptional regulator molecule of claim 24, wherein the DNA binding portion comprises a structure of formula (A-11) or a pharmaceutically acceptable salt thereof:

45. The transcriptional regulator molecule of claim 24, wherein the DNA binding portion comprises a structure of formula (A-12) or a pharmaceutically acceptable salt thereof:

46. ​​The transcriptional regulator molecule of claim 24, wherein the DNA binding portion comprises a structure of formula (A-13) or a pharmaceutically acceptable salt thereof:

47. A transcriptional regulator molecule according to any one of claims 24 to 46, or a pharmaceutically acceptable salt thereof, wherein W 1 It's hydrogen.

48. The transcriptional regulator molecule of any one of claims 24 to 47, or a pharmaceutically acceptable salt thereof, wherein the first end is capable of binding DNA with an affinity of less than 500 nM.

49. The transcriptional regulator molecule of any one of claims 24 to 48, or a pharmaceutically acceptable salt thereof, wherein the oligomeric backbone is a linker having a length of less than about 50 angstroms.

50. The transcriptional regulator molecule of any one of claims 24 to 48, or a pharmaceutically acceptable salt thereof, wherein the oligomeric backbone is a linker having a length of about 10 to 60 angstroms.

51. A transcriptional regulator molecule according to any one of claims 24 to 50, or a pharmaceutically acceptable salt thereof, wherein the oligomeric backbone comprises a polymer having 2 to 50 spacer moieties, wherein Each spacer moiety is independently selected from the group consisting of: -((CR 3a R 3b ) x -O) y -、-((CR 3a R 3b ) x -NR 4a ) y -、-((CR 3a R 3b ) x -CH=CH-(CR 3a R 3b ) x -O) y -, optionally substituted C1-C 12 Alkyl, optionally substituted C2-C 10 Alkenyl, optionally substituted C2-C 10 Alkynyl, optionally substituted C6-C 10 arylene, optionally substituted C3-C7 cycloalkylene, optionally substituted 5- to 10-membered heteroarylene, optionally substituted 4- to 10-membered heterocycloalkylene, amino acid residue, -O-, -C(O)NR 4a -、-NR 4a C(O)-, -C(O)-, -NR 1a -, -C(O)O-, -S-, -S(O)-, -S(O)2-, -S(O)2NR 4a -、-NR 4a S(O)2- and -P(O)OH- and any combination thereof; wherein each x is independently 2 to 4; each y is independently 1 to 10; Each R 1a are independently hydrogen or optionally substituted C1-C6 alkyl; Each R 3a and R 3b is independently selected from hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted alkoxy, optionally substituted amino, carboxyl, carboxyl ester, acyl, acyloxy, acylamino, aminoacyl, optionally substituted alkylamide, sulfonyl, optionally substituted thioalkoxy, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl, and optionally substituted heterocyclyl; and Each R 4a and R is independently hydrogen or optionally substituted C1-C6 alkyl.

52. The transcriptional regulator molecule of claim 51 or a pharmaceutically acceptable salt thereof, wherein each spacer moiety is independently selected from the group consisting of: -((CH2) x -O) y -、-((CH2) x -NH) y -, -O-, -C(O)NH-, -NH-, and any combination thereof.

53. A transcriptional regulator molecule according to any one of claims 24 to 50, or a pharmaceutically acceptable salt thereof, wherein the oligomeric backbone comprises -NR 4a (CH2CH2O) y (CH2) x -or-NR 4a -(CH2) q -C(O)NR 4a (CH2CH2O) y (CH2) x -, wherein q is 2 to 10, x is 1 to 4, y is 1 to 50, and each R 4a and R is independently hydrogen or optionally substituted C1-C6 alkyl.

54. The transcriptional regulator molecule of any one of claims 24 to 53, or a pharmaceutically acceptable salt thereof, wherein the second terminus comprises a bromodomain binding moiety.

55. The transcriptional regulator molecule of any one of claims 24 to 53, or a pharmaceutically acceptable salt thereof, wherein the second terminus comprises a portion capable of binding to a bromodomain and beyond-terminal domain (BET) family member.

56. The transcriptional regulator molecule of claim 55, or a pharmaceutically acceptable salt thereof, wherein the BET family member is BRD2, BRD3, BRD4 or BRDT.

57. The transcriptional regulator molecule of any one of claims 24 to 54, or a pharmaceutically acceptable salt thereof, wherein the bromodomain is CBP / p300, PCAF (P300 / CBP-associated factor), CECR2 (cat eye syndrome chromosomal region candidate gene 2), BRPF (bromodomain-containing and PHD finger protein), ATAD2 / ATAD2B (chromatin remodeling protein), TRIM24 (triplet-containing motif protein 24), BAZ2 (bromodomain adjacent to zinc finger) or TAF1 (TBP-associated factor).

58. The transcriptional regulator molecule according to any one of claims 24 to 54, or a pharmaceutically acceptable salt thereof, wherein the second terminus has a triazolodiazepine structure.

59. The transcriptional regulator of any one of claims 24 to 54, wherein the second end comprises a structure of formula (2-A): or a pharmaceutically acceptable salt thereof, wherein: Ring A is optionally substituted aryl or optionally substituted 5- to 6-membered heteroaryl; Ring B is absent or is an optionally substituted 6-membered monocyclic aryl or heteroaryl group; D is C or N; E is O or N; Y A is -NH- or -O-; R 5 is hydrogen, deuterium or C1-C6 alkyl; R 6 is selected from hydrogen, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl and optionally substituted C1-C6 hydroxyalkyl; R 7 is selected from hydrogen, deuterium, halogen, -NO2, -CN, optionally substituted aryl, optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 heteroalkyl, optionally substituted C1-C6 haloalkyl, and optionally substituted C1-C6 hydroxyalkyl; or R 7 Yes - NR 7A R 7B ,in R 7A and R 7B are independently hydrogen, deuterium, an optionally substituted C1-C 20 Alkyl or optionally substituted C1-C 20 heteroalkyl; and x1 is an integer from 1 to 6.

60. The transcriptional regulator molecule of claim 59, wherein the second terminus comprises a structure of formula (2-B): or a pharmaceutically acceptable salt thereof, wherein: Ring A is optionally substituted aryl or optionally substituted 5- to 6-membered heteroaryl; Ring B is absent or is an optionally substituted 6-membered monocyclic aryl or heteroaryl group; Y A is -NH- or -O-; R 5 is hydrogen, deuterium or C1-C6 alkyl; R 6 is selected from hydrogen, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl and optionally substituted C1-C6 hydroxyalkyl; R 7 is selected from hydrogen, deuterium, halogen, -NO2, -CN, optionally substituted aryl, optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 heteroalkyl, optionally substituted C1-C6 haloalkyl, and optionally substituted C1-C6 hydroxyalkyl; or R 7 Yes - NR 7A R 7B ,in R 7A and R 7B are independently hydrogen, deuterium, an optionally substituted C1-C 20 Alkyl or optionally substituted C1-C 20 heteroalkyl; and x1 is an integer from 1 to 6.

61. The transcriptional regulator molecule of claim 59, wherein the second terminus comprises a structure of formula (2-C): or a pharmaceutically acceptable salt thereof, wherein: R 8 and R 9 Each is independently selected from hydrogen, deuterium, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl or optionally substituted C1-C6 hydroxyalkyl.

62. The transcriptional regulator molecule of claim 59, wherein the second terminus comprises a structure of formula (2-D) or a pharmaceutically acceptable salt thereof: or a pharmaceutically acceptable salt thereof, wherein: R 10 is selected from hydrogen, deuterium, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl or optionally substituted C1-C6 hydroxyalkyl.

63. A transcriptional regulator molecule according to any one of claims 59 to 62, or a pharmaceutically acceptable salt thereof, wherein R 5 It's hydrogen.

64. A transcriptional regulator molecule according to any one of claims 59 to 63, or a pharmaceutically acceptable salt thereof, wherein Y A is NH and x1 is 1.

65. The transcriptional regulator molecule of any one of claims 59 to 64, or a pharmaceutically acceptable salt thereof, wherein Ring B is optionally substituted aryl.

66. The transcriptional regulator molecule of any one of claims 24 to 54, wherein the second end comprises a structure of formula (3-A): or a pharmaceutically acceptable salt thereof, wherein Y B is -CH2NH-, -CH2O-, -NH- or -O-; R 11A and R 11B are each independently hydrogen, deuterium or optionally substituted C1-C6 alkyl; R 12 is hydrogen, halogen, -OH, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl or optionally substituted C1-C6 hydroxyalkyl; R 14 and R 15 Each is independently hydrogen, deuterium, halogen, -CN, -NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl or optionally substituted C1-C6 hydroxyalkyl; or R 14 Yes - NR A R B ; R 16 is optionally substituted C1-C6 alkyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, C1-C6 hydroxyalkyl, -SO2R A or -NHSO2R A ; R Y is hydrogen, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted 5- to 6-membered monocyclic aryl or heteroaryl; Each R A and R B is independently hydrogen, deuterium, optionally substituted C1-C6 alkyl, or optionally substituted C1-C6 heteroalkyl; and y1 is 1 to 3; and wherein the connection to the linker is at R 14 or R Y Place.

67. The transcriptional regulator molecule of any one of claims 24 to 54, wherein the second end comprises a structure of formula (3-B): or a pharmaceutically acceptable salt thereof, wherein Ring C is absent or is an optionally substituted 5- to 6-membered monocyclic aryl or heteroaryl or a 4- to 8-membered heterocyclic ring; Y B is -CH2NH-, -CH2OH-, -NH- or -O-; R 11A and R 11B are each independently hydrogen, deuterium or optionally substituted C1-C6 alkyl; R 12 is hydrogen, deuterium, optionally substituted C1-C6 alkyl, C(O)R A or C(O)NR A R B ;in Each R A and R B is independently hydrogen, deuterium, optionally substituted C1-C6 alkyl, or optionally substituted C1-C6 heteroalkyl; and R 13 is hydrogen, substituted aryl, substituted heteroaryl, or substituted diphenyl ether; and y2 is an integer from 0 to 2.

68. The transcriptional regulator molecule of claim 66, wherein the second terminus comprises a structure of formula (3-C): or a pharmaceutically acceptable salt thereof, wherein: Ring C is absent or is an optionally substituted 5- to 6-membered monocyclic aryl or heteroaryl or a 4- to 8-membered heterocyclic ring; Y B is -CH2NH-, -CH2O-, -NH- or -O-; R 14 and R 15 Each is independently hydrogen, halogen, -CN, -NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl or optionally substituted C1-C6 hydroxyalkyl; or R 14 Yes - NR A R B ,in Each R A and R B are independently hydrogen, optionally substituted C1-C6 alkyl, or optionally substituted C1-C6 heteroalkyl; R 16 is a substituted C1-C6 alkyl, an optionally substituted C1-C6 heteroalkyl, an optionally substituted C2-C6 alkenyl, an optionally substituted C2-C6 alkynyl, an optionally substituted C1-C6 hydroxyalkyl, -SO2R A or -NHSO2R A ;as well as y1 is an integer from 1 to 3.

69. A transcriptional regulator molecule according to any one of claims 66 to 68, or a pharmaceutically acceptable salt thereof, wherein Y B It's NH.

70. The transcriptional regulator molecule of any one of claims 66 to 69, or a pharmaceutically acceptable salt thereof, wherein Ring C is absent or is optionally substituted aryl.

71. The transcriptional regulator molecule of claim 66, wherein the second end comprises a structure of formula (3-D): or a pharmaceutically acceptable salt thereof, wherein: R 11A and R 11B are each independently hydrogen or optionally substituted C1-C6 alkyl; R 12 is hydrogen or optionally substituted C1-C6 alkyl; Each R 15 are independently hydrogen, halogen, -CN, -NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl or optionally substituted C1-C6 hydroxyalkyl; R 16 is optionally substituted C1-C6 alkyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 hydroxyalkyl, -SO2R A or -NHSO2R A ;in R A is hydrogen, optionally substituted C1-C6 alkyl, or optionally substituted C1-C6 heteroalkyl; and y1 is an integer from 1 to 3.

72. A transcriptional regulator molecule according to any one of claims 66 to 71, or a pharmaceutically acceptable salt thereof, wherein R 11A and R 11B Each is independently a C1-C6 alkyl group.

73. The transcriptional regulator molecule of any one of claims 24 to 72, wherein the molecule or a pharmaceutically acceptable salt thereof is described in Table 4.

74. A pharmaceutical composition comprising a transcriptional regulator molecule according to any one of claims 24 to 73, or a pharmaceutically acceptable salt thereof; and a pharmaceutically acceptable excipient.

75. The pharmaceutical composition of claim 74, wherein the composition is formulated for administration by intravenous administration.

76. A method of treating Huntington's disease (HD) in a patient in need thereof, the method comprising administering to the patient a transcriptional regulator molecule having a first end, a second end, and an oligomeric backbone, wherein (a) the first end comprises a DNA binding portion, and the DNA binding portion is capable of binding to a nucleotide repeat sequence comprising CAG; (b) the second end comprises a protein binding portion, the protein binding portion being capable of binding to a regulatory molecule that regulates the expression of a gene having an expanded nucleotide repeat sequence; as well as (c) the oligomeric backbone connects the first end and the second end; and wherein the DNA binding moiety comprises -NH-QC(O)-, wherein Q is an optionally substituted C6-C 10 arylene, an optionally substituted 4- to 10-membered heterocyclylene, an optionally substituted 5- to 10-membered heteroarylene, or an optionally substituted alkylene.

77. The method of claim 76, wherein the DNA binding moiety comprises a polyamide having one or more subunits selected from: -NH-benzopyrazinylene-C(O)-, -NH-phenylene-C(O)-, -NH-pyridinylene-C(O)-, -NH-piperidinylene-C(O)-, -NH-pyrimidinylene-C(O)-, -NH-anthracenylene-C(O)-, -NH-quinolinylene-C(O)-, and wherein each R' is independently hydrogen, an optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, optionally substituted C1-C 20 haloalkyl or optionally substituted C1-C 20 and Z is H, NH2, C1-C6 alkyl, C1-C6 haloalkyl or C1-C6 alkyl-NH2.

78. The method of claim 76, wherein the DNA binding moiety comprises a structure of formula (A-1): or a pharmaceutically acceptable salt thereof, wherein: Z 1 absent, or -O- or -NH-; Each X 1 , X 2 , X 3 , X 4 , X 5 , X 6 , X 7 and X 8 are independently O, S or NR 2 ; Each Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , Y 6 , Y 7 and Y 8 are independently CH or N; W 1 is deuterium, hydrogen, optionally substituted C1-C6 alkyl, (nitro)methanediamine, (nitro)-N,N,N',N'-tetramethylmethanediamine, -C(O)-NR 1A R 1B 、-NR 1A -C(O)-NR 1A R 1B , -Z B -P(O)(OR 1A 2. -Z B -(CH2) p -P(O)(OR 1A 2. -Z B -(CH2) p3 -OP(O)(OR 1A )2, where Z B is N or O; p3 is an integer from 1 to 10; W 2 is an optionally substituted C1-C6 alkyl or -C(O)-NR 1A R 1B ; Each R 1 is hydrogen, halogen, amino, cyano, optionally C1-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl or -NHC(O)R 1A ;or Two R on the same atom or adjacent atoms 1 and the atoms to which they are attached are taken together to form an optionally substituted 3- to 6-membered carbocyclic or 3- to 6-membered heterocyclic ring; Each R 2 are independently hydrogen, deuterium, optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, optionally substituted C1-C 20 haloalkyl or optionally substituted C1-C 20 Alkylamino; Each R 1A are independently hydrogen or optionally substituted C1-C 20 alkyl; Each R 1B are independently hydrogen, optionally substituted 5-membered heteroaryl, optionally substituted C1-C 20 Alkyl, optionally substituted C2-C 10 Heteroalkyl or (AA) p2 ,in Each AA is an amino acid; p2 is an integer from 1 to 10; j1 is 0 or 1; n0 is 0 or 1; m1 and n1 are each independently an integer from 0 to 3; p1 is 2 or 3, provided that when Z 1 is O or NH, p1 is 2, or when Z 1 When it does not exist, p1 is 3; and Where W 1 or W 2 One of the two is connected to the oligomeric backbone.

79. The method of any one of claims 76 to 78, wherein the first end is capable of binding DNA with an affinity of less than 500 nM.

80. The method of any one of claims 76 to 79, wherein the oligomeric backbone is a linker having a length of less than about 50 angstroms.

81. The method of any one of claims 76 to 79, wherein the oligomeric backbone is a linker having a length of about 10 to 60 angstroms.

82. The method of any one of claims 76 to 81, wherein the second terminus comprises a bromodomain binding moiety.

83. The method of any one of claims 76 to 81, wherein the second terminus comprises a portion capable of binding to a bromodomain and extra-terminal domain (BET) family member.

84. The method of claim 83, wherein the BET family member is BRD2, BRD3, BRD4 or BRDT.

85. The method of any one of claims 76 to 84, wherein the second end is CBP / p300, PCAF (P300 / CBP-associated factor), CECR2 (cat eye syndrome chromosomal region candidate gene 2), BRPF (bromodomain-containing and PHD finger protein), ATAD2 / ATAD2B (chromatin remodeling protein), TRIM24 (triplet-containing motif protein 24), BAZ2 (bromodomain adjacent to zinc finger) or TAF1 (TBP-associated factor).

86. The method of any one of claims 76 to 85, wherein the method reduces one or more symptoms of Huntington's disease.

87. The method of claim 86, wherein the one or more symptoms are selected from chorea, cognitive impairment, sexual dysfunction, eye movement abnormalities, olfactory abnormalities, aggressiveness, agitation, anxiety, apathy, bradykinesia, slow thinking, clumsiness, delusions, depression, difficulty walking, disinhibition, catatonia, gait imbalance, muscle weakness, hallucinations, hostility, hypokinesia, irritability, memory impairment, myoclonus, obsessive-compulsive behavior, poor fine motor coordination, epilepsy, dysphonia, staring, weight loss, abnormal cholesterol metabolism, abnormal white matter, alcoholism, Babinski sign, caudate nucleus atrophy, brain atrophy, apnea, clonus, striatal degeneration, excessive daytime sleepiness, impaired visual-spatial constructive cognition, inability to walk, insomnia, mutism, oropharyngeal dysphagia, rigidity, suicidal ideation, cerebellar atrophy, dementia, gait ataxia, gliosis, hyperreflexia, neuronal loss, or personality changes.

88. A transcriptional regulator molecule having a first end, a second end, and an oligomeric backbone, wherein: (a) the first end comprises a DNA binding portion, and the DNA binding portion is capable of binding to a nucleotide repeat sequence comprising CAG; (b) the second end comprises a protein binding portion, the protein binding portion is capable of binding to a regulatory molecule, the regulatory molecule regulates the expression of a gene having the nucleotide repeat sequence; as well as (c) the oligomeric backbone connects the first end and the second end; and Wherein the second end comprises a structure of formula (2-A): or a pharmaceutically acceptable salt thereof, wherein: Ring A is optionally substituted aryl or optionally substituted 5- to 6-membered heteroaryl; Ring B is absent or is an optionally substituted 6-membered monocyclic aryl or heteroaryl group; D is C or N; E is O or N; Y A is -NH- or -O-; R 5 is hydrogen, deuterium or C1-C6 alkyl; R 6 is selected from hydrogen, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl and optionally substituted C1-C6 hydroxyalkyl; R 7 is selected from hydrogen, deuterium, halogen, -NO2, -CN, optionally substituted aryl, optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 heteroalkyl, optionally substituted C1-C6 haloalkyl, and optionally substituted C1-C6 hydroxyalkyl; or R 7 Yes - NR 7A R 7B ,in R 7A and R 7B are independently hydrogen, deuterium, an optionally substituted C1-C 20 Alkyl or optionally substituted C1-C 20 heteroalkyl; and x1 is an integer from 1 to 6; Or wherein the second end comprises a structure of formula (3-A): or a pharmaceutically acceptable salt thereof, wherein Y B is -CH2NH-, -CH2O-, -NH- or -O-; R 11A and R 11B are each independently hydrogen, deuterium or optionally substituted C1-C6 alkyl; R 12 is hydrogen, halogen, -OH, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl or optionally substituted C1-C6 hydroxyalkyl; R 14 and R 15 Each is independently hydrogen, deuterium, halogen, -CN, -NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl or optionally substituted C1-C6 hydroxyalkyl; or R 14 Yes - NR A R B ; R 16 is optionally substituted C1-C6 alkyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, C1-C6 hydroxyalkyl, -SO2R A or -NHSO2R A ; R Y is hydrogen, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted 5- to 6-membered monocyclic aryl or heteroaryl; Each R A and R B is independently hydrogen, deuterium, optionally substituted C1-C6 alkyl, or optionally substituted C1-C6 heteroalkyl; and y1 is 1 to 3; and wherein the connection to the linker is at R 14 or R Y Place.

89. The transcriptional regulator of claim 88, wherein the second end of formula (2-A) comprises a structure of formula (2-B) or a pharmaceutically acceptable salt thereof:

90. The transcriptional regulator of claim 88, wherein the second end of formula (2-A) comprises a structure of formula (2-C): or a pharmaceutically acceptable salt thereof, wherein: R 8 and R 9 Each is independently selected from hydrogen, deuterium, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl or optionally substituted C1-C6 hydroxyalkyl.

91. The transcriptional regulator of claim 88, wherein the second end of formula (2-A) comprises a structure of formula (2-D): or a pharmaceutically acceptable salt thereof, wherein: R 10 is selected from hydrogen, deuterium, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl or optionally substituted C1-C6 hydroxyalkyl.

92. A transcriptional regulator molecule according to any one of claims 88 to 91, or a pharmaceutically acceptable salt thereof, wherein R 5 It's hydrogen.

93. A transcriptional regulator molecule according to any one of claims 88 to 92, or a pharmaceutically acceptable salt thereof, wherein Y A is NH and x1 is 1.

94. The transcriptional regulator molecule of any one of claims 88 to 93, or a pharmaceutically acceptable salt thereof, wherein Ring B is optionally substituted aryl.

95. The transcriptional regulator of claim 88, wherein the second end of formula (3-A) comprises a structure of formula (3-C): or a pharmaceutically acceptable salt thereof, wherein: Ring C is absent or is an optionally substituted 5- to 6-membered monocyclic aryl or heteroaryl or a 4- to 8-membered heterocyclic ring; Y B is -NH-, -CH2NH-, -CH2O- or -O-; R 14 and R 15 Each is independently hydrogen, halogen, -CN, -NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl or optionally substituted C1-C6 hydroxyalkyl; or R 14 Yes - NR A R B ,in Each R A and R B are independently hydrogen, optionally substituted C1-C6 alkyl, or optionally substituted C1-C6 heteroalkyl; R 16 is a substituted C1-C6 alkyl, an optionally substituted C1-C6 heteroalkyl, an optionally substituted C2-C6 alkenyl, an optionally substituted C2-C6 alkynyl, an optionally substituted C1-C6 hydroxyalkyl, -SO2R A or -NHSO2R A ;as well as y1 is an integer from 1 to 3.

96. A transcriptional regulator according to claim 88 to 95, or a pharmaceutically acceptable salt thereof, wherein Y B It's NH.

97. The transcriptional regulator molecule of any one of claims 88, 95 or 65, or a pharmaceutically acceptable salt thereof, wherein Ring C is absent or is optionally substituted aryl.

98. The transcriptional regulator of claim 88, wherein the second end of formula (3-A) comprises a structure of formula (3-D): or a pharmaceutically acceptable salt thereof, wherein: R 11A and R 11B are each independently hydrogen or optionally substituted C1-C6 alkyl; R 12 is hydrogen or optionally substituted C1-C6 alkyl; Each R 15 are independently hydrogen, halogen, -CN, -NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl or optionally substituted C1-C6 hydroxyalkyl; R 16 is optionally substituted C1-C6 alkyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 hydroxyalkyl, -SO2R A or -NHSO2R A ;in R A is hydrogen, optionally substituted C1-C6 alkyl, or optionally substituted C1-C6 heteroalkyl; and y1 is an integer from 1 to 3.

99. A transcriptional regulator molecule according to any one of claims 88 or 95 to 98, or a pharmaceutically acceptable salt thereof, wherein R 11A and R 11B Each is independently a C1-C6 alkyl group.

100. The transcriptional regulator molecule of any one of claims 88 to 99, or a pharmaceutically acceptable salt thereof, wherein the oligomeric backbone is a linker having a length of less than about 50 angstroms.

101. The transcriptional regulator molecule of any one of claims 88 to 99, or a pharmaceutically acceptable salt thereof, wherein the oligomeric backbone is a linker having a length of about 10 to 60 angstroms.

102. The transcriptional regulator molecule of any one of claims 88 to 99, or a pharmaceutically acceptable salt thereof, wherein the oligomeric backbone comprises a polymer having 2 to 50 spacer moieties, wherein Each spacer moiety is independently selected from the group consisting of: -((CR 3a R 3b ) x -O) y -、-((CR 3a R 3b ) x -NR 4a ) y -、-((CR 3a R 3b ) x -CH=CH-(CR 3a R 3b ) x -O) y -, optionally substituted C1-C 12 Alkyl, optionally substituted C2-C 10 Alkenyl, optionally substituted C2-C 10 Alkynyl, optionally substituted C6-C 10 arylene, optionally substituted C3-C7 cycloalkylene, optionally substituted 5- to 10-membered heteroarylene, optionally substituted 4- to 10-membered heterocycloalkylene, amino acid residue, -O-, -C(O)NR 4a -、-NR 4a C(O)-, -C(O)-, -NR 1a -, -C(O)O-, -S-, -S(O)-, -S(O)2-, -S(O)2NR 4a -、-NR 4a S(O)2- and -P(O)OH- and any combination thereof; wherein each x is independently 2 to 4; each y is independently 1 to 10; Each R 1a are independently hydrogen or optionally substituted C1-C6 alkyl; Each R 3a and R 3b is independently selected from hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted alkoxy, optionally substituted amino, carboxyl, carboxyl ester, acyl, acyloxy, acylamino, aminoacyl, optionally substituted alkylamide, sulfonyl, optionally substituted thioalkoxy, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl, and optionally substituted heterocyclyl; and Each R 4a and R is independently hydrogen or optionally substituted C1-C6 alkyl.

103. The transcriptional regulator molecule of claim 102, or a pharmaceutically acceptable salt thereof, wherein each spacer moiety is independently selected from the group consisting of: -((CH2) x -O) y -、-((CH2) x -NH) y -, -O-, -C(O)NH-, -NH-, and any combination thereof.

104. The transcriptional regulator molecule of any one of claims 88 to 103, or a pharmaceutically acceptable salt thereof, wherein the polyamide is selected from linear polyamides, hairpin polyamides, H-pin polyamides, U-pin polyamides, overlapping polyamides, grafted polyamides, cyclic polyamides, tandem polyamides, and extended polyamides.

105. The transcriptional regulator molecule of claim 104, or a pharmaceutically acceptable salt thereof, wherein the polyamide is a linear polyamide.

106. The transcriptional regulator molecule of any one of claims 88 to 105, or a pharmaceutically acceptable salt thereof, wherein the DNA binding portion comprises a polyamide having one or more subunits selected from: -NH-benzopyrazinylene-C(O)-, -NH-phenylene-C(O)-, -NH-pyridinylene-C(O)-, -NH-piperidinylene-C(O)-, -NH-pyrimidinylene-C(O)-, -NH-anthracenylene-C(O)-, -NH-quinolinylene-C(O)-, and wherein each R' is independently hydrogen, an optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, optionally substituted C1-C 20 haloalkyl or optionally substituted C1-C 20 Alkylamino; And Z is H, NH2, C1-C6 alkyl, C1-C6 haloalkyl or C1-C6 alkyl-NH2.

Images