Application of polypeptide or related biological material thereof in serving and / or preparing product for regulating oral micro-ecological balance

Abstract

The invention provides application of polypeptide or related biological materials thereof in serving and / or preparing products for regulating oral micro-ecological balance. The polypeptide with the amino acid sequence as shown in SEQ ID NO: 1 or related biological materials thereof can selectively inhibit harmful bacteria (such as streptococcus mutans) in the oral cavity, and also can ensure normal physiological activities of probiotics (such as streptococcus sanguis, streptococcus salivarius, streptococcus gordoni and the like) in the oral cavity, so that the regulation of micro-ecological balance of the oral cavity is realized, and the oral health of a human body is ensured.

Description

Technical Field

[0001] The present invention belongs to the field of polypeptide technology, and more specifically, relates to the use of polypeptides or related biomaterials in the production and / or preparation of products for regulating the balance of oral microecology. Background Art

[0002] Billions of microorganisms live in the oral cavity. Various microorganisms coexist, compete and antagonize in different parts, maintaining a self-stabilizing state of dynamic balance in population size and function, and building a complex human oral microecological "micro world". Among them, the oral flora, as the second largest flora in the human body, has more than 700 species of bacteria, most of which are beneficial and can resist diseases, help digestion and regulate body functions. They play an important role in oral health and are called oral probiotics.

[0003] Oral probiotics are a type of active microorganisms that are beneficial to the host. They mainly exert their beneficial effects by secreting antibacterial substances, competing with harmful oral bacteria for colonization, regulating the host immune response, and adjusting the pH value of the biofilm. For example, Streptococcus salivarius ( Streptococcus salivarius ), Streptococcus gordonii ( Streptococcus gordonii ) have been shown to prevent the growth of harmful microorganisms.

[0004] Under normal physiological conditions, there is a dynamic balance between oral microorganisms and between microorganisms and hosts, and they jointly participate in the body's metabolism, immunity, nutrition and maintenance of oral health. However, many oral products currently kill oral harmful bacteria while also killing too many oral probiotics, which breaks the balance of the oral microecology and leads to the occurrence of oral diseases. Oral diseases will further aggravate the imbalance of the oral microecology, causing oral problems to enter a vicious cycle. Therefore, it is very necessary to find a product that can effectively regulate the balance of the oral microecology for oral health. Summary of the invention

[0005] The present invention aims to provide a polypeptide or its related biomaterials for use as and / or in the preparation of products for regulating oral microecological balance. The polypeptide or its related biomaterials can selectively inhibit oral harmful bacteria while ensuring the normal physiological activities of oral probiotics, thereby regulating the oral microecological balance and ensuring the oral health of the body.

[0006] The first object of the present invention is to provide the use of a polypeptide or its related biomaterials as and / or in the preparation of a product for regulating the balance of oral microecology.

[0007] The second object of the present invention is to provide the use of active peptides or related biomaterials thereof as and / or in the preparation of products for regulating the balance of oral microecology.

[0008] The above-mentioned purpose of the present invention is achieved through the following technical solutions: The polypeptide or its related biomaterials having an amino acid sequence as shown in SEQ ID NO:1 of the present invention can selectively inhibit harmful oral bacteria (such as Streptococcus mutans, etc.) while ensuring the normal physiological activities of oral probiotics (such as Streptococcus sanguinis, Streptococcus salivarius, Streptococcus gordonii, etc.), thereby effectively regulating the microecological balance of the oral cavity. Therefore, the present invention provides the use of the polypeptide or its related biomaterials as and / or in the preparation of a product for regulating the microecological balance of the oral cavity, wherein the amino acid sequence of the polypeptide is as shown in SEQ ID NO:1.

[0009] Preferably, the relevant biological material is a nucleic acid molecule capable of expressing the polypeptide, or an expression cassette, a recombinant plasmid, a recombinant bacterium or a recombinant cell containing the nucleic acid molecule.

[0010] In addition, the present invention also provides the use of active peptides or related biomaterials in the production and / or preparation of products for regulating the balance of oral microecology, wherein the active peptides have more than 85% homology with the polypeptide having an amino acid sequence as shown in SEQ ID NO: 1.

[0011] Preferably, the relevant biological material is a nucleic acid molecule capable of expressing the active peptide, or an expression cassette, recombinant plasmid, recombinant bacteria or recombinant cell containing the nucleic acid molecule.

[0012] Preferably, the regulation of oral microecological balance is to inhibit the growth of harmful bacteria in the oral cavity and promote and / or not inhibit the growth of probiotics in the oral cavity.

[0013] More preferably, the inhibiting the growth of harmful oral bacteria is inhibiting the growth of Streptococcus mutans.

[0014] More preferably, the inhibition of the growth of mutans Streptococcus is the inhibition of the formation of mutans Streptococcus biofilm.

[0015] More preferably, the oral probiotics are one or more of Streptococcus sanguinis, Streptococcus salivarius, and Streptococcus gordonii.

[0016] Preferably, the product is one or more of an oral care liquid, an oral lozenge, a mouthwash, a toothpaste or a mouthwash effervescent tablet.

[0017] Preferably, the product further contains auxiliary materials.

[0018] The present invention has the following beneficial effects: The polypeptide of the present invention whose amino acid sequence is shown in SEQ ID NO:1 or its related biomaterial can selectively inhibit harmful oral bacteria (such as Streptococcus mutans, etc.) while ensuring the normal physiological activities of oral probiotics (such as Streptococcus sanguinis, Streptococcus salivarius, Streptococcus gordonii, etc.), thereby effectively regulating the microecological balance of the oral cavity. Therefore, the present invention provides the use of the polypeptide of the amino acid sequence shown in SEQ ID NO:1 or its related biomaterial in the product of and / or preparation of the product of regulating the microecological balance of the oral cavity. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The results of crystal violet staining experiment on biofilm of Streptococcus mutans.

[0020] Figure 2 The results of the crystal violet staining experiment on biofilm of Streptococcus salivarius.

[0021] Figure 3 The results of the crystal violet staining experiment on the biofilm of Streptococcus sanguis.

[0022] Figure 4 These are the statistical results of the number of each bacterial species in the Streptococcus sanguis and Streptococcus mutans dual-species biofilm experiment.

[0023] Figure 5 These are the statistical results of the percentage of each bacterial species in the Streptococcus sanguis and Streptococcus mutans dual-species biofilm experiment.

[0024] Figure 6 These are the statistical results of the number of each bacterial species in the biofilm experiment of Streptococcus sanguinis, Streptococcus salivarius and Streptococcus mutans.

[0025] Figure 7 These are the statistical results of the percentage of each bacterial species in the biofilm experiment of Streptococcus sanguinis, Streptococcus salivarius and Streptococcus mutans.

[0026] Figure 8 These are the statistical results of the number of each bacterial species in the biofilm experiment of Streptococcus sanguinis, Streptococcus gordonii and Streptococcus mutans.

[0027] Fig. 9 These are the statistical results of the percentage of each bacterial species in the biofilm experiment of Streptococcus sanguinis, Streptococcus gordonii and Streptococcus mutans. DETAILED DESCRIPTION

[0028] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0029] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0030] Streptococcus mutans: No. ATCC 700610, purchased from the American Type Culture Collection (ATCC).

[0031] Streptococcus sanguis: ATCC number 10556, purchased from the American Type Culture Collection (ATCC).

[0032] Streptococcus salivarius: ATCC 27975, purchased from the American Type Culture Collection (ATCC).

[0033] Streptococcus gordonii: ATCC 35105, purchased from the American Type Culture Collection (ATCC).

[0034] Example 1 Synthesis of polypeptide The peptide was synthesized by Sangon Bioengineering Co., Ltd. (amino acid sequence is shown in SEQ ID NO: 1: GLDWWQL).

[0035] Example 2 Effects of polypeptides on common oral bacteria in a single-bacteria system 1. Effects of peptides on biofilm of Streptococcus mutans In this example, the effect of the polypeptide obtained in Example 1 on the biofilm of Streptococcus mutans at different concentrations (6.25, 12.5, 25 μM) was tested by biofilm crystal violet staining experiment.

[0036] The specific steps of the biofilm crystal violet staining experiment are as follows: (1) Cultivation of biofilm: Use BHI medium to revive and culture mutans streptococci, collect mutans streptococci in the logarithmic phase, wash with PBS, and resuspend in CDM medium containing 1 wt% sucrose. In a 96-well plate, culture mutans streptococci at 1×10 7 The initial concentration of CFU / mL was inoculated in 200 μL of CDM medium containing 1wt% sucrose. Subsequently, the peptide was added to the medium to make the final concentration of the peptide 6.25, 12.5, and 25 μM, respectively (the experiment without peptide was used as the blank control group). The mutans streptococcus biofilm was formed by anaerobic culture at 37 °C and 5% CO2 for 24 h.

[0037] (2) Sample fixation: After the culture is completed, the supernatant is removed, the sample is washed three times with PBS to remove floating bacteria, and then fixed with methanol for 15 min.

[0038] (3) Staining: After staining with 0.1 mL of 0.1% (w / v) crystal violet staining solution for 5 min, wash thoroughly with sterile saline to remove excess crystal violet dye, add 200 μL of 95% (v / v) ethanol, and then shake the 96-well plate for 30 min.

[0039] (4) Quantitative analysis: The absorbance (OD value) at 595 nm is measured by a spectrophotometer, which indirectly reflects the biomass of the biofilm.

[0040] The results are as follows Figure 1 As shown. Figure 1 It can be seen that under the action of the polypeptide at a concentration of 6.25 to 25 μM, the biomass of the mutans Streptococcus biofilm is significantly reduced, indicating that the polypeptide of the present invention can significantly inhibit the formation of mutans Streptococcus biofilm, and further significantly inhibit the growth of mutans Streptococcus.

[0041] 2. Effects of peptides on Streptococcus salivarius biofilm The same method as the aforementioned “Effect of Peptides on Streptococcus Mutans Biofilm” was used to test the effect of peptides on Streptococcus salivarius biofilm at different concentrations (6.25, 12.5, 25 μM), and the experiment without peptide was used as a blank control group.

[0042] The results are as follows Figure 2 As shown. Figure 2 It can be seen that the peptide has no inhibitory effect on the formation of S. salivarius biofilm in the concentration range of 6.25-25 μM, indicating that it will not inhibit the growth of S. salivarius.

[0043] 3. Effects of peptides on Streptococcus sanguis biofilm The same method as the aforementioned “Effect of Peptides on Streptococcus Mutans Biofilm” was used to test the effect of peptides on Streptococcus sanguis biofilm at different concentrations (6.25, 12.5, 25 μM), and the experiment without peptide was used as a blank control group.

[0044] The results are as follows Figure 3 As shown. Figure 3 It can be seen that the peptide has no inhibitory effect on the formation of Streptococcus sanguis biofilm in the concentration range of 6.25-25 μM, indicating that it will not inhibit the growth of Streptococcus sanguis.

[0045] In summary, it can be seen that the polypeptide of the present invention can selectively inhibit harmful oral bacteria (such as Streptococcus mutans) while ensuring the normal physiological activities of oral probiotics (such as Streptococcus salivarius and Streptococcus sanguinis), indicating that the polypeptide of the present invention can effectively regulate the microecological balance of the oral cavity and ensure the oral health of the body.

[0046] Example 3 Effects of polypeptides on common oral bacteria in a mixed bacterial system 1. Streptococcus sanguinis-Streptococcus mutans dual-strain biofilm experiment Use BHI medium to recover and culture Streptococcus sanguinis and Streptococcus mutans, collect Streptococcus sanguinis and Streptococcus mutans in the logarithmic phase, wash with PBS, and resuspend in CDM medium containing 1wt% sucrose. In a 24-well plate, place Streptococcus sanguinis and Streptococcus mutans at 1×107 The initial concentration of CFU / mL was inoculated in CDM medium containing 1wt% sucrose. Subsequently, the peptide was added to the medium to make the final concentration of the peptide 1.56, 3.13, 6.25, 12.5, and 25 μM, respectively (the experiment without peptide was used as the blank control group). The biofilm of Streptococcus sanguinis and Streptococcus mutans was formed by anaerobic culture at 37 °C and 5% CO2 for 24 h. After the culture was completed, the supernatant was removed, the cells were washed three times with PBS, the biofilm of Streptococcus sanguinis and Streptococcus mutans was collected, and genomic DNA was extracted. The DNA of Streptococcus sanguinis and Streptococcus mutans were amplified using 16S rRNA-specific primers (Streptococcus sanguinis: forward primer SEQ ID NO: 2: CAAAATTGTTGCAAATCCAAAGG, reverse primer SEQ ID NO: 3: GCTATCGCTCCCTGTCTTTGA; Streptococcus mutans: forward primer SEQ ID NO: 4: GCCTACAGCTCAGAGATGCTATTCT, reverse primer SEQ ID NO: 5: GCCATACACCACTCATGAATTGA), respectively, and the Ct value of each bacterial species was recorded. The specific number and percentage of each bacterial species in the mixed flora were calculated based on the Ct-CFU standard curve of each bacterial species.

[0047] The statistical results of the number of each bacterial species in the mixed bacterial community are as follows: Figure 4 As shown. It can be seen that in the Streptococcus sanguinis-Streptococcus mutans dual-strain culture system, under the action of various concentrations of polypeptides, the bacterial amount of Streptococcus sanguinis remained basically unchanged, while the bacterial amount of Streptococcus mutans decreased significantly. This shows that the polypeptide of the present invention can target and inhibit oral harmful bacteria (Streptococcus mutans) without interfering with oral probiotics (Streptococcus sanguinis), thereby effectively regulating the microecological balance of the oral cavity.

[0048] The statistical results of the percentage of each bacterial species in the mixed bacterial community are as follows: Figure 5 As shown. It can be seen that in the sanguinic acid-mutant streptococcus dual-strain culture system, under the action of each concentration of polypeptide, the proportion of sanguinic acid increased, while the proportion of mutans streptococcus decreased significantly. This shows that the polypeptide of the present invention can target and inhibit oral harmful bacteria (mutant streptococci) without interfering with oral probiotics (sanguinic acid), thereby effectively regulating the microecological balance of the oral cavity.

[0049] 2. Biofilm experiment of Streptococcus sanguinis, Streptococcus salivarius and Streptococcus mutans BHI medium was used to recover and culture Streptococcus sanguinis, Streptococcus salivarius, and Streptococcus mutans. The logarithmic phase Streptococcus sanguinis, Streptococcus salivarius, and Streptococcus mutans were collected, washed with PBS, and resuspended in CDM medium containing 1 wt% sucrose. In a 24-well plate, Streptococcus sanguinis, Streptococcus salivarius, and Streptococcus mutans were cultured at 1×10 6The initial concentration of CFU / mL was inoculated in CDM medium containing 1wt% sucrose. Subsequently, the peptide was added to the medium to make the final concentration of the peptide 1.56, 3.13, 6.25, 12.5, and 25 μM, respectively (the experiment without peptide was used as the blank control group). The three-species biofilm of Streptococcus sanguinis, Streptococcus salivarius, and Streptococcus mutans was formed by anaerobic culture at 37 °C and 5% CO2 for 24 h. After the culture was completed, the supernatant was removed and the cells were washed three times with PBS. The biofilms of Streptococcus sanguinis, Streptococcus salivarius and Streptococcus mutans were collected and genomic DNA was extracted. The 16S rRNA-specific primers (Streptococcus sanguinis: forward primer SEQ ID NO: 2: CAAAATTGTTGCAAATCCAAAGG, reverse primer SEQ ID NO: 3: GCTATCGCTCCCTGTCTTTGA; Streptococcus salivarius: forward primer SEQ ID NO: 6: CTGCTCTTGTGACAGCCCAT, reverse primer SEQ ID NO: 7: ACGGGAAGCTGATCTTTCGTA; Streptococcus mutans: forward primer SEQ ID NO: 4: GCCTACAGCTCAGAGATGCTATTCT, reverse primer SEQ ID NO: 8: GCCTACAGCTCAGAGATGCTATTCT) were used to amplify the genomic DNA. NO:5: GCCATACACCACTCATGAATTGA) were used to amplify the DNA of Streptococcus sanguinis, Streptococcus salivarius and Streptococcus mutans, and the Ct value of each bacterial species was recorded. Then, based on the Ct-CFU standard curve of each bacterial species, the specific number and percentage of each bacterial species in the mixed flora were calculated.

[0050] The statistical results of the number of each bacterial species in the mixed bacterial community are as follows: Figure 6 As shown. It can be seen that in the three-strain culture system of Streptococcus sanguinis-Streptococcus salivarius-Streptococcus mutans, under the action of polypeptides at various concentrations, the bacterial counts of Streptococcus sanguinis and Streptococcus salivarius remain basically unchanged, while the bacterial count of Streptococcus mutans is significantly reduced. This shows that the polypeptide of the present invention can target and inhibit oral harmful bacteria (Streptococcus mutans) without interfering with oral probiotics (Streptococcus sanguinis and Streptococcus salivarius), thereby effectively regulating the microecological balance of the oral cavity.

[0051] The statistical results of the percentage of each bacterial species in the mixed bacterial community are as follows: Figure 7 As shown. It can be seen that in the three-strain culture system of Streptococcus sanguinis-Streptococcus salivarius-Streptococcus mutans, under the action of polypeptides at various concentrations, the proportion of Streptococcus salivarius increased, the proportion of Streptococcus sanguinis remained basically unchanged, and the proportion of Streptococcus mutans decreased significantly. This shows that the polypeptide of the present invention can target and inhibit oral harmful bacteria (Streptococcus mutans) without interfering with oral probiotics (Streptococcus sanguinis, Streptococcus salivarius), thereby effectively regulating the microecological balance of the oral cavity.

[0052] 3. Biofilm experiment of Streptococcus sanguinis, Streptococcus gordonii and Streptococcus mutans Use BHI medium to recover and culture Streptococcus sanguinis, Streptococcus gordonii, and Streptococcus mutans, collect Streptococcus sanguinis, Streptococcus gordonii, and Streptococcus mutans in the logarithmic phase, wash with PBS, and resuspend in CDM medium containing 1wt% sucrose. In a 24-well plate, Streptococcus sanguinis, Streptococcus gordonii, and Streptococcus mutans were cultured at 1×10 7 The initial concentration of CFU / mL was inoculated in CDM medium containing 1wt% sucrose. Subsequently, the peptide was added to the medium to make the final concentration of the peptide 1.56, 3.13, 6.25, 12.5, and 25 μM, respectively (the experiment without peptide was used as the blank control group). The three-species biofilm of Streptococcus sanguinis, Streptococcus gordonii, and Streptococcus mutans was formed by anaerobic culture at 37 °C and 5% CO2 for 24 h. After the culture was completed, the supernatant was removed and the cells were washed three times with PBS. The biofilms of Streptococcus sanguinis, Streptococcus gordonii and Streptococcus mutans were collected and genomic DNA was extracted. The 16S rRNA-specific primers (Streptococcus sanguinis: forward primer SEQ ID NO: 2: CAAAATTGTTGCAAATCCAAAGG, reverse primer SEQ ID NO: 3: GCTATCGCTCCCTGTCTTTGA; Streptococcus gordonii: forward primer SEQ ID NO: 8: CGGATGATGCTAATCAAGTGCCC, reverse primer SEQ ID NO: 9: GTTAGCTGTTGGATTGGTTGCC; Streptococcus mutans: forward primer SEQ ID NO: 4: GCCTACAGCTCAGAGATGCTATTCT, reverse primer SEQ ID NO: 5: GCCTACAGCTCAGAGATGCTATTCT, reverse primer SEQ ID NO: 6: GCCTACAGCTCAGAGATGCTATTCT, reverse primer SEQ ID NO: 7: GCCTACAGCTCAGAGATGCTATTCT, reverse primer SEQ ID NO: 8: GCCTACGCTCCCTGTCTTTGA) were used to detect the expression of the 16S rRNA-specific primers. NO:5: GCCATACACCACTCATGAATTGA) were used to amplify the DNA of Streptococcus sanguinis, Streptococcus gordonii, and Streptococcus mutans, and the Ct value of each bacterial species was recorded. The specific number and percentage of each bacterial species in the mixed flora were then calculated based on the Ct-CFU standard curve of each bacterial species.

[0053] The statistical results of the number of each bacterial species in the mixed bacterial community are as follows: Figure 8 As shown. It can be seen that in the three-strain culture system of Streptococcus sanguinis-Streptococcus gordonii-Streptococcus mutans, under the action of various concentrations of polypeptides, the bacterial counts of Streptococcus sanguinis and Streptococcus gordonii remained basically unchanged, while the bacterial count of Streptococcus mutans was significantly reduced. This shows that the polypeptide of the present invention can target and inhibit oral harmful bacteria (Streptococcus mutans) without interfering with oral probiotics (Streptococcus sanguinis and Streptococcus gordonii), thereby effectively regulating the microecological balance of the oral cavity.

[0054] The statistical results of the percentage of each bacterial species in the mixed bacterial community are as follows: Fig. 9As shown. It can be seen that in the three-strain culture system of Streptococcus sanguinis-Streptococcus gordonii-Streptococcus mutans, under the action of polypeptides at various concentrations, the proportion of Streptococcus sanguinis increased, the proportion of Streptococcus gordonii remained basically unchanged, and the proportion of Streptococcus mutans decreased significantly. This shows that the polypeptide of the present invention can target and inhibit oral harmful bacteria (Streptococcus mutans) without interfering with oral probiotics (Streptococcus sanguinis, Streptococcus gordonii), thereby effectively regulating the microecological balance of the oral cavity.

[0055] In summary, the polypeptide of the present invention having an amino acid sequence as shown in SEQ ID NO: 1 or its related biomaterials can selectively inhibit harmful oral bacteria (such as Streptococcus mutans, etc.) while ensuring the normal physiological activities of oral probiotics (such as Streptococcus sanguinis, Streptococcus salivarius, Streptococcus gordonii, etc.), thereby effectively regulating the microecological balance of the oral cavity and ensuring the oral health of the body.

[0056] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Use of polypeptides or related biomaterials as and / or in the preparation of products for regulating oral microecological balance, characterized in that: The amino acid sequence of the polypeptide is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that: The related biological material is a nucleic acid molecule capable of expressing the polypeptide, or an expression box, a recombinant plasmid, a recombinant bacterium or a recombinant cell containing the nucleic acid molecule.

3. Use of active peptides or related biomaterials as and / or in the preparation of products for regulating oral microecological balance, characterized in that: The active peptide has more than 85% homology with the polypeptide with an amino acid sequence as shown in SEQ ID NO:

1.

4. The use according to claim 3, characterized in that: The related biological material is a nucleic acid molecule capable of expressing the active peptide, or an expression box, a recombinant plasmid, a recombinant bacterium or a recombinant cell containing the nucleic acid molecule.

5. The use according to any one of claims 1 to 4, characterized in that: The regulation of the oral microecological balance is to inhibit the growth of harmful bacteria in the oral cavity and promote and / or not inhibit the growth of probiotics in the oral cavity.

6. The use according to claim 5, characterized in that: The inhibition of the growth of harmful oral bacteria is the inhibition of the growth of Streptococcus mutans.

7. The use according to claim 6, characterized in that: The inhibition of the growth of mutans streptococci is the inhibition of the formation of mutans streptococcus biofilm.

8. The use according to claim 5, characterized in that: The oral probiotics are one or more of Streptococcus sanguinis, Streptococcus salivarius, and Streptococcus gordonii.

9. The use according to any one of claims 1 to 4, characterized in that: The product is one or more of oral care liquid, oral lozenges, mouthwash, toothpaste or mouthwash effervescent tablets.

10. The use according to any one of claims 1 to 4, characterized in that: The product also contains excipients.

Images