KYJ protein for negative regulation of saline-alkali resistance of poplar and coding gene and application of KYJ protein

Abstract

The invention discloses two KYJ proteins for negative regulation of saline-alkali resistance of poplar and coding genes and application thereof, the amino acid sequence of the KYJ proteins is shown as SEQ ID NO.2 or SEQ ID NO.5, and the sequence of the coding gene kyj is shown as SEQ ID NO.1 or SEQ ID NO.4. The invention further discloses a preparation method of the KYJ proteins. Experiments prove that under the saline-alkali condition, compared with a wild type, the kyj gene double-process strain is higher in plant height, stronger in photosynthesis, larger in biomass and better in growth vigor, that is, the saline-alkali resistance of the kyj gene double-process strain is obviously superior to that of the wild type material, which indicates that the kyj gene plays an important regulation function in the process that the poplar responds to saline-alkali stress; the method has important guiding significance for genetic improvement of the poplar.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to two proteins KYJ1 and KYJ2 for negatively regulating salt-alkali resistance of poplars and application of encoding genes thereof. Background Art

[0002] Salt-alkali stress is one of the main abiotic stresses that inhibit plant growth and development, second only to drought stress. It not only affects plant growth and development, but also poses a serious threat to agricultural production and the ecological environment. Poplar (Populus L.) is one of the most widely distributed and adaptable tree species in the world. It is the main tree species for building shelterbelts and timber forests in the northern plains and sandy areas. Salt-alkali stress will inhibit the photosynthesis of poplars and affect their growth. Under salt-alkali stress, plants will induce the expression of salt-alkali resistance genes in the body to improve their salt-alkali resistance. Biotechnology will introduce isolated or cloned salt-alkali resistance genes into crops with weak salt-alkali resistance to improve their salt-alkali resistance. In a short period of time, more salt-alkali resistance mutants and salt-alkali resistance transgenic plants will be screened out, and new salt-alkali resistance crop varieties that can be widely used in production will be cultivated through resistance and adaptability training. Biotechnology is one of the main means to solve the problem of plant resistance to salt and alkali, and it is also an effective way to expand the area of ​​​​arable land, ensure food and oil security, improve the ecological environment, and ensure the sustainable development of agriculture. However, an important prerequisite for achieving this is to explore and mine the genes related to plant salt-alkali resistance. Summary of the invention

[0003] One of the purposes of the present invention is to provide two proteins KYJ1 and KYJ2 which negatively regulate salt-alkali resistance of poplar and their encoding genes.

[0004] The second object of the present invention is to provide the use of the above protein and its encoding gene in improving the salt-alkali resistance of poplar.

[0005] In order to achieve the above object, the technical solution of the present invention is as follows:

[0006] Protein KYJ1 regulating poplar salt-alkali resistance, the protein is the following A1), A2) or A3):

[0007] A1) The amino acid sequence is the protein shown in SEQ ID NO.2;

[0008] A2) a protein having the same function as the amino acid sequence shown in SEQ ID NO. 2 in the sequence list, wherein one or more amino acid residues are substituted and / or deleted and / or added;

[0009] A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

[0010] Protein KYJ2 that regulates salt-alkali resistance of poplar, the protein is as follows B1), B2) or B3):

[0011] B1) the amino acid sequence is the protein shown in SEQ ID NO.5;

[0012] B2) a protein having the same function as the amino acid sequence shown in SEQ ID NO. 5 in the sequence list, with one or more amino acid residues substituted and / or deleted and / or added;

[0013] B3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B1) or B2).

[0014] The protein in A2) is a protein having 75% or more identity with the amino acid sequence of the protein shown in SEQ ID NO.2 and having the same function. The protein in B2) is a protein having 75% or more identity with the amino acid sequence of the protein shown in SEQ ID NO.5 and having the same function. The 75% or more identity is 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity.

[0015] The proteins in A2) and B2) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0016] The coding genes of the proteins in A2) or B2) above (named kyj1 gene and kyj2 gene, respectively) can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID NO.1 or SEQ ID NO.4, and / or performing missense mutations of one or several base pairs, and / or connecting the coding sequence of the tag shown in the above table to its 5′ end and / or 3′ end.

[0017] The present invention also provides the coding sequences of the above proteins KYJ1 and KYJ2, which are shown in SEQ ID NO.1 and SEQ ID NO.4. The DNA molecule shown in SEQ ID NO.1 encodes the protein KYJ1 shown in SEQ ID NO.2. The DNA molecule shown in SEQ ID NO.4 encodes the protein KYJ2 shown in SEQ ID NO.5.

[0018] It is further defined that the coding sequence also includes any one of the following:

[0019] (1) The coding sequence is a cDNA molecule or a DNA molecule of SEQ ID NO.1 or SEQ ID NO.4;

[0020] (2) the cDNA molecule or DNA molecule shown in SEQ ID NO.1 or SEQ ID NO.4 in the sequence listing;

[0021] (3) the DNA molecule shown in SEQ ID NO.3 or SEQ ID NO.6 in the sequence listing;

[0022] (4) A cDNA molecule or a DNA molecule that has 75% or more identity with the coding sequence and encodes the protein.

[0023] (5) A cDNA molecule or a genomic DNA molecule that hybridizes with the coding sequence defined in (1) or (2) or (3) or (4) above under stringent conditions and encodes the protein.

[0024] It is further defined that the coding sequence can be DNA, such as cDNA, genomic DNA or recombinant DNA, or RNA, such as mRNA or hnRNA.

[0025] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the present invention encoding the protein consisting of the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.4. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0026] The aforementioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0027] The nucleotide sequences of kyj1 gene and kyj2 gene have an identity higher than 85%. Therefore, the present invention collectively refers to kyj1 and kyj2 as kyj genes, and the proteins encoded by kyj1 and kyj2 as KYJ proteins.

[0028] The present invention also provides a biological material related to the above coding sequence, wherein the biological material is any one of the following materials:

[0029] C1) a nucleic acid molecule encoding a KYJ protein;

[0030] C2) contains the CRISPR / CAS9 gene editing site target sequence of the nucleic acid molecule described in C1);

[0031] C3) a gene expression cassette containing the sequence of C1) or a portion of the sequence;

[0032] C4) a recombinant vector containing the expression cassette described in C3);

[0033] C5) a recombinant microorganism containing the nucleic acid molecule described in C1);

[0034] C6) a recombinant microorganism containing the expression cassette described in C3);

[0035] C7) a recombinant microorganism containing the recombinant vector described in C4);

[0036] C8) a recombinant microorganism containing the recombinant vector described in C4);

[0037] C9) a transgenic plant cell line containing the expression cassette described in C3);

[0038] C10) a transgenic plant cell line containing the recombinant vector described in C4);

[0039] C11) A transgenic plant cell line containing the recombinant vector described in C4).

[0040] In the above application, the nucleic acid molecule or sequence described in C1) or C2) is the gene shown in (1) or (2) or (3) or (4) or (5) above.

[0041] In addition, a person skilled in the art can easily mutate the kyj gene of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides with 75% or higher identity to the nucleotide sequence encoding the protein are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the same protein and have the same function. Primer pairs for amplifying the full length of the coding sequence encoding the protein KYJ or its fragments also fall within the scope of protection of the present invention.

[0042] The main purpose of the present invention is to protect the above protein KYJ, the kyj gene encoding the protein KYJ and the application of biological materials containing the above coding sequence in regulating the salt-alkali resistance of poplar.

[0043] The regulation is negative regulation, and the negative regulation of poplar salt-alkali resistance is specifically manifested as: compared with the wild type, the kyj gene knockout strain has higher plant height, stronger photosynthesis, larger biomass and better growth under saline-alkali conditions.

[0044] Furthermore, under saline-alkali conditions, compared with the wild type, the chlorophyll content and net photosynthetic rate of the kyj gene knockout strain decreased less, the malondialdehyde (MDA) content was relatively low, the proline (Pro) content was significantly higher than the wild type, and the superoxide dismutase (SOD) and ascorbate peroxidase (APX) activities were significantly higher than those of the wild type, indicating that the kyj gene knockout strain has stronger stress resistance.

[0045] In addition, the present invention also discloses a method for improving salt-alkali resistance of poplar, the method comprising:

[0046] (1) By reducing the activity of protein KYJ in poplar or reducing the content of protein KYJ in poplar;

[0047] (2) By reducing the expression of kyj gene in poplar.

[0048] The expression of kyj gene in the recipient plant can be reduced by knocking out the kyj gene in the recipient plant to improve the salt-alkali resistance of the recipient plant. The kyj gene can be knocked out by RNAi or CRISPR / Cas9 technology.

[0049] In the above, the receptor plant can be either a monocot or a dicot. The present invention uses poplar as the experimental material.

[0050] Furthermore, the present invention also provides a method for cultivating salt-alkali resistant poplars, the method comprising the following steps: gene editing the kyj gene in the plant genome to obtain a gene-edited plant, and obtaining a homozygous gene-edited plant from the self-pollinated offspring of the gene-edited plant; the homozygous gene-edited plant is a salt-alkali resistant plant. The self-pollinated offspring can be the offspring of the first generation of self-pollination, the offspring of the second generation of self-pollination, the offspring of the third generation of self-pollination, etc., until a homozygous gene-edited plant is obtained. The self-pollinated offspring of the homozygous gene-edited plant is a salt-alkali resistant strain.

[0051] In the above-mentioned method, gene editing of the kyj gene in the plant genome can be specifically achieved through the Cas9 system.

[0052] In the above method, gene editing of the kyj gene in the plant genome is specifically achieved by introducing a recombinant plasmid. The recombinant plasmid can be specifically: using the Golden Gate method (using the restriction endonuclease Bsa I), the linearized sgRNA expression cassette and the pHSbdcas9i-tRNA-ccdb (K5N) plasmid (from Wuhan Boyuan Biotechnology Co., Ltd.) are connected to obtain a recombinant plasmid.

[0053] The substance used for gene editing of the kyj1 gene in the plant genome can specifically be product A, product B, product C or product D.

[0054] Product A includes specific sgRNA and CAS9 protein.

[0055] Product B includes a DNA molecule expressing a specific sgRNA and a DNA molecule expressing a CAS9 protein.

[0056] Product C includes a recombinant plasmid expressing specific sgRNA and a plasmid expressing CAS9 protein.

[0057] Product D includes a recombinant plasmid expressing specific sgRNA and CAS9 protein.

[0058] The target sequences of the specific sgRNA are: "ACGGGTCTTAGTGTGCTAGCCGG" and "TCGCTTGTCTTTGTTCCCGTTGG" in the kyj1 gene and "CGCATGGCGTGTAGTAGCTGCGG" and "GGTTATGGACCAGAAGCCCATGG" in the kyj2 gene.

[0059] The sequence of the specific sgRNA is:

[0060] ①UGCCCAGAAUCACACGAUCG GCC

[0061] ②AGCGAACAGAAACAAGGGCA ACC

[0062] ③GCGUACCGCACAUCAUCGAC GCC

[0063] ④CCAAUACCUGGUCUUCGGGUACC.

[0064] The recombinant plasmid expressing specific sgRNA and CAS9 protein can be specifically: using the Golden Gate method (using the restriction endonuclease Bsa I), the linearized sgRNA expression cassette and the pHSbdcas9i-tRNA-ccdb (K5N) plasmid are connected to obtain a recombinant plasmid.

[0065] The experiment of the present invention proves that the kyj double mutant strain shows stronger salt-alkali resistance than the wild-type strain, thereby proving that the KYJ protein and its encoding gene can negatively regulate the salt-alkali resistance of plants.

[0066] The above method for promoting the growth and development of poplars is also applicable to other receptor plants with homologous genes to poplars. There is no particular limitation on the receptor plants applicable to the present invention, including not only poplars, but also other plants with high homology, as long as they are suitable for gene transformation operations, such as various crops, flower plants or forestry plants. The plants can be, for example (but not limited to): dicots, monocots, woody plants, Rosales, Rosaceae, Prunus, peach, Cruciferae, Arabidopsis, Arabidopsis, etc.

[0067] The "plant" mentioned in the present invention includes the whole plant, its parent and progeny plants and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues and organs, and our target gene or nucleic acid is present in these different parts. The "plant" mentioned here also includes plant cells, suspension cultures, callus, embryos, meristem regions, gametophytes, sporophytes, pollen and microspores, and similarly, each of the aforementioned objects contains the target gene / nucleic acid.

[0068] The present invention includes any plant cell, or any plant obtained or obtainable by the method therein, and all plant parts and propagules thereof. This patent also includes transfected cells, tissues, organs or whole plants obtained by any of the aforementioned methods. The only requirement is that the progeny exhibit the same genotypic or phenotypic characteristics, and the progeny obtained using the method of this patent have the same characteristics.

[0069] The invention also extends to the harvestable parts of the plants as described above, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. It also further relates to other derivatives of the plants after harvest, such as dry granules or powders, oils, fats and fatty acids, starch or proteins. The invention also relates to foods or food additives obtained from the relevant plants.

[0070] Advantages of the present invention:

[0071] During the research process, the present invention discovered a new protein KYJ for regulating plant salt-alkali resistance from poplar, and proved through experiments that under saline-alkali conditions, compared with the wild type, the kyj gene double mutant strain has a higher plant height, stronger photosynthesis, larger biomass and better growth, that is, the salt-alkali resistance of the kyj gene double mutant strain is significantly better than that of the wild type material, indicating that the kyj gene plays an important regulatory function in the process of poplar responding to salt-alkali stress, and has important guiding significance for the genetic improvement of poplar. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] Figure 1 This is the sequencing peak diagram of the target area.

[0073] Figure 2 An exemplary photograph of a cell under a laser scanning confocal microscope.

[0074] Figure 3 The phenotypes of wild-type plants and kyj-T4 plants after treatment with 150 mM NaCl and 50 mM NaHCO3.

[0075] Figure 4 The figure shows the results of physiological index analysis of wild-type plants and kyj-T4 plants after treatment with 150mM NaCl and 50mM NaHCO3; Figure 4A in the figure is fresh weight analysis, and B is plant height analysis.

[0076] Figure 5 The figure shows the results of physiological index analysis of wild-type plants and kyj-T4 plants after treatment with 150mM NaCl and 50mM NaHCO3; Figure 5 Figure A is the chlorophyll content analysis, and Figure B is the net photosynthetic rate analysis.

[0077] Figure 6 The figure shows the results of physiological index analysis of wild-type plants and kyj-T4 plants after treatment with 150mM NaCl and 50mM NaHCO3; Figure 6 A is the MDA content analysis, and B is the proline content analysis.

[0078] Figure 7 The figure shows the results of physiological index analysis of wild-type plants and kyj-T4 plants after treatment with 150mM NaCl and 50mM NaHCO3; Figure 7 A in the figure is APX activity analysis, and B is SOD activity analysis.

[0079] Figure 8 This is a photo of Western Blotting results. DETAILED DESCRIPTION

[0080] The present invention will be further described below in conjunction with specific examples, and the advantages and features of the present invention will become clearer as the description proceeds. However, the specific experimental methods involved in the following examples are all conventional methods or implemented under the conditions recommended by the manufacturer's instructions unless otherwise specified.

[0081] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be purchased from the market.

[0082] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0083] The terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" as used herein are meant to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, single-stranded or double-stranded structures. These nucleic acids or polynucleotides include gene coding sequences, antisense sequences and regulatory sequences of non-coding regions, but are not limited to these. These terms include a gene. "Gene" or "gene sequence" is widely used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include a coding sequence in a cDNA, and / or include a cDNA and its regulatory sequences. In specific embodiments, such as with respect to an isolated nucleic acid sequence, it is preferably assumed to be cDNA.

[0084] Unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0085] The inventors of the present invention discovered two highly identical proteins regulating plant salt-alkali resistance from poplars during the research process, which were named KYJ1 and KYJ2 respectively, and were uniformly named KYJ protein. The amino acid sequence of the KYJ1 protein in poplars is shown in SEQ ID NO.2 of the sequence list. The gene encoding the KYJ1 protein is named kyj1 gene (LOC7496571). The open reading frame of the kyj1 gene in the cDNA of poplars is shown in SEQ ID NO.1 of the sequence list. The kyj1 gene in the genomic DNA of poplars is shown in SEQ ID NO.3 of the sequence list. The amino acid sequence of the KYJ2 protein in poplars is shown in SEQ ID NO.5 of the sequence list. The gene encoding the KYJ1 protein is named kyj2 gene (LOC7482787). The open reading frame of the kyj2 gene in the cDNA of poplars is shown in SEQ ID NO.4 of the sequence list. The kyj2 gene in the genomic DNA of poplars is shown in SEQ ID NO.6 of the sequence list.

[0086] Example 1kyj gene isolation

[0087] In the Phytozome (https: / / phytozomejgi.doe.gov / pz / portal.html) database, we selected Populus trichocarpa V4.1 to obtain the gene sequences of LOC7496571 and LOC7482787. Based on the base sequences of their coding regions, we analyzed and designed 84K poplar homologous amplification primers. Then, we used the cDNA of 84K poplar as a template to amplify the target genes kyj1 and kyj2 ( Figure 1 ).

[0088] The specific method is as follows:

[0089] 1. Total RNA extraction from 84K poplar leaves

[0090] The leaves of the tissue culture seedlings of 84K poplar were cut and ground in liquid nitrogen for later use. RNA was extracted using the Tiangen Plant Total RNA Extraction Kit. The specific operation steps refer to the instructions of the Plant Total RNA Extraction Kit (RNAEasy Fast Plant Tissue Kit) of Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0091] 2. cDNA Synthesis

[0092] (1) The reverse transcription process uses the Beijing Quanshijin Biotechnology Trans Script One-Step gDNA Removal and cDNA Synthesis Super Mix Kit, and the reverse transcription mixture is prepared according to the following system:

[0093] Total RNA / m RNA 50ng-5μg;

[0094] Anchored oligo(dT) 18 Primer 1 μL;

[0095] 2×TS reaction mix 10 μL;

[0096] TransScript RT / RIEnzyme Mix 1μL;

[0097] g DNARemover 1 μL;

[0098] RNase-free Water to 20 μL.

[0099] (2) Mix gently and use the product for PCR: incubate at 42°C for 30 min;

[0100] (3) Heat at 85°C for 5 seconds to inactivate Trans Script RT / RI and gDNARemover.

[0101] 3. Amplification of target gene kyj

[0102] Kyj1-F and kyj1-R were synthesized respectively, and the kyj1 gene shown in SEQ ID NO.1 was amplified by PCR.

[0103] kyj1-F:5'-gtcaATGGGACCGATCGTTCTGAC-3';

[0104] kyj1-R:5'-atgcAGATGGAGGACGGTTC-3'.

[0105] Kyj2-F and kyj2-R were synthesized respectively, and the kyj2 gene shown in SEQ ID NO.4 was amplified by PCR.

[0106] kyj2-F:5'-gtcaATGGAACCGATCGTTTTGAC-3';

[0107] kyj2-R:5'-atgcAGATGGGCGGTTTGGT-3'.

[0108] Example 2 Cellular sublocalization of KYJ protein

[0109] 1. Using the kyj gene obtained in Example 1 as a template, PCR amplification was performed using a primer pair consisting of KYJ1-PBSK-F and KYJ1-PBSK-R, and the PCR amplification product was recovered.

[0110] KYJ1-PBSK-F: 5'-CCG GTCGAC ATGGGACCGATCGTTCTGAC-3';

[0111] KYJ1-PBSK-R: 5'-GGCGAATTCAGATGGAGGACGGTTC-3'.

[0112] At the same time, PCR amplification was performed using a primer pair consisting of KYJ2-PBSK-F and KYJ2-PBSK-R, and the PCR amplification product was recovered.

[0113] KYJ1-PBSK-F: 5'-CCG GTCGACATGGAACCGATCGTTTTGAC-3';

[0114] KYJ1-PBSK-R: 5'-GGC GAATTC AGATGGGCGGTTTGGT-3'.

[0115] 2. Take the amplified product obtained in step 1, use restriction endonucleases EcoRI and SalI to perform double enzyme digestion, and recover the enzyme digestion product.

[0116] 3. Take the PBSK vector (Xincheng Xingchuang Technology Development Co., Ltd., product catalog number Biovector105802), use restriction endonucleases EcoRI and SalI to perform double enzyme digestion, and recover the vector backbone.

[0117] 4. The enzyme digestion product obtained in step 2 and the vector backbone obtained in step 3 were connected to obtain recombinant plasmids PBSK-KYJ1 and PBSK-KYJ2.

[0118] 5. Take wild-type poplar leaves that have germinated for 3-4 weeks, cut the middle part of the leaves into 0.5-1 mm thin strips, put them into enzyme solution for dark digestion for 3-4 hours, centrifuge and collect protoplasts.

[0119] 6. Use the PEG method to co-transform the recombinant plasmids PBSK-KYJ1 and PBSK-KYJ2 into protoplasts and culture them overnight under light.

[0120] 7. The expression of GFP in mesophyll cells was observed using a laser scanning confocal microscope (LSM510META, Zeiss). The objective magnification was 40 times, the excitation wavelength was 488 nm, the bandpass was BP505-530 nm, and the long pass was LP560 nm.

[0121] An exemplary result for one cell is shown in Figure 2 The KYJ1-GFP signal and the KYJ2-GFP signal completely overlapped with the chlorophyll autofluorescence signal, indicating that both KYJ1 and KYJ2 proteins were localized in the chloroplast.

[0122] Example 3 Obtaining gene-edited strains

[0123] 1. Construction of CRISPR / CAS9 gene editing vector

[0124] 1. Single-stranded DNA molecules guide-F and guide-R were synthesized separately, then mixed and annealed to obtain double-stranded DNA molecules with restriction sites at both ends. Restriction endonuclease Bsa I was used for single enzyme digestion, and the digestion products were recovered to obtain double-stranded DNA molecules with sticky ends.

[0125] kyj 1-guide-1-F: 5'-GTAC GGTCTC ACGGGTCTTAGTGTGCTAGCCGG-3';

[0126] kyj1-guide-1-R: 5'-AAAC GGTCTC CCGGCTAGCACACTAAGACCCGT-3':

[0127] kyj1-guide-2-F:5'-GTAC GGTCTC TCGCTTGTCTTTGTTCCCGTTGG-3';

[0128] kyj1-guide-2-R: 5'-AAAC GGTCTC CCAACGGGAACAAAGACAAGCGA-3';

[0129] kyj2-guide-1-F: 5'-GTAC GGTCTC CGCATGGCGTGTAGTAGCTGCGG-3';

[0130] kyj2-guide-1-R: 5'-AAAC GGTCTC CCGCAGCTACTACACGCCATGCG-3';

[0131] kyj2-guide-2-F: 5'-GTAC GGTCTC GGTTATGGACCAGAAGCCCATGG-3';

[0132] kyj2-guide-2-R: 5'-AAAC GGTCTC CCATGGGCTTCTGGTCCATAACC-3'.

[0133] 2. Take the AtU3d-sgRNA plasmid, use the restriction endonuclease Bsa I for single enzyme digestion, and recover the enzyme digestion product.

[0134] 3. Connect the double-stranded DNA molecule with sticky ends obtained in step 1 and the enzyme digestion product obtained in step 2 to obtain a connection product.

[0135] 4. Take the ligation product obtained in step 3, use the primer pair consisting of UF and guide-R to perform PCR amplification, and recover the amplified product.

[0136] 5. Take the ligation product obtained in step 3, use the primer pair consisting of gR-R and guide-F to perform PCR amplification, and recover the amplified product.

[0137] 6. Take the amplified product of step 4 and the amplified product of step 5, mix them in equal moles and use them as templates, and use the primer pair consisting of Pps-R and Pgs-L to perform PCR amplification to obtain the amplified product (linearized sgRNA expression cassette).

[0138] After sequencing, the sgRNA expression cassette can express the aforementioned specific sgRNA.

[0139] 7. Using the Golden Gate method (using the restriction endonuclease Bsa I), the linearized sgRNA expression cassette and the pHSbdcas9i-tRNA-ccdb (K5N) plasmid were connected to obtain the CRISPR / CAS9 gene editing vector.

[0140] Universal primer sequences:

[0141] UF: 5'-CTCCGTTTTACCTGTGGAATCG-3'.

[0142] gR-R: 5'-CGGAGGAAAATTCCATCCAC-3'.

[0143] Pps-R: 5'-TTCAGAggtctcTACCGACTAGTATGGAATCGGCAGCAAAGG-3'.

[0144] Pgs-L: 5'-AGCGTGggtctcGCTCGACGCGTATCCATCCACTCCAAGCTC-3'.

[0145] 2. Obtaining gene-edited plants

[0146] 1. Take the CRISPR / CAS9 gene editing vector constructed in step 1 and introduce it into Agrobacterium GV3101 to obtain recombinant Agrobacterium.

[0147] 2. After the plants have been cultivated for 1-3 months, select leaves with uniform color and no abnormalities on the surface of the leaves. Remove the edges of the leaves and make even cuts in the middle of the leaves.

[0148] 3. Inoculate the recombinant Agrobacterium obtained in step 1 into the infection solution and adjust the concentration to OD600 = 0.3-0.4. Put the prepared leaves into the bacterial solution, shake continuously, infect for 15 minutes, take out the leaves, tear them into small pieces, inoculate them into the co-cultivation medium and culture them in the dark at 25°C for 2 days.

[0149] 4. The co-cultivated leaves are inoculated on the induction screening medium and continued to be cultured in the dark for about two weeks. After the callus grows, it is subcultured to a new screening medium and subcultured once every two weeks. Generally, the induction subculture is performed up to three times, and the longest period of the whole stage is 45 days.

[0150] 5. Inoculate the induced callus onto differentiation medium and subculture once every three weeks. During this period, the callus will turn green and harden. This stage normally lasts about two months.

[0151] 6. Take the seedlings that have grown to 1-3 cm and inoculate them into the rooting screening medium. They will take root in about 7-15 days. Transplant the normally growing plants into nutrient soil for cultivation, which are the T1 generation plants.

[0152] 7. Screen gene-edited plants from the T1 generation plants.

[0153] Specific steps: take plant leaves, extract genomic DNA by CTAB method, use two primer pairs consisting of kyj1-F and kyj1-R, kyj2-F and kyj2-R for PCR amplification, then recover the PCR amplification products and sequence them, and screen gene-edited plants according to the sequencing results (the gene-edited plants can be in the form of heterozygous gene-edited plants, chimeric gene-edited plants or homozygous gene-edited plants).

[0154] 8. Self-pollinate the gene-edited plants obtained in step 7 and harvest the seeds.

[0155] 9. Sow the seeds harvested in step 8 in a solid 1 / 2MS culture medium containing 50 mg / L hygromycin. After culturing for 10 days, transplant the normally growing plants into nutrient soil for cultivation, which are T2 generation plants.

[0156] 10. Screen gene-edited plants from the T2 generation plants (specific steps are the same as step 7).

[0157] 11. The gene-edited plants obtained in step 10 are self-pollinated and seeds are harvested.

[0158] 12. Sow the seeds harvested in step 11 in nutrient soil and cultivate them into plants, namely T3 generation plants.

[0159] 13. The T3 generation plants were identified (the specific steps are the same as step 7), and it was found that the T3 generation plants obtained by self-pollination of a certain T2 generation plant were all the same homozygous gene-edited plants. The T2 generation plant was named kyj plant, and the self-pollinated offspring of the kyj plant was named kyj strain.

[0160] 11. The T3 generation plants of the kyj strain are self-pollinated and the seeds are harvested. The harvested seeds are sown in nutrient soil and cultivated into plants, namely the T4 generation plants.

[0161] 12. The T4 generation plants of the kyj line are self-pollinated and the seeds are harvested. The harvested seeds are sown in nutrient soil and cultivated into plants, namely the T5 generation plants.

[0162] The kyj plants, T3 plants of the kyj line, T4 plants of the kyj line and T5 plants of the kyj line all have the following phenotypes: in the culture medium containing 150 mM NaCl and 50 mM NaHCO3, compared with the wild-type poplar, the plants of the kyj line are taller, have larger biomass and grow better.

[0163] Example 4 Phenotypic Identification of kyj Strain

[0164] Poplars to be tested: T4 plants of kyj strain and wild-type poplars.

[0165] For the stress assay of poplar seedlings, seeds of T4 plants of kyj strain and wild-type plants were surface sterilized, placed on 1 / 2MS plates containing 150 mM NaCl and 50 mM NaHCO3 and kept at 4°C for 2 days. The plates were then transferred to culture under appropriate conditions. At the same time, seeds of T4 plants of kyj strain and wild-type plants of the same batch were surface sterilized, placed on 1 / 2MS plates without NaCl and NaHCO3 and kept at 4°C for 2 days.

[0166] See the exemplary photos of T4 plants of the kyj strain and wild-type plants grown under 150 mM NaCl and 50 mM NaHCO3 treatment conditions for 30 days. Figure 3 .

[0167] Physiological parameters of the kyj strain T4 plants and wild-type plants under normal conditions and saline-alkali conditions were measured, including fresh weight and plant height. The results are shown in Figure 4 Figures A and B in Figure 1. Compared with normal conditions, the biomass of the T4 plants of the kyj1 line increased under saline-alkali conditions, while the biomass of the WT decreased under saline-alkali conditions. After the same number of days of cultivation under saline-alkali conditions, the average fresh weight and plant height of the T4 plants of the four groups of kyj1 lines were significantly higher than those of the wild-type plants.

[0168] Example 5 Physiological Identification of the kyj1 Strain

[0169] 1. Determination of physiological indicators of stress resistance

[0170] Poplars to be tested: T4 plants of kyj strain and wild-type poplars.

[0171] like Figure 5 As shown in the figure, before the stress treatment, the chlorophyll content and net photosynthetic rate of each group were basically the same. After treatment with 150mM NaCl and 50mM NaHCO3, the chlorophyll content of the leaves decreased and the net photosynthetic rate decreased. Among them, the chlorophyll content and net photosynthetic rate of WT decreased the most, while the chlorophyll content and net photosynthetic rate of the T4 generation plants of the kyj strain decreased less. It can be seen that the T4 generation plants of the kyj strain are more salt-tolerant, while the WT is more sensitive to stress.

[0172] Malondialdehyde (MDA) is produced by the peroxidation of membrane lipids in tissues or organs of organisms when the organism is damaged during aging or under stress. Its content is closely related to the aging of the organism and stress damage. The higher the peroxide content, the higher the MDA content, and the greater the damage to the plant. Figure 6 As shown in Figure A, before stress treatment, the MDA content of each group was basically the same. After treatment with 150mM NaCl and 50mM NaHCO3, the MDA content of WT was the highest, while the MDA content of T4 plants of kyj1 strain was relatively low, which indicated that kyj strain had stronger stress resistance.

[0173] Proline (Pro) also reflects a certain degree of stress resistance to a certain extent. The higher the Pro content, the stronger the plant resistance. Figure 6 As shown in Figure B, before stress treatment, the Pro content of each group was basically the same. After treatment with 150mM NaCl and 50mM NaHCO3, the Pro content of the kyj mutant was significantly higher than that of the wild type, which also indicates that the kyj strain is more salt-tolerant than the wild type.

[0174] In addition, superoxide dismutase (SOD) removes superoxide free radicals to generate hydrogen peroxide, while ascorbate peroxidase (APX) removes H2O2 to generate H2O. Such enzymatic antioxidants are essential for controlling ROS levels, maintaining the redox homeostasis of plants and resisting adverse stress. Therefore, the higher the levels of SOD and APX, the stronger the plant's stress resistance. Figure 7 As shown in the figure, before stress treatment, the number of SOD and APX activity units per mg protein in each group of plants was basically the same. After treatment with 150 mM NaCl and 50 mM NaHCO3, the SOD and APX activities of the kyj mutant were significantly higher than those of the wild type, indicating that the kyj strain has stronger salt-alkali resistance.

[0175] These results show that under saline-alkali conditions, the T4 generation plants of the kyj strain have stronger photosynthesis, more biomass, stronger growth, and better growth than wild-type plants, that is, the T4 generation plants of the kyj strain have higher salt-alkali resistance than wild-type plants. Therefore, the kyj gene plays an important role in regulating plant salt-alkali resistance. The above results show that the KYJ1 protein and its coding sequence can negatively regulate the salt-alkali resistance of poplar.

[0176] 2. Detection of accumulation of key proteins affecting chloroplast development

[0177] 1. Extraction of total protein

[0178] Take 50 mg of fresh test sample, add 200 μL of buffer E (0.1514 g / mL Tris, 0.01 g / mL SDS, 10% glycerol, 0.095 g / mL Na2S2O5, pH 8.8), grind into a homogenate, centrifuge at 13000g at room temperature for 10 minutes, and collect the supernatant.

[0179] 2. Quantification of total protein

[0180] 15 μL of the supernatant was taken and the total protein was quantified (in mg / mL) using the BioRad DcProtein Assay kit (Bio-Rad, Hercules, CA, USA).

[0181] 3. According to the results of total protein quantification, the total protein concentration of the supernatant obtained from the two test samples was adjusted to obtain a protein solution. The protein solution obtained from the wild-type plant was diluted to 2 times the volume.

[0182] 4. Take the protein solution obtained from the kyj strain plants, the protein solution obtained from the wild-type plants, and the 2-fold dilution of the protein solution obtained from the wild-type plants, and perform protein electrophoresis and Western blotting respectively (the antibodies used to detect the proteins of each photosystem are all commercially available antibodies).

[0183] Results Figure 8 The content of various component proteins that affect chloroplast development and photosynthesis (such as CF1α, PsaN, PsaA, and Cpn60) in the kyj strain plants increased significantly. The increase in the content of subunits related to the photosynthesis complex will lead to enhanced photosynthesis and plant growth, thereby improving the ability of plants to resist adverse stress.

[0184] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, other implementation methods can certainly be easily made by replacement or modification based on the technical contents disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

[0185] Wherein, the sequence of SEQ ID NO.1 is as follows:

[0186]

[0187] The sequence of SEQ ID NO.2 is as follows:

[0188]

[0189] The sequence of SEQ ID NO.3 is as follows:

[0190]

[0191]

[0192] The sequence of SEQ ID NO.4 is as follows:

[0193]

[0194] The sequence of SEQ ID NO.5 is as follows:

[0195]

[0196] The sequence of SEQ ID NO.6 is as follows:

[0197]

[0198]

Claims

1. A KYJ protein that negatively regulates salt-alkali resistance in poplar, characterized in that: The KYJ protein is KYJ1 protein or KYJ2 protein, the amino acid sequence of KYJ1 protein is shown in SEQ ID NO.2, and the amino acid sequence of KYJ2 protein is shown in SEQ ID NO.

5.

2. The gene encoding the KYJ protein according to claim 1, characterized in that: The gene encoding the KYJ1 protein is the kyj1 gene, and its nucleotide sequence is shown in SEQ ID NO.

1. The gene encoding the KYJ2 protein is the kyj2 gene, and its nucleotide sequence is shown in SEQ ID NO.

4.

3. Use of the KYJ protein according to claim 1 or the coding gene of the KYJ protein according to claim 2 or a biological material containing the coding gene thereof in negatively regulating the salt-alkali resistance of poplar, wherein the biological material is an expression cassette, a vector, a host cell or a recombinant bacterium.

4. The use according to claim 3, characterized in that: The negative regulation of poplar salt-alkali resistance is specifically manifested as follows: compared with the wild type, the kyj gene knockout strain has higher plant height, larger biomass, stronger photosynthesis, stronger growth ability and better growth under saline-alkali conditions.

5. The use according to claim 3, characterized in that: Under saline-alkali conditions, the chlorophyll content and net photosynthetic rate of the kyj gene knockout strain decreased less than those of the wild type, the malondialdehyde content was lower than that of the wild type, the proline content was significantly higher than that of the wild type, and the superoxide dismutase and ascorbate peroxidase activities were significantly higher than those of the wild type.

6. A method for improving salt-alkali resistance of poplar, characterized in that: The method comprises: (1) By reducing the activity of KYJ protein in poplar or reducing the content of KYJ protein in poplar; (2) by reducing the expression of the kyj gene in poplar; The amino acid sequence of the KYJ protein is shown in SEQ ID NO.2 or SEQ ID NO.5, and the nucleotide sequence of the kyj gene is shown in SEQ ID NO.1 or SEQ ID NO.

4.

7. The method according to claim 6, characterized in that The way to reduce the expression of kyj gene in poplar is to knock out the kyj gene.

8. The method according to claim 7, characterized in that The kyj gene can be knocked out by using RNAi or CRISPR / Cas9 technology.

9. A method for cultivating salt-alkali resistant poplar plants, characterized in that: The kyj gene in the poplar genome is gene-edited to obtain a gene-edited plant, and a homozygous gene-edited plant is obtained from the self-pollinated offspring of the gene-edited plant. The homozygous gene-edited plant is a salt-alkali resistant plant, and the nucleotide sequence of the kyj gene is shown in SEQ ID NO.1 or SEQ ID NO.

4.

10. The method according to claim 9, characterized in that Gene editing is achieved through the Cas9 system.

Images