Primer and method for rapid detection of Heterobasidion insulare

Abstract

The present invention relates to the field of biological detection, and particularly to a primer for rapidly detecting *Alloclavaria pallida*. The upstream primer sequence of the specific primer pair is as shown in SEQ ID NO.13, and the downstream primer sequence of the specific primer pair is as shown in SEQ ID NO.14. Based on the primer pair, a method for detecting and quantifying *Alloclavaria pallida* is provided. The present invention provides a primer and a method for rapidly detecting *Alloclavaria pallida*, which are used to solve the problems of low detection efficiency of dictyostelium in the prior art and inability to rapidly screen samples, provide a specific primer, and establish a method for rapidly and highly specifically detecting and quantifying *Alloclavaria pallida* in samples.

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, and particularly relates to a primer and method for rapidly detecting Heterostelium pallidum. Background Art

[0002] Dictyostelid, full name Dictyostelid cellular slime molds, is a common protozoan in soil and has a very close relationship with bacteria. Most bacteria in the soil environment can be preyed on by Dictyostelid. Dictyostelium discoideum is a Dictyostelid that is currently widely used, and its research aspects include biomedicine, ecological environment, cytogenetics, etc. Heterostelium pallidum also belongs to the Dictyostelid class, but its morphological structure shows regular whorled branches, which is significantly different from Dictyostelium discoideum. Compared with Dictyostelium discoideum, in terms of research, the research and application of Heterostelium pallidum are very few, and there is a lack of technical exploration. It has been confirmed that there is a "symbiotic" relationship between Dictyostelid and pathogenic bacteria, which can avoid predation under selective pressure or survive in the preyed Dictyostelid. Dictyostelid has also been reported in urban domestic water, posing a potential threat to public health. The existing research results in the laboratory show that there are predation differences between Heterostelium pallidum and Dictyostelium discoideum, and there are interrelationships with different bacteria. Therefore, there is great potential in studying Heterostelium pallidum.

[0003] The currently commonly used Dictyostelid detection technology is a conventional PCR amplification technology based on 18S rDNA. By amplifying the relatively stable gene fragments in Dictyostelid and then sequencing to obtain the sequence results of the samples, the previous steps of sample separation, sample acquisition, sample purification, and DNA extraction are required. The DNA fragments amplified by this method are generally applicable within the Dictyostelid class. However, to obtain a certain Dictyostelid, a large amount of repetitive work is required, and it is impossible to quickly screen samples, resulting in low efficiency.

[0004] Quantitative Real-time PCR (qPCR) technology is a well-recognized rapid quantitative detection technology. Currently, there are two methods, namely the DNA-binding dye method and the probe-based chemical method. In the dye method, SYBR Green I is a widely used fluorescent dye. It has relatively high requirements for primer specificity. In the reaction system, the SYBR fluorescent dye can specifically bind to double-stranded DNA, generating a strong fluorescent signal, while hardly generating a fluorescent signal when not bound to double-stranded DNA, thus ensuring that the increase in the fluorescent signal is completely synchronized with the increase in PCR products. The probe method is to add a pair of primers and a specific probe to the PCR system. The probe is labeled with a fluorescent reporter group at the 5' end and a fluorescent quenching group at the 3' end. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quenching group, and the fluorescent signal cannot be detected. When the probe binds to the complementary sequence of the target gene, it is cleaved by Taq enzyme, and the 5' end and 3' end are separated, and the reporter group is no longer quenched. The dye method has better versatility and lower cost compared to the probe method. During the process of quantitative real-time PCR, the fluorescent signal increases with the accumulation of amplification products. The instrument will receive and detect the fluorescent signal in real time to generate an amplification curve. The amplification result is sensitive and the obtained result has high accuracy. By analyzing the amplification curve, quantitative analysis of the template can be achieved. Summary of the Invention

[0005] To overcome the deficiencies of the prior art, the present invention provides a primer and method for rapidly detecting Heterostylis cinerea, which is used to solve the problems of low detection efficiency of dictyostelium in the prior art and the inability to quickly screen samples, provides a specific primer, and establishes a rapid, highly specific quantitative detection method that can simply detect the relative expression level of Heterostylis cinerea in environmental samples.

[0006] The specific technical solutions are as follows:

[0007] A primer for rapidly detecting Heterostylis cinerea provided by the present application includes the following steps:

[0008] Step S1: Prepare multiple groups of strain samples containing Heterostylis cinerea;

[0009] Step S2: Extract the genomic DNA of the strain to be tested;

[0010] Step S3: Use primer 6 software to design specific primers for the genome of Heterostylis cinerea;

[0011] Step S4: Using the genome of Heterostylis cinerea as a template, perform gradient amplification by conventional PCR to preliminarily screen qualified primer pairs:

[0012] Step S5: According to the amplification results, use the specific primer pairs obtained by conventional PCR and the genomes of multiple groups of strains as templates respectively for conventional PCR specific amplification. Take the products of conventional PCR specific amplification for detection to obtain the optimal specific primer pairs.

[0013] The upstream primer sequence of the specific primer pair is shown in SEQ ID NO. 13: TGTTCTCATACGATTCAGTTC;

[0014] The downstream primer sequence of the specific primer pair is shown in SEQ ID NO. 14: AGATGGAGCAGAGATGATG.

[0015] Preferably, the strain samples include Heterostelium pallidum, Dictyostelium discoideum, Dictyostelium giganteum, Cavenderia aureostipes, and Polysphondylium violaceum.

[0016] As a further elaborated solution, the present application also provides a method for detecting and quantifying Heterostelium pallidum, including the following steps:

[0017] Step 1: Obtaining the target fragment: Use the specific primers SEQ ID NO. 13 - 14 of the Heterostelium pallidum genome to perform PCR amplification on the Heterostelium pallidum genome to obtain the target fragment, and cut and recover it.

[0018] Step 2: Ligating the target gene to the plasmid vector: Use a cloning kit to ligate the target fragment to the plasmid vector.

[0019] Step 3: Transforming and screening recombinants;

[0020] Step 4: Extracting the plasmid using a kit:

[0021] Step 5: Making a standard curve;

[0022] Step 6: Preparation of the sample to be tested: Prepare liquid - suspended Heterostelium pallidum cells, use a hemocytometer to prepare a bacterial solution of 1×10 8 cells / mL as the mother liquor, and dilute it to 2×10 7 cells / mL, 1×10 7 cells / mL, 5×10 6 cells / mL, 2×10 6 cells / mL, 1×10 6A cell suspension at a concentration of cells / mL, and then 200 μL was taken to extract genomic DNA;

[0023] Step 7: Extract the genomic DNA of the strain to be tested, and then prepare a real-time fluorescence quantitative PCR reaction system;

[0024] Step 8: Fluorescence quantitative PCR reaction: The fluorescence quantitative PCR reaction was carried out by the two-step method to obtain amplification results and melting curves at different concentrations;

[0025] Step 9: Using the copy number (copies / μL) = [ (number of ng × 10 -9 ) × (6.02 × 10 23 ) ] ÷ (number of bases × 660), the obtained CT value can be calculated according to the standard curve formula, and the CT value is corresponding to the copy concentration to achieve the quantification of the standard sample strain.

[0026] Technical effects and advantages of the present invention:

[0027] Using the dye method, a pair of specific primers for *Heterostelium pallidum* was designed, and relatively accurate and rapid detection effects were achieved through real-time fluorescence quantitative PCR technology, effectively shortening the repeated steps of screening the target dictyostelium, and can effectively quantify *Heterostelium pallidum* in the sample to a certain extent, so as to provide a feasible technical method in aspects such as environmental sample analysis, public health threats, and interactions between dictyostelium and bacteria. Description of the drawings

[0028] Figure 1 It is the gel imaging result diagram of primer gradient amplification in Example 1;

[0029] Figure 2 It is the conventional PCR amplification result diagram of primer specificity in Example 1;

[0030] Figure 3 It is the schematic diagram of constructing the standard plasmid in Example 2;

[0031] Figure 4 It is the amplification curve and standard curve diagram of the plasmid standard of *Heterostelium pallidum* in Example 2;

[0032] Figure 5 It is the amplification curve and melting curve diagram of different concentration samples of *Heterostelium pallidum* in Example 2;

[0033] Figure 6 It is the amplification result diagram of the random sample of *Heterostelium pallidum* provided in Example 3.

[0034] Among them, Figure 1 The legends A-L in are the gel imaging results of different primer sequences, Figure 1 A is SEQ ID NO.1-2;Figure 1 B is: SEQ ID NO.3 - 4; Figure 1 C is: SEQ ID NO.5 - 6; Figure 1 D is: SEQ ID NO.7 - 8; Figure 1 E is: SEQ IDNO.9 - 10; Figure 1 F is: SEQ ID NO.11 - 12; Figure 1 G is: SEQ ID NO.13 - 14; Figure 1 H is: SEQ ID NO.15 - 16; Figure 1 I is: SEQ ID NO.17 - 18; Figure 1 J is: SEQ ID NO.19 - 20; Figure 1 K is: SEQ ID NO.21 - 22; Figure 1 L is: SEQ ID NO.23 - 24.

[0035] Among them, Figure 2 The legend A - E of is the conventional PCR amplification result of different primer sequences, Figure 2 A is: SEQ ID NO.13 - 14; Figure 2 B is: SEQ ID NO.15 - 16; Figure 2 C is: SEQ ID NO.3 - 4; Figure 2 D is: SEQ ID NO.5 - 6; Figure 2 In E: 1 - 6: SEQ ID NO.17 - 18, 7 - 12: SEQ ID NO.1 - 2; 13 - 18: SEQ ID NO.9 - 10; 19 - 24: SEQ ID NO.11 - 12.

[0036] Among them, Figure 3 A is the target fragment amplified from the genome of Figure 3 B is the target fragment amplified by using the plasmid general detection primers; Figure 3 C is the sequence alignment result.

[0037] Among them, Figure 4 A is the amplification curve of the plasmid standard of Figure 4 B is its standard curve.

[0038] Among them, Figure 5 A is the amplification curve of different concentration samples of Figure 5 B is its melting curve. Specific implementation mode

[0039] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments. The embodiments of the present invention are given for the purposes of illustration and description, and are not exhaustive or limit the present invention to the disclosed form. Many modifications and variations are obvious to those of ordinary skill in the art. The embodiments are selected and described to better illustrate the principles and practical applications of the present invention, and enable those of ordinary skill in the art to understand the present invention and thus design various embodiments with various modifications suitable for specific purposes.

[0040] Example 1:

[0041] Please refer to Figure 1 , the present invention provides a pair of specific primers for nucleic acid detection of *Alloclavaria grisella*, retrieves and screens a pair of specific primers using the *Alloclavaria grisella* genome as the target gene, and the specific amplification primers include an upstream primer and a downstream primer;

[0042] It includes the following steps:

[0043] Step S1, prepare multiple groups of strain samples containing *Alloclavaria grisella*, as shown in Table 1;

[0044] All strains are dictyostelids cultured by the Engineering Research Center of Edible and Medicinal Fungi of Jilin Agricultural University.

[0045] Table 1 Test strains

[0046]

[0047] Step S2, extract the genomic DNA of the test strains;

[0048] Use a column-type universal genomic DNA extraction kit for DNA extraction, with the model TaKaRa MiniBEST Bacteria Genomic DNA Extraction Kit. The specific steps include the following:

[0049] S2.1: Take 5 mL of the bacterial culture solution, centrifuge at 12,000 rpm for 2 min, and discard the supernatant;

[0050] S2.2: Add 180 μL of Buffer GL, 20 μL of Proteinase K, and 10 μL of RNase A to the tube, mix well, and incubate in a water bath at 56 °C for 10 min;

[0051] S2.3: Add 200 μL of Buffer GB and 200 μL of absolute ethanol thereto, and mix well by pipetting;

[0052] S2.4: Transfer the above liquid into an adsorption column, centrifuge at 12,000 rpm for 2 min, and then discard the filtrate;

[0053] S2.5: Add 500 μL of Buffer WA to it, centrifuge at 12,000 rpm for 1 min, and then discard the filtrate;

[0054] S2.6: Add 700 μL of Buffer WB to it, centrifuge at 12,000 rpm for 1 min, and then discard the filtrate;

[0055] S2.7: Centrifuge the empty adsorption column at 12,000 rpm for 2 min, then place it on a new 1.5 mL centrifuge tube, let it stand for 10 min, add 30 μL of sterile water to the center of the adsorption column, and let it stand at room temperature for 5 min;

[0056] S2.8: Centrifuge at 12,000 rpm for 2 min to elute the DNA;

[0057] S2.9: Detect the concentration of genomic DNA using a spectrophotometer and store it in a -40 °C refrigerator for later use.

[0058] Step S3: Design specific primers for the genome of *Allocetraria incana* using primer 6 software. A total of 12 pairs of primers were designed, as shown in Table 2;

[0059] Table 2 Primer sequence list

[0060]

[0061] As Figure 1 shown, the preliminary screening results of gradient amplification by conventional PCR of primers designed according to the genome of *Allocetraria incana* are presented. A total of 8 pairs of primers are qualified, namely A, B, C, E, F, G, H, and L.

[0062] A: SEQ ID NO.1-2; B: SEQ ID NO.3-4; C: SEQ ID NO.5-6; D: SEQ ID NO.7-8; E: SEQ ID NO.9-10; F: SEQ ID NO.11-12; G: SEQ ID NO.13-14; H: SEQ ID NO.15-16; I: SEQ ID NO.17-18; J: SEQ ID NO.19-20; K: SEQ ID NO.21-22; L: SEQ ID NO.23-24. M: DNA marker 2000bp. The conventional PCR annealing temperatures for lanes 1-8 of A-K are 60°C, 59.7°C, 59.1°C, 58.1°C, 57°C, 56.2°C, 55.5°C, 55°C; the conventional PCR annealing temperatures for lanes 1-6 of L are 60°C, 59°C, 58°C, 57°C, 56°C, 55°C.

[0063] Step S4: Using the genome of Heterobasidion insulare as a template, perform gradient amplification by conventional PCR to preliminarily screen qualified primer pairs:

[0064] They are SEQ ID NO.1-2 ( Figure 1 A), SEQ ID NO.3-4 ( Figure 1 B), SEQ ID NO.5-6 ( Figure 1 C), SEQ ID NO.9-10 ( Figure 1 E), SEQ ID NO.11-12 ( Figure 1 F), SEQ ID NO.13-14 ( Figure 1 G), SEQ ID NO.15-16 ( Figure 1 H), SEQ ID NO.17-18 ( Figure 1 L). The conventional PCR reaction system is shown in Table 3.

[0065] Table 3 Conventional PCR reaction system

[0066]

[0067] The PCR reaction procedure is as follows:

[0068] Pre-denaturation: 95 °C, 3 min; 35 cycles: denaturation: 95 °C, 30 sec; annealing: 60 - 55 °C, 30 sec; extension: 72 °C, 1 min; final extension: 72 °C, 5 min.

[0069] Step S5: According to the gel imaging results of the amplification ( Figure 1), the specific primer pair obtained by conventional PCR was used for specific amplification by conventional PCR with water, D5, K3, G2-BB, AX2, and HA-1 as templates ( Figure 2 ), and finally a better specific primer pair was obtained. The preferred primer sequences are SEQ ID NO.13-14 ( Figure 2 A).

[0070] As Figure 2 shown, it is the result of specific conventional PCR amplification of the preliminary screening primers. A is the preferred specific primer pair.

[0071] A: SEQ ID NO.13-14; B: SEQ ID NO.15-16; C: SEQ ID NO.3-4; D: SEQ ID NO.5-6; E: 1-6: SEQ ID NO.17-18, 7-12: SEQ ID NO.1-2; 13-18: SEQ ID NO.9-10; 19-24: SEQ IDNO.11-12.

[0072] A-E: M: DNA marker 2000bp. Lanes 1-6 in A-D are different templates: water, D5, K3, G2-BB, AX2, HA-1. E: The templates in lanes 1, 7, 13, and 19 are water, lanes 2, 8, 14, and 20 are D5, lanes 3, 9, 15, and 21 are K3, lanes 4, 10, 16, and 22 are G2-BB, lanes 5, 11, 17, and 23 are AX2, and lanes 6, 12, 18, and 24 are HA-1.

[0073] The upstream primer sequence of the specific primer pair is as shown in SEQ ID NO.13: TGTTCTCATACGATTCAGTTC; the downstream primer sequence of the specific primer pair is as shown in SEQ ID NO.14: AGATGGAGCAGAGATGATG.

[0074] Example 2:

[0075] This example provides a method for rapid detection of Heterobasidion insulare, including the following steps:

[0076] Step 1, obtaining the target fragment: Using the specific primers SEQ ID NO.13-14 of the Heterobasidion insulare genome to perform PCR amplification on the Heterobasidion insulare genome to obtain the target fragment ( Figure 3 A), and recovering by gel cutting.

[0077] Step 2: Ligate the target gene to the plasmid vector: Using the pEASY-T&B Zero Cloning Kit general gene cloning kit, ligate the target fragment to the pEASY-T&B Zero Cloning Vector plasmid vector. The cloning reaction system is shown in Table 4;

[0078] Table 4 Cloning reaction system

[0079]

[0080] Among them, the ligation ratio of the pEASY-T&B Zero Cloning Vector to the target fragment is 1:7; after mixing, place it in a PCR instrument at 25 °C for 10 min; after completion, place the centrifuge tube on ice.

[0081] Step 3: Transform and screen recombinants, including:

[0082] 3.1: Place the competent DH5α on ice to thaw;

[0083] 3.2: Add the ligation product, gently mix and place on ice for 30 min;

[0084] 3.3: Put the centrifuge tube into a 42 °C water bath for 45 sec, and then quickly place it on ice for 2 min;

[0085] 3.4: Add 700 μL of pure LB medium, gently mix, and incubate at 37 °C, 180 rpm for 1 h;

[0086] 3.5: Spread the transformed bacterial solution evenly on an LB plate containing antibiotics and incubate it upside down at 37 °C overnight;

[0087] 3.6: Pick monoclonal colonies for large-scale culture and conduct preliminary verification by conventional PCR ( Figure 3 B), and further conduct preliminary verification by conventional PCR ( Figure 3 B) using the general plasmid detection primers (forward primer: GTTGTAAAACGACGGCCAG; reverse primer: CAGGAAACAGCTATGAC). After sending for testing, the results show that ( Figure 3 C), the full length of the sequence is 406 bp, and the standard quality plasmid construction is successful.

[0088] As Figure 3 shown, the amplification results of the target fragment, the construction of the standard quality plasmid and the sequence alignment results are provided. The lengths of the target fragment and the plasmid standard are correct. Compare the sequencing results with the sequence, the length is correct, and the plasmid construction is successful.

[0089] Among them, A: M: DNA marker 2000bp, lane 1 shows the result of amplifying the genome of Heterobasidion insulare with specific primers HA7R / F. B: M: DNA marker 2000bp, lane 5 shows the verification result of the plasmid. C: Standard quality plasmid sequence alignment result.

[0090] Step 4: Extract the plasmid using a kit:

[0091] Use the BBI EZ-10 Spin Column Plasmid Mini-Preps Kit from Sangon Biotech Co., Ltd. to extract the plasmid. The specific steps are as follows:

[0092] 4.1: Take 5 mL of the bacterial solution and add it to a centrifuge tube; centrifuge at 12000 rpm for 1 min to collect the bacterial cells. Discard the supernatant;

[0093] 4.2: Add 200 μL of Buffer S1 (already added RNase A) to the bacterial cell pellet and mix well by vortexing;

[0094] 4.3: Add 200 μL of Buffer S2 to the centrifuge tube; gently invert the centrifuge tube up and down 10 times;

[0095] 4.4: Add the specified amount of neutralization buffer Buffer S3; gently invert the centrifuge tube up and down 10 times to mix well;

[0096] 4.5: Centrifuge at 12000 rpm for 10 min;

[0097] 4.6: Carefully transfer the supernatant to the adsorption column; add 500 μL of 75% ethanol to the adsorption column; centrifuge at 8000 rpm for 1 min, then discard the filtrate; repeat the washing step once.

[0098] 4.7: Place the adsorption column in a new centrifuge tube and let it stand at room temperature for 10 min to completely volatilize the alcohol residue;

[0099] 4.8: Drop ddH2O onto the center of the adsorption membrane; let it stand at room temperature for 5 min, then centrifuge at an appropriate speed for 2 min to collect the plasmid solution in the centrifuge tube.

[0100] Step 5: Make a standard curve;

[0101] Extract high-concentration plasmids with a plasmid concentration reaching 1000 ng / μL. Use this as the mother liquor and perform 10-fold serial dilutions to obtain concentrations of 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, and 1 pg / μL as standard samples to be measured. Perform fluorescence quantitative PCR reactions to obtain a standard curve. The amplification curve is in an "S" shape ( Figure 4 A), and perform three replicates with good repeatability. According to the linear relationship between the logarithm of the DNA amount (x) and the corresponding CT value (y), we obtain Y = -4.963x + 12.947, R 2 = 0.993 ( Figure 4 B).

[0102] As Figure 4 shown, a plasmid standard amplification curve and a standard curve for Heterobasidion insulare are provided. R 2 = 0.993, with a good linear fitting degree.

[0103] A: Standard amplification curve of the standard sample. The concentrations of 1 - 6 are 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, and 1 pg / μL; B: Standard curve of Heterobasidion insulare.

[0104] Step 6. Preparation of samples to be measured:

[0105] Prepare liquid-suspended Heterobasidion insulare cells. Use a hemocytometer to prepare a bacterial suspension of 1×10 8 cells / mL as the mother liquor, and dilute it to cell suspensions with concentrations of 2×10 7 cells / mL, 1×10 7 cells / mL, 5×10 6 cells / mL, 2×10 6 cells / mL, and 1×10 6 cells / mL. Subsequently, take 200 μL to extract genomic DNA;

[0106] Step 7. Extract genomic DNA of the strain to be measured;

[0107] Use the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit for DNA extraction, specifically including:

[0108] 7.1: Take the bacterial culture medium, add 180 μL of Buffer GL, 20 μL of Proteinase K, and 10 μL of RNaseA to the tube, mix well, and incubate in a water bath at 56 °C for 10 min;

[0109] 7.2: Add 200 μL of Buffer GB and 200 μL of absolute ethanol thereto, and pipette and mix well;

[0110] 7.3: Transfer the above liquid to an adsorption column, centrifuge at 12,000 rpm for 2 min, and then discard the filtrate;

[0111] 7.4: Add 500 μL of Buffer WA thereto, centrifuge at 12,000 rpm for 1 min, and then discard the filtrate;

[0112] 7.5: Add 700 μL of Buffer WB thereto, centrifuge at 12,000 rpm for 1 min, and then discard the filtrate;

[0113] 7.6: Centrifuge the empty adsorption column at 12,000 rpm for 2 min, then place it on a new 1.5 mL centrifuge tube, let it stand for 10 min, add 30 μL of sterile water to the center of the adsorption column, and let it stand at room temperature for 5 min;

[0114] 7.7: Centrifuge at 12,000 rpm for 2 min to elute the DNA; Store the obtained genome in a -40 °C refrigerator for later use. Then prepare the real-time fluorescence quantitative PCR reaction system.

[0115] Step 8, Real-time fluorescence quantitative PCR reaction:

[0116] The real-time fluorescence quantitative PCR reaction is carried out by a two-step method. Set 10 μM and 5 μM as the primer reaction concentration variables, set 60 °C and 55 °C as the cycle reaction annealing temperature variables. Finally, the preferred primer concentration for the real-time fluorescence quantitative PCR reaction system is 5 μM, and the cycle reaction annealing temperature is 55 °C. The reaction system is shown in Table 5 below:

[0117] Table 5 Real-time fluorescence quantitative PCR reaction system

[0118]

[0119] The reaction procedure is as follows: Pre-denaturation: 95 °C, 30 sec; 40 cycles: 95 °C, 10 sec, 55 °C, 30 sec; Enter the default program reaction. The amplification results and melting curves at different concentrations are as Figure 5 shown.

[0120] As Figure 5 , an amplification curve and a melting curve of different concentrations of Heterobasidion insulare are provided. The amplification curve is "S"-shaped, and the melting curve has a strong single peak.

[0121] A: The concentration of 1 - 5 is 2×10 7 cells / mL, 1×107 cells / mL, 5×10 6 cells / mL, 2×10 6 cells / mL, 1×10 6 cells / mL. B: Dissolution curves of different concentration samples of *Alloclavaria albida*.

[0122] Step 9: Using the formula of copy number (copies / μL) = [ (number of ng × 10 -9 ) × (6.02×10 23 ) ] ÷ (number of base pairs × 660), the obtained CT value can be calculated according to the standard curve formula, and the CT value is corresponding to the copy concentration, so as to realize the quantification of the standard sample strain.

[0123] The cell concentration of the sample to be measured is converted with the copy concentration, and the results are shown in Table 6 below.

[0124] Table 6 Cell concentration and copy concentration

[0125]

[0126] After taking the average value of the corresponding relationship of this result calculation, the average copy concentration corresponding to the cell concentration of 1×10 6 cells / mL is 4.3×10 5 copies / μL.

[0127] Example 3:

[0128] A random sample detection of *Alloclavaria albida* is provided:

[0129] By random sampling, genomic DNA of the sample is extracted with reference to Example 2, and then fluorescence quantitative PCR ( Figure 6 ) is carried out. According to the formula, copy concentration (copies / μL) / average copy concentration ≈ cell concentration (cells / mL). The obtained CT value result of the sample is calculated for the copy concentration, and further the cell concentration in the random sample is obtained. The corresponding results are as follows in the table:

[0130] Table 7 Cell concentration and copy concentration

[0131]

[0132] Refer to Figure 6 the amplification results of the random samples of *Alloclavaria albida* provided. The random samples can be amplified and the corresponding CT values can be obtained.

[0133] Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of them. All other embodiments obtained by those of ordinary skill in the art and related fields based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention. Structures, devices, and operation methods not specifically described and explained in the present invention shall be implemented by conventional means in the art unless otherwise specified and limited.

Claims

1. A primer for rapid detection of Heterostigma grisea, characterized in that: The upstream primer sequence of the primer is shown in SEQ ID NO.13; The downstream primer sequence of the primer is shown in SEQ ID NO.

14.

2. A method for detecting and quantifying Heterostigmus griseus using the primers described in claim 1, characterized in that: The following steps are involved: Step 1, obtaining the target fragment: using the Heterostigma genome-specific primers SEQ ID NO.13-14 to perform PCR amplification on the Heterostigma genome to obtain the target fragment, and then cutting and recovering the fragment; Step 2, target gene connected to plasmid vector: Use cloning kit to connect the target fragment to the plasmid vector; Step 3, transforming and screening recombinants; Step 4: Extract the plasmid using the kit: Step 5: Prepare a standard curve; Step 6. Sample preparation: Prepare liquid-suspended Heterosceles cells and use a hemocytometer to prepare 1×10 8 cells / mL of bacterial solution was used as the mother solution and diluted to 2×10 7 cells / mL,1×10 7 cells / mL,5×10 6 cells / mL,2×10 6 cells / mL,1×10 6 cells / mL concentration of cell suspension, and then 200 μL was taken to extract genomic DNA; Step 7, extracting the genomic DNA of the strain to be tested, and then preparing a real-time fluorescence quantitative PCR reaction system; Step 8, Fluorescence quantitative PCR reaction: A two-step method is used to perform fluorescence quantitative PCR reaction, and the amplification results and melting curves of different concentrations are obtained; Step 9: Use the copy number (copies / μL) = [(ng number × 10 -9 )×(6.02×10 23 )]÷(number of bases × 660) The obtained CT value can be calculated according to the standard curve formula, and the CT value can be corresponded to the copy concentration to achieve the quantification of the standard sample strain; The method is used for non-disease diagnosis purposes.

3. The method according to claim 2, characterized in that In step 2, the cloning kit is used pEASY -T&BZero Cloning Kit universal gene cloning kit, the plasmid vector is pEASY -T&B Zero Cloning Vector plasmid vector, cloning reaction system is as follows: PCR target fragment 0.5 μL; pEASY -T&B Zero Cloning Vector 1μL; pEASY -The connection ratio of T&B Zero Cloning Vector to the target fragment is 1:7; after mixing, place in PCR instrument at 25℃ for 10 minutes; after completion, place the centrifuge tube on ice.

4. The method according to claim 2, characterized in that: The step 3 specifically includes: 3.1: Thaw the competent DH5α on ice; 3.2: Add the ligation product, mix gently and place on ice for 30 minutes; 3.3: Place the centrifuge tube in a 42°C water bath for 45 seconds, then quickly place it on ice for 2 minutes; 3.4: Add 700 μL of pure LB medium, mix gently, and culture at 37°C and 180 rpm for 1 hour; 3.5: Spread the transformed bacterial solution evenly on the LB plate containing antibiotics and culture it upside down at 37℃ overnight; 3.6: Pick a single clone for expansion and further perform preliminary verification by conventional PCR using universal plasmid detection primers. The universal plasmid detection primers are: forward primer: GTTGTAAAACGACGGCCAG; reverse primer: CAGGAAACAGCTATGAC, with a total sequence length of 406 bp. The standard was successfully constructed.

5. The method according to claim 2, characterized in that: The kit in step 4 is a BBI EZ-10 SpinColumn Plasmid Mini-Preps Kit, and the plasmid extraction specifically includes the following steps: 4.1: Take 5 mL of bacterial solution and add it to a centrifuge tube; centrifuge at 12000 rpm for 1 min, collect the bacteria and discard the supernatant; 4.2: Add 200 μL of buffer S1 to the bacterial pellet and shake thoroughly to mix; 4.3: Add 200 μL of Buffer S2 to the centrifuge tube; gently invert the centrifuge tube upside down 10 times; 4.4: Add the specified amount of neutralization buffer Buffer S3; gently turn the centrifuge tube upside down 10 times to mix thoroughly; 4.5: Centrifuge at 12000 rpm for 10 min; 4.6: Carefully transfer the supernatant to the adsorption column; add 500 μL of 75% ethanol to the adsorption column; centrifuge at 8000 rpm for 1 min, and then discard the filtrate; repeat the washing step once; 4.7: Place the adsorption column in a new centrifuge tube and let it stand at room temperature for 10 minutes to completely evaporate the alcohol residue; 4.8: Add ddH2O to the center of the adsorption film; leave it at room temperature for 5 minutes, then centrifuge it at an appropriate speed for 2 minutes and collect the plasmid solution into a centrifuge tube.

6. The method according to claim 2, characterized in that In step 7, DNA extraction is performed using TaKaRa MiniBESTUniversal Genomic DNA Extraction Kit, which specifically includes: 7.1: Take the bacterial culture medium, add 180μL of Buffer GL, 20μL of Proteinase K and 10μL of RNase A to the tube, mix well and incubate in a 56℃ water bath for 10min; 7.2: Add 200 μL of Buffer GB and 200 μL of anhydrous ethanol, and mix thoroughly by pipetting; 7.3: Transfer the above liquid to the adsorption column, centrifuge at 12000rpm for 2min, and then discard the filtrate; 7.4: Add 500 μL of Buffer WA, centrifuge at 12000 rpm for 1 min, and then discard the filtrate; 7.5: Add 700 μL of Buffer WB, centrifuge at 12000 rpm for 1 min, and then discard the filtrate; 7.6: Centrifuge the empty adsorption column at 12000rpm for 2min, then place it in a new 1.5mL centrifuge tube and let it stand for 10min. Add 30μL of sterile water to the center of the adsorption column and let it stand at room temperature for 5min. 7.7: Centrifuge at 12000rpm for 2min to elute the DNA; store the obtained genome in a -40℃ refrigerator for later use.

7. The method according to claim 2, characterized in that: In step 8, the primer concentration of the fluorescence quantitative PCR reaction system is 5 μM, and the annealing temperature of the cycle reaction is 55° C.

Images