Traditional Chinese medicine compound essential oil of ludwigia odorifera and application thereof in preparation of products for preventing and treating obesity

Abstract

The invention provides curcuma zedoaria traditional Chinese medicine compound essential oil and application thereof in preparation of products for preventing and treating obesity, and relates to the technical field of traditional Chinese medicine essential oil. The traditional Chinese medicine compound essential oil is prepared from radix curcumae essential oil, rhizoma cyperi essential oil and gynostemma pentaphylla essential oil. According to the traditional Chinese medicine compound essential oil which is administered in a sniffing mode, the weight gain of obese mice induced by high-fat feed can be remarkably reduced, and adipogenesis is inhibited; the traditional Chinese medicine composition can effectively reduce triglyceride, cholesterol and HDL level of obese mice induced by high-fat feed, improve LDL level, improve hyperlipidemia symptoms of the obese mice, improve the ability of liver to transport phospholipid and cholesterol, eliminate the ability of cholesterol of peripheral blood vessels, and realize the function of regulating lipid metabolism; meanwhile, the traditional Chinese medicine compound essential oil of the Blumea odorata provided by the invention can realize the effect of repairing intestinal flora disorder caused by high-fat diet, and the ecological balance of intestinal tracts of obese mice is recovered. The traditional Chinese medicine compound essential oil of the Blumea odorata has a huge application prospect in treating or preventing diseases in the aspect of obesity.

Description

Technical Field

[0001] The invention relates to the technical field of traditional Chinese medicine essential oils, and in particular to euphorbia pulegium traditional Chinese medicine compound essential oil and application thereof in preparing products for preventing and treating obesity. Background Art

[0002] Overweight and obese patients have excessive accumulation of triglycerides (TG) in their serum, mild or severe inflammation of the liver, and increased risk of coronary artery disease, hypertension, respiratory diseases, obstructive sleep apnea, osteoarthritis, and gallstones. Currently, most FDA-approved obesity treatment drugs are injected, resulting in poor patient compliance. Other side effects include gastrointestinal discomfort, vomiting, anxiety and depression, so finding new drugs that can fight obesity with fewer side effects has always been a new research hotspot.

[0003] Chinese herbal essential oils are volatile and aromatic fat-soluble substances extracted from Chinese herbal plants. They generally exist in the form of small molecular compounds such as terpenes, alcohols, ketones, aldehydes, and esters. They have small molecular weight, strong fat solubility, high inhalability and high permeability, and are easy to enter the microcirculation and tissue cells of organisms. They have anti-tumor, anti-viral, tranquilizing, anti-oxidation, lipid metabolism regulation, and immune regulation. In addition, aromatherapy derived from essential oils covers a variety of administration methods, such as smearing, rubbing, gargling, medicinal bathing, and sniffing. Aromatherapy can affect the body's metabolism through the mouth, nose, and skin, and ultimately achieve the effect of treating obesity. At present, many Chinese herbal essential oils have been proven to have the effect of resisting fatty liver and obesity. Most of the studies are on single essential oils, but they have weaknesses such as a single mechanism of action and poor effect. Therefore, it is very necessary to find a Chinese herbal compound essential oil with a clear effect, significant efficacy, and significant weight loss and lipid metabolism improvement for the body. Summary of the invention

[0004] 1. Technical issues to be solved

[0005] In view of the deficiencies in the prior art, the present invention provides a traditional Chinese medicine compound essential oil of yuxianglan and its application in the preparation of products for preventing and treating obesity.

[0006] (II) Technical solution

[0007] To achieve the above objectives, the present invention is implemented through the following technical solutions:

[0008] On the one hand, the present invention provides a traditional Chinese medicine compound essential oil of Curcuma aromatica, which is prepared from Curcuma essential oil, Cyperus rotundus essential oil and Gynostemma pentaphyllum essential oil.

[0009] Furthermore, the traditional Chinese medicine compound essential oil is prepared from the following raw materials in parts by weight: 0.1-2 parts of turmeric essential oil, 0.1-3 parts of cyperus rotundus essential oil, and 0.1-3 parts of gynostemma pentaphyllum essential oil.

[0010] Furthermore, the traditional Chinese medicine compound essential oil is prepared from the following raw materials in parts by weight: 0.1-1 parts of Curcuma essential oil, 0.5-2 parts of Cyperus rotundus essential oil, and 0.5-2 parts of Gynostemma pentaphyllum essential oil.

[0011] Furthermore, the Chinese medicine compound essential oil is made from the following raw materials in parts by weight: 0.5 parts of Curcuma essential oil, 1 part of Cyperus rotundus essential oil, and 1 part of Gynostemma pentaphyllum essential oil.

[0012] The single essential oils of the above ingredients are commercially available or obtained by conventional extraction methods, with a purity of more than 99%.

[0013] On the other hand, the present invention also provides the use of the indigofera traditional Chinese medicine compound essential oil in the preparation of products for preventing and / or improving and / or alleviating and / or treating obesity.

[0014] The product is a medically acceptable external preparation for aromatherapy.

[0015] (III) Beneficial effects

[0016] The present invention provides a Chinese medicine compound essential oil made of turmeric essential oil, cyperus rotundus essential oil and gynostemma pentaphyllum essential oil, and studies the application prospects of the above Chinese medicine compound essential oil in the treatment or prevention of obesity. Animal experiment results show that the yuxianglan Chinese medicine compound essential oil administered by sniffing provided by the present invention can significantly reduce the weight gain of obese mice induced by high-fat diet and inhibit fat generation; it can effectively reduce the levels of triglycerides, cholesterol and HDL in obese mice induced by high-fat diet, increase the level of LDL, improve the hyperlipidemia symptoms of obese mice, improve the liver's ability to transport phospholipids and cholesterol, and eliminate cholesterol in peripheral blood vessels, and achieve the function of regulating lipid metabolism; at the same time, the yuxianglan Chinese medicine compound essential oil provided by the present invention can achieve the effect of repairing the intestinal flora disorder caused by high-fat diet, and restore the intestinal ecological balance of obese mice. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The effects of different formulas of compound essential oils on the body weight of obese model mice; A is the weight change of mice in each group during the experiment; B is the body weight result of mice in each group at the end of the experiment; C is the decimal liver index of each group; compared with the HFD group, *P<0.05, **P<0.01.

[0018] Figure 2 The figure shows the effect of the Chinese herbal compound essential oil of the present invention on the body weight of obese mice; A is the food intake of each group of mice during the experiment; B is the weight gain change of each group of mice during the experiment and the body weight of each group of mice at the end of the experiment; C is the liver weight and liver index of each group of mice; compared with the HFD group, *P<0.05, **P<0.01, ***P<0.001.

[0019] Figure 3 The figure shows the effect of the Chinese herbal compound essential oil of the present invention on TC, TG, HDL and LDL in the serum and liver of obese mice; compared with the HFD group, *P<0.05, **P<0.01, ***P<0.001.

[0020] Figure 4 The results of HE staining and Oil Red staining of liver tissues of mice in each group.

[0021] Figure 5 Gene expression results of fat metabolism-related factors in liver tissue of mice in each group; compared with the HFD group, *P<0.05, **P<0.01, ***P<0.001.

[0022] Figure 6 The results are the effects of the indigofera traditional Chinese medicine compound essential oil of the present invention on the intestinal flora of obesity model mice. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0024] Example 1

[0025] The invention discloses a turmeric herbal compound essential oil. The compound essential oil is prepared from the following raw materials in parts by weight: 0.1 part of turmeric essential oil, 0.5 part of cyperus rotundus essential oil and 0.5 part of gynostemma pentaphyllum essential oil.

[0026] The single essential oils of the above ingredients are commercially available or obtained by conventional extraction methods, with a purity of more than 99%.

[0027] The Yuxianglan Chinese medicine compound essential oil is used to prepare a product for preventing and / or improving and / or alleviating and / or treating obesity. The product is a medically acceptable external preparation for aromatherapy.

[0028] Example 2

[0029] The difference between this embodiment and embodiment 1 is that the Chinese medicine compound essential oil is made of the following raw materials in parts by weight: 2 parts of Curcuma essential oil, 3 parts of Cyperus rotundus essential oil, and 3 parts of Gynostemma pentaphyllum essential oil.

[0030] Example 3

[0031] The difference between this embodiment and embodiment 1 is that the Chinese medicine compound essential oil is made of the following raw materials in parts by weight: 0.5 parts of Curcuma essential oil, 1.2 parts of Cyperus rotundus essential oil, and 1.4 parts of Gynostemma pentaphyllum essential oil.

[0032] Example 4

[0033] The difference between this embodiment and embodiment 1 is that the Chinese medicine compound essential oil is made of the following raw materials in parts by weight: 1.6 parts of Curcuma essential oil, 2.8 parts of Cyperus rotundus essential oil, and 2.4 parts of Gynostemma pentaphyllum essential oil.

[0034] Example 5

[0035] The difference between this embodiment and embodiment 1 is that the Chinese medicine compound essential oil is made of the following raw materials in parts by weight: 0.5 parts of Curcuma essential oil, 0.8 parts of Cyperus rotundus essential oil, and 0.6 parts of Gynostemma pentaphyllum essential oil.

[0036] Example 6

[0037] The difference between this embodiment and embodiment 1 is that the Chinese medicine compound essential oil is made of the following raw materials in parts by weight: 0.8 parts of Curcuma essential oil, 1.2 parts of Cyperus rotundus essential oil, and 1.4 parts of Gynostemma pentaphyllum essential oil.

[0038] Example 7

[0039] The difference between this embodiment and embodiment 1 is that the Chinese medicine compound essential oil is made of the following raw materials in parts by weight: 0.4 parts of Curcuma essential oil, 0.8 parts of Cyperus rotundus essential oil, and 1.2 parts of Gynostemma pentaphyllum essential oil.

[0040] Example 8

[0041] The difference between this embodiment and embodiment 1 is that the Chinese medicine compound essential oil is made of the following raw materials in parts by weight: 0.5 parts of Curcuma essential oil, 1.5 parts of Cyperus rotundus essential oil, and 0.5 parts of Gynostemma pentaphyllum essential oil.

[0042] Example 9

[0043] The difference between this embodiment and embodiment 1 is that the Chinese medicine compound essential oil is made of the following raw materials in parts by weight: 0.5 parts of Curcuma essential oil, 1 part of Cyperus rotundus essential oil, and 1 part of Gynostemma pentaphyllum essential oil.

[0044] Test Example 1

[0045] 1 Experimental animals

[0046] C57 / Bl6J mice were of standard strain, 7 weeks old, weighing (20±1) g, and were housed in a room with appropriate temperature and humidity control, with a 12-h light / dark cycle, free access to food and water, and fed with standard laboratory diet (Cat. No. 1010001, a product of Jiangsu Collaborative Pharmaceutical Bioengineering Co., Ltd.). Experiments were performed after one week of adaptation.

[0047] 2 Experimental drugs

[0048] Compound essential oil 1: 0.5 part of turmeric essential oil, 1 part of cyperus rotundus essential oil

[0049] Compound essential oil 2: 0.5 parts of turmeric essential oil, 1 part of Gynostemma pentaphyllum essential oil

[0050] Compound essential oil 3: 1 part Cyperus rotundus essential oil, 1 part Gynostemma pentaphyllum essential oil

[0051] Compound essential oil 4: 0.5 parts of turmeric essential oil, 1 part of cyperus rotundus essential oil, 1 part of gynostemma pentaphyllum essential oil

[0052] Compound essential oil 5: 0.5 part of rhubarb essential oil, 1 part of cyperus rotundus essential oil, 1 part of gynostemma pentaphyllum essential oil

[0053] According to the above formula, the single essential oils are mixed evenly and refrigerated for later use; the above single essential oils are obtained by carbon dioxide extraction method using Curcuma aromatica, Cyperus rotundus and Gynostemma pentaphyllum as raw materials, and the purity is above 99%.

[0054] 3 Experimental methods

[0055] 42 C57 / Bl6J mice after one week of adaptive feeding were randomly allocated to cages, 6 mice per cage, and then randomly divided into 7 groups, namely control diet group (NC group), high-fat diet group (HFD group), high-fat diet + compound essential oil group 1 (experimental group 1, F1), high-fat diet + compound essential oil group 2 (experimental group 2, F2), high-fat diet + compound essential oil group 3 (experimental group 3, F3), high-fat diet + compound essential oil group 4 (experimental group 4, F4), high-fat diet + compound essential oil group 5 (experimental group 5, F5). Among them, the essential oil group was given 10 μL / mouse of the corresponding compound essential oil by applying it on both sides of the nose once a day; the HFD group was replaced with normal saline. The HFD group and the essential oil group continued to be fed with a high-fat diet (D12492, Research diets) during the experiment, and had free access to food and water for 8 weeks.

[0056] 4 Observation indicators

[0057] The weight gain of mice in each group was recorded during the experiment. After the experiment, the mice were killed by cervical dislocation. The liver was weighed and the liver index was calculated.

[0058] 5 Statistical methods

[0059] Prism software was used to measure the data for collation and statistical analysis, and the data were expressed as mean ± standard error (x ± sem). One-Way ANOVA was used for inter-group significance analysis. P < 0.05 indicated statistically significant differences, and P < 0.01 indicated statistically significant differences. For quantitative experiments, three replicates were set up unless otherwise specified, and the results were averaged.

[0060] 6 Results

[0061] During the experiment, the weight changes of mice in each group were as follows: Figure 1 As shown in A, compared with the NC group, the weight gain rate of mice in the HFD group was significant, indicating that the obesity model was successfully established; compared with the HFD group, the weight gain of mice in the F1-F5 groups slowed down, among which the weight gain rate of mice in the F4 group was the slowest, which was equivalent to the weight gain rate of mice in the NC group; the weight gain rate of mice in the F1-F3 groups was significantly higher than that of the F4 group; the weight gain rate of mice in the F5 group was significantly higher than that of the F4 group, which was equivalent to the weight gain rate of mice in the F3 group.

[0062] The body weights of mice in each group at the end of the experiment were as follows: Figure 1 As shown in B, compared with the NC group, the body weight of mice in the HFD group was significantly higher than that in the NC group, with a significant difference (P<0.05); compared with the HFD group, the body weight of mice in the F1-F5 groups was significantly lower than that in the HFD group, among which the body weight of mice in the F4 group was significantly lower than that in the HFD group (P<0.05), and there was no significant difference compared with the NC group (P>0.05). Although the body weight of mice in the F1-F3 groups was significantly lower than that in the HFD group, it was still higher than that in the F4 group. In addition, the body weight of mice in the F5 group was equivalent to that of mice in the F3 group, with no significant difference (P>0.05).

[0063] The liver index results of each group of mice are as follows Figure 1 As shown in C, compared with the NC group, the liver index of mice in the HFD group was significantly higher than that in the NC group, with a significant difference (P<0.05); compared with the HFD group, the liver index of mice in the F1-F5 groups decreased to varying degrees, among which the liver index of mice in the F4 group was significantly lower than that in the HFD group (P<0.05), and there was no significant difference compared with the NC group (P>0.05). Although the liver index of mice in the F1-F3 groups was significantly lower than that in the HFD group, it was still higher than that in the F4 group (P<0.05).

[0064] According to the above results, the Yuxianglan Chinese medicine compound essential oil provided by the present invention can significantly reduce the body weight of obese model mice and reduce the liver index of obese model mice, and has great application prospects in the field of fat and weight loss. In addition, the above experimental results show that the three of Curcuma, Cyperus and Gynostemma pentaphyllum in the Chinese medicine compound essential oil provided by the present invention synergize, and after reducing any component and replacing a certain component, the best technical effect of reducing body weight and liver index for obese model mice cannot be achieved.

[0065] Test Example 2

[0066] 1 Experimental animals

[0067] C57 / Bl6J mice were of standard strain, 7 weeks old, weighing (20±1) g, and were housed in a room with appropriate temperature and humidity control, with a 12-h light / dark cycle, free access to food and water, and fed with standard laboratory diet (Cat. No. 1010001, a product of Jiangsu Collaborative Pharmaceutical Bioengineering Co., Ltd.). Experiments were performed after one week of adaptation.

[0068] 2 Experiment with essential oils

[0069] 0.5 parts of turmeric essential oil, 1 part of cyperus rotundus essential oil and 1 part of gynostemma pentaphyllum essential oil are mixed evenly according to the above parts by weight and refrigerated for later use; the above single essential oils are obtained by carbon dioxide extraction method with turmeric, cyperus rotundus and gynostemma pentaphyllum as raw materials, and the purity is above 99%.

[0070] 3 Animal grouping and treatment

[0071] Thirty-two C57 / Bl6J mice after one week of adaptive feeding were randomly allocated to cages, 8 mice per cage, and then randomly divided into 4 groups, namely control diet group (NC group), high-fat diet group (HFD group), high-fat diet + low-dose compound essential oil group (YXL-L group, 5μL / mouse), high-fat diet + high-dose compound essential oil group (YXL-H group, 10μL / mouse). Among them, the essential oil group was administered by sniffing once a day, which was applied to both sides of the nose; the HFD group was replaced with normal saline. The HFD group, essential oil group and positive control group continued to be fed with a high-fat diet (D12492, Research diets) during the experiment, and had free access to food and water for 8 weeks.

[0072] Two days before the end of the experiment, fresh feces of each mouse were collected and immediately frozen at -80°C. The mice were killed by cervical dislocation. Blood was centrifuged to obtain serum, and liver and epididymal fat were taken and immediately placed in liquid nitrogen and stored at -80°C for further analysis; the liver was weighed and divided into three parts the size of soybeans for subsequent QPCR verification of the expression of fat metabolism-related genes; part of the fat and liver were taken for HE sections to observe pathological changes.

[0073] 4. Detection indicators

[0074] 4.1 Determination of serum and liver TC, TG, HDL, LDL, etc.

[0075] Whole blood was centrifuged at 2500 rpm / min for 10 min to collect serum, and the test was performed according to the manufacturer's kit (Nanjing Jiancheng Bioengineering Institute).

[0076] 4.2 Pathological examination of mouse liver and adipose tissue

[0077] Mouse liver and epididymal tissues were fixed in formalin for 24 hours, dehydrated, embedded, stained, and finally imaged under a microscope.

[0078] 4.3 Detection of gene expression levels related to fat metabolism in mouse liver

[0079] The liver was taken out from the -80℃ ultra-low temperature freezer, 20 mg of tissue was weighed, total RNA was extracted, reverse transcribed into cDNA using a reverse transcription kit, and fluorescent quantitative PCR amplification was performed using cDNA as a template. GAPDH was used as an internal reference and 2 -ΔΔCT The mNRA expression of related genes was calculated by this method.

[0080] The primer sequences are as follows

[0081] Gene Upstream primer Downstream primer Ppara TTTCACAAGTGCCTGTCTGTCG TCTTCAGGTAGGCTTCGTGGAT Cyp7a1 GCTAAGGAGGACTTCACTCTACACC TGGTCTTTGCTTTCCCACTTTC Cpt1a GCCTCTATGTGGTGTCCAAGTATC CACCATAGCCGTCATCAGCAA Cox7A1 AACAGGTCTCCCAGGCTCT TCTGCTTCTCTGCCACACG SCD-1 GTTAGCACCTTCTTGCGATACACT GTGAAGTTGATGTGCCAGCG FAS CTGCCTCTGGTGCTTGCT ACCCGCCTCCTCAGCTTT PPAR-γ GACCACTCGCATTCCTTTGA CCACAGACTCGGCACTCAAT Cidea TGCACAGATGACGGGACAG GTGCTAGGCTTGGGGGATG GAPDH CCTCGTCCCGTAGACAAAATG TGAGGTCAATGAAGGGGTCGT

[0082] Note: PPAR-α: peroxisome proliferator-activated receptor α; PPAR-γ: peroxisome proliferator-activated receptor gamma; CYP7A1: cholesterol 7-alpha hydroxylase; CPT-1: carnitine palmitoyltransferase 1; Cox7A1: cytochrome C oxidase subunit 7A1; FAS: fatty acid synthase; SCD-1: stearoyl-CoA desaturase-1; Cidea: apoptosis-inducing DFF45-like effector A; GAPDH: 3-phosphate dehydrogenase.

[0083] 5 Statistical methods

[0084] Prism software was used to measure the data for collation and statistical analysis, and the data were expressed as mean ± standard error (x ± sem). One-Way ANOVA was used for inter-group significance analysis. P < 0.05 indicated statistically significant differences, and P < 0.01 indicated statistically significant differences. For quantitative experiments, three replicates were set up unless otherwise specified, and the results were averaged.

[0085] 6 Results

[0086] 6.1 Effect of the Chinese herbal compound essential oil of the present invention on the body weight of obese mice

[0087] like Figure 2 As shown in A, there was no significant difference in the food intake of mice in each group during the experiment (P>0.05). Figure 2 As shown in B, compared with the NC group, the body weight of mice in the HFD group increased significantly, and the difference was extremely significant (P<0.001); compared with the HFD group, the body weight of mice in the YXL-H, YXL-L and EXP groups decreased significantly (P<0.001 or P<0.05).

[0088] like Figure 2 As shown in C, compared with those in the NC group, the liver weight and liver index of mice in the HFD group were significantly increased, and the difference was extremely significant (P<0.001). Compared with the HFD group, the liver weight of the YXL-H group was significantly reduced (P<0.05), and the liver index was significantly decreased (P<0.01). The liver weight and liver index of the YXL-L group were both significantly decreased (P<0.05).

[0089] 6.2 Effects of the Chinese herbal compound essential oil of the present invention on serum and liver biochemical indices of obese mice

[0090] like Figure 3 As shown in the figure, compared with the NC group, the TC and TG contents in serum and liver of the mice in the HFD group were significantly increased (P<0.001), the HDL content in serum was significantly decreased (P<0.001), and the LDL content in serum was significantly increased. Compared with the HFD group, the TC and TG contents in serum and liver of the mice in the YXL-H group were significantly decreased (P<0.001), the HDL content in serum was significantly increased (P<0.001), and the LDL content in serum was significantly decreased; the TC content in serum and the TC and TG content in liver of the mice in the YXL-L group were significantly decreased (P<0.001), the TG content in serum was significantly decreased (P<0.05), the HDL content in serum was significantly increased (P<0.001), and the LDL content in serum was significantly decreased.

[0091] The liver was stained with HE and oil red. Figure 4 As shown, compared with the NC group, the degree of fatty degeneration in the liver of the mice in the HFD group was significantly increased, and the diameter of the fat droplets was significantly increased; compared with the HFD group, the degree of fatty degeneration in the liver of the mice in the YXL-H and YXL-L groups was significantly reduced, and the diameter of the fat droplets was significantly reduced.

[0092] 6.3 Effect of the Chinese herbal compound essential oil of the present invention on fat metabolism-related factors in obese mice

[0093] like Figure 5 As shown in the figure, compared with the NC group, the lipolysis genes PPAR-α, CPT-1 and CYP7A1 in the liver of the HFD group mice were significantly down-regulated, and the lipolysis genes PPAR-γ, SCD-1, FAS and Cidea were significantly up-regulated. Compared with the HFD group, the lipolysis genes PPAR-α, CPT-1 and CYP7A1 in the YXL-H and YXL-L groups mice were significantly up-regulated (P<0.01), and the lipolysis genes PPAR-γ, SCD-1, FAS and Cidea were significantly down-regulated (P<0.05 or P<0.01).

[0094] 6.4 Effect of the Chinese herbal compound essential oil of the present invention on the intestinal flora structure of obese mice

[0095] Figure 6 The results of the changes in the intestinal flora structure of mice in the model group and the group treated with euphorbia obesa essential oil are shown. Figure 6 A) shows that the health of the intestinal flora of mice was improved after treatment with yulan essential oil, and principal coordinate analysis PCOA analysis ( Figure 6 B) It was found that the intestinal flora of mice after treatment was significantly different from that of the model group. Further analysis of the flora composition found that Dubosiella and Acetatifactor bacteria increased significantly at the genus level, and Dubosiella, Lachnospiraceae bacterium 28-4 and Acetatifactor bacteria increased in abundance at the species level, and these bacteria can produce short-chain fatty acids and other metabolites that help reduce body weight. The above results show that the blue essential oil provided by the present invention can repair the flora disorder caused by a high-fat diet and restore the intestinal ecological balance of obese model mice.

[0096] 7 Conclusion

[0097] The above results show that the indigofera Chinese medicinal compound essential oil administered by inhalation provided by the present invention can significantly reduce the weight gain of obese mice induced by a high-fat diet and inhibit fat production; it can effectively reduce the levels of triglycerides, cholesterol and HDL in obese mice induced by a high-fat diet, and increase the level of LDL, which has the effect of improving the hyperlipidemia symptoms of obese mice, improving the liver's ability to transport phospholipids and cholesterol, and eliminating cholesterol in peripheral blood vessels, thereby achieving the function of regulating lipid metabolism; at the same time, the indigofera Chinese medicinal compound essential oil provided by the present invention can achieve the effect of repairing the intestinal flora disorder caused by a high-fat diet, and restore the intestinal ecological balance of obese mice.

[0098] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Chinese medicinal compound essential oil of indigofera odorifera, characterized in that: The traditional Chinese medicine compound essential oil is prepared from turmeric essential oil, cyperus rotundus essential oil and gynostemma pentaphyllum essential oil.

2. A kind of indigofera traditional Chinese medicine compound essential oil according to claim 1, characterized in that, The traditional Chinese medicine compound essential oil is prepared from the following raw materials in parts by weight: 0.1-2 parts of turmeric essential oil, 0.1-3 parts of cyperus rotundus essential oil, and 0.1-3 parts of gynostemma pentaphyllum essential oil.

3. A kind of indigofera traditional Chinese medicine compound essential oil according to claim 1, characterized in that, The traditional Chinese medicine compound essential oil is prepared from the following raw materials in parts by weight: 0.1-1 parts of turmeric essential oil, 0.5-2 parts of cyperus rotundus essential oil, and 0.5-2 parts of gynostemma pentaphyllum essential oil.

4. A kind of indigofera traditional Chinese medicine compound essential oil according to claim 1, characterized in that, The traditional Chinese medicine compound essential oil is prepared from the following raw materials in parts by weight: 0.5 parts of turmeric essential oil, 1 part of cyperus rotundus essential oil, and 1 part of gynostemma pentaphyllum essential oil.

5. The Chinese medicinal compound essential oil according to any one of claims 1 to 3, characterized in that: The essential oils of Curcuma aromatica, Cyperus rotundus and Gynostemma pentaphyllum are commercially available or obtained by conventional extraction methods, and have a purity of more than 99%.

6. Use of the indigofera traditional Chinese medicine compound essential oil according to any one of claims 1 to 3 in the preparation of products for preventing and / or improving and / or alleviating and / or treating obesity.

Images