Plasma tsRNA molecular marker for predicting postoperative delirium of elderly patients and application of plasma tsRNA molecular marker
By detecting tRF-Gly-14 and tRF-Arg-39 in preoperative plasma in elderly patients, the problem of difficult prediction of postoperative delirium in the prior art is solved, efficient and early prediction and diagnosis are achieved, and postoperative prognosis and quality of life are improved.
CN119709992AActive Publication Date: 2025-03-28NINGBO FIRST HOSPITAL
5 Cites 2 Cited by
Patent Information
- Application Number
- CN202510238262.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-03
- Publication Date
- 2025-03-28
- Estimated Expiration
- 2045-03-03
AI Technical Summary
Technical Problem
The existing technology lacks reliable predictors and it is difficult to promptly alert elderly patients with high-risk postoperative delirium.
Method used
A predictive marker based on plasma tsRNA, specifically tRF-Gly-14 and/or tRF-Arg-39, was developed to detect positive and reverse primers amplified by fluorescence quantitative PCR to predict the occurrence of postoperative delirium.
Benefits of technology
Detection of tRF-Gly-14 and tRF-Arg-39 through peripheral blood can efficiently and early diagnosis and prediction of postoperative delirium, improving prediction accuracy and sensitivity, and helping to timely identify high-risk patients.
✦ Generated by Eureka AI based on patent content.
Abstract
The invention discloses a plasma tsRNA molecular marker for predicting postoperative delirium of old patients and application of the plasma tsRNA molecular marker, and is characterized in that the plasma tsRNA molecular marker is tRF-Gly-14 and / or tRF-Arg-39, the nucleotide sequence of the tRF-Gly-14 is AATGGTAGAATTTCGGCC, the nucleotide sequence of the tRF-Arg-39 is TCAGAAGATTGAGGGTTCGAATCCTTCGTGGTTG, and the nucleotide sequence of the tRF-Gly-14 and / or the tRF-Arg-39 is / are AATGGTAGAATTTCGGTGGTTG. The invention further provides application of the plasma tsRNA molecular marker in preparation of a kit for predicting postoperative delirium of old patients. The kit comprises forward and reverse primers for fluorescent quantitative PCR (Polymerase Chain Reaction) amplification of tRF-Gly-14 and / or tRF-Arg-39; the method has the advantages of high POD prediction accuracy, high sensitivity and strong specificity, and is helpful for identifying high-risk patients in time.
Need to check novelty before this filing date? Find Prior Art