Application of alantolactone in preparation of medicine for treating xerophthalmia

Abstract

The invention provides an application of alantolactone in preparation of a medicine for treating xerophthalmia. The alantolactone in the medicine can effectively inhibit ocular surface inflammation and reduce relative expression of TLR4 mRNA (messenger Ribonucleic Acid). By establishing a rat xerophthalmia model and determining indexes such as animal tear secretion volume, tear film rupture time, ocular surface inflammation level, cornea thickness and the like after administration, alantolactone is found to increase tear secretion, prolong tear film rupture time and significantly reduce IL-1beta, IL-10 and IL-17A levels (plt; 0.05) of the alantolactone, the degree of corneal hyperplasia is relieved, a good treatment effect on xerophthalmia is achieved, and the treatment effect is in positive correlation with the dosage of the alantolactone.

Description

Technical Field

[0001] The invention belongs to the field of medical technology, and particularly relates to the application of inulin lactone in the preparation of medicines for treating dry eye. Background Art

[0002] Dry eye, also known as keratoconjunctivitis sicca, is the most common ocular surface disease in clinical practice. It is caused by decreased tear film stability and imbalance of the ocular surface environment. It may be accompanied by symptoms such as ocular tissue damage, and in severe cases, it may eventually lead to corneal opacity and vision loss. Currently, the pathogenesis of dry eye is mainly (1) increased tear osmotic pressure; (2) tear film instability; (3) inflammation of the ocular surface, which requires long-term treatment to rebuild and maintain the homeostasis of the ocular surface system. Patients with dry eye who are not treated in time will develop serious complications. Therefore, it is crucial to continuously develop drugs to treat dry eye.

[0003] Currently, the treatment options available in clinical practice are limited, mainly focusing on increasing tear production and anti-inflammation. Commonly used treatments in clinical practice include (1) artificial tears; (2) autologous serum; (3) anti-inflammatory drugs, such as cyclosporine A; and (4) drugs such as corticosteroids. These treatments have many limitations. For example, artificial tears can only produce temporary relief. Long-term use of hormonal eye drops may cause cataracts or glaucoma. Therefore, finding a new drug that can inhibit ocular surface inflammation has become a focus of clinical attention in ophthalmology.

[0004] Alantolactone, chemical name: 3a,5,6,7,8,8a,9,9a-octahydro-5,8a-dimethyl-3-methylenenaphtho[2,3-b]furan-2(3H)-one, is a member of the Asteraceae plant Alantolactone ( Inula helenium L.) or Tibetan Atractylodes ( Inula racemosa Hook. f.) is the main active ingredient in the dried root of Eupatorium odoratum. Inula and Tibetan Aucklandia odoratum not only have antibacterial, antiviral, antitumor, analgesic, insecticidal and cardiovascular protective effects, but also have certain anti-inflammatory effects in cell experiments by intervening in IFN-γ and TNF-α. As one of the main ingredients, there is no research report on the use of Eupatorium odoratum in the treatment of dry eye.

[0005] Based on the above, the inventor innovatively proposed the use of scutellaria lactone in the preparation of drugs for treating dry eye, in order to achieve the preparation and application of drugs for dry eye. Summary of the invention

[0006] In order to solve the above problems, the present invention provides the use of scutellaria lactone in the preparation of a drug for treating dry eye by reducing ocular inflammation and the expression of related factors.

[0007] In order to achieve the above object, the present invention provides the following technical solutions: The invention provides a medicine for treating dry eye. The raw materials include: inulin lactone, an osmotic pressure regulator, a pH regulator, a stabilizer and distilled water.

[0008] Preferably, the osmotic pressure regulator includes one or more of inorganic salts, monosaccharides and lower polyols, more preferably monosaccharides; the inorganic salts preferably include potassium chloride and / or sodium chloride, more preferably sodium chloride; the monosaccharides preferably include one or more of glucose, fructose and lactose, more preferably lactose; the lower polyols preferably include mannitol and / or xylitol, more preferably mannitol.

[0009] Preferably, the pH regulator includes phosphate buffer, citrate buffer or borate buffer; the pH value of the drug is adjusted to 5-9, which is within the eye tolerance range.

[0010] Preferably, the stabilizer comprises a nonionic surfactant: one or more of polysorbate, poloxamer, polycarbophil, carbomer, vitamin E polyethylene glycol succinate (TPGS), diethylene glycol monoethyl ether, hydroxypropyl methylcellulose and polyethylene glycol.

[0011] Preferably, the mass fraction of inulin lactone in the drug is 0.001% to 0.01%, more preferably 0.005%.

[0012] Preferably, the mass fraction of the osmotic pressure regulator in the drug is 0.1% to 4%. The osmotic pressure regulator can be used to adjust the osmotic pressure between the drug and the tear fluid.

[0013] This concentration range is the concentration range in which inulin lactone is fully soluble.

[0014] Preferably, the mass fraction of the stabilizer in the drug is 0.1% to 1.5%, which is within the tolerance range of the eye.

[0015] Preferably, the dosage form of the drug comprises eye drops.

[0016] The present invention also provides the use of inulin lactone in preparing a medicine for treating dry eye.

[0017] Preferably, the dry eye syndrome includes ocular surface inflammatory factors and relative expression of TLR4 mRNA.

[0018] Preferably, the scutellaria lactone in the medicine is used as an inhibitor of ocular surface inflammation and / or in the preparation of a medicine for preventing and / or treating ocular surface inflammation.

[0019] Preferably, the inulin in the drug inhibits the signaling pathway where TLR4 is located and induces the reduction of TLR4 mRNA related gene expression.

[0020] Beneficial effects: The present invention provides the use of scutellaria lactone in the preparation of a drug for treating dry eye. The scutellaria lactone in the drug of the present invention can effectively inhibit ocular surface inflammation and reduce the relative expression of TLR4 mRNA. By establishing a rat dry eye model, and measuring the tear secretion, tear film breakup time, ocular surface inflammation level, corneal thickness and other indicators of the animals after administration, it was found that scutellaria lactone increased tear secretion, prolonged tear film breakup time, significantly reduced IL-1β, IL-10, IL-17A levels in corneal tissue (p<0.05), and alleviated the degree of corneal hyperplasia, and had a good therapeutic effect on dry eye, and the therapeutic effect was positively correlated with the dosage of scutellaria lactone. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0022] Figure 1 H&E staining images of the corneas of rats in each experimental group. DETAILED DESCRIPTION

[0023] In order to enable those skilled in the art to better understand the technical solution of the present invention, the application of the scutellaria lactone provided by the present invention in the preparation of a drug for treating dry eye is described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0024] Embodiment 1: A drug for treating dry eye, comprising the following components: 0.2wt.% of scutellaria lactone, 4wt.% of an osmotic pressure regulator, 10mM of a pH regulator, 1.5wt.% of a stabilizer, and the remainder of distilled water; the osmotic pressure regulator is glucose; the pH regulator is a phosphate buffer (the pH value of the drug is 7.4); the stabilizer is vitamin E polyethylene glycol succinate (TPGS) and diethylene glycol monoethyl ether (1:1, w:w); the mass ratio of hydroxypropyl methylcellulose to polyethylene glycol 400 is 0.5:1.

[0025] The preparation method of the drug is as follows: adding the required osmotic pressure regulator, pH buffer and stabilizer into a beaker and heating to 50° C., stirring for 30 minutes, adding inulin lactone, continuing to stir for 30 minutes, adding an appropriate amount of distilled water to 100%; after cooling to room temperature, filtering into a sterile container using a 0.22 μm sterile filter membrane. Example

[0026] A drug for treating dry eye, comprising the following components: 0.01wt.% of scutellaria lactone, 0.2wt.% of an osmotic pressure regulator, 5mM of a pH regulator, 0.1wt.% of a stabilizer, and the remainder of distilled water; the osmotic pressure regulator is sodium chloride; the pH regulator is a citrate buffer (the pH value of the drug is 5.8); and the stabilizer is polysorbate 80.

[0027] The preparation method of the drug is the same as that of Example 1. Example

[0028] A drug for treating dry eye, comprising the following components: 0.001wt.% of scutellaria lactone, 2wt.% of an osmotic pressure regulator, 10mM of a pH regulator, 0.3wt.% of a stabilizer, and the remainder of distilled water; the osmotic pressure regulator is lactose; the pH regulator is a phosphate buffer (the pH value of the drug is 7.0); and the stabilizer is poloxamer.

[0029] The preparation method of the drug is the same as that of Example 1.

[0030] Establishing an animal dry eye model Sprague Dawley rats were selected as experimental animals, and each rat was subcutaneously injected with 0.4 mL of 6 mg / ml scopolamine hydrobromide, 4 times a day, for 10 consecutive days to complete the modeling. After modeling, the drug eye drops prepared in Examples 1 to 3 of the present invention were given for treatment, and the commercially available drug cyclosporine eye drops (specification 0.05%) were used as positive controls, SD dry eye rats were used as dry eye controls, and normal rats were used as normal controls. There were 5 rats in each group. Three times a day, 50 µL each time, were administered for 10 consecutive days, and the tear secretion was detected 1 hour after administration on the 0th, 2nd, 4th, 6th, 8th, and 10th days, and the tear film breakup time and corneal thickness were measured after the end of the experiment. The effect of the drug eye drops prepared in Examples 1 to 3 on the treatment of dry eye was evaluated, and the mechanism of action of the drug eye drops prepared in Examples 1 to 3 on the treatment of dry eye was studied by detecting the level of ocular surface inflammation and TLR4 mRNA expression.

[0031] Tear secretion: The phenol red cotton thread method was used to read the length (mm) of the moistened and reddened phenol red cotton thread to assess tear secretion.

[0032] Corneal surface defect: corneal sodium fluorescein staining was used to record the time from the last blink to the appearance of the first corneal dark spot under the cobalt blue light of a slit lamp to record the tear film rupture time.

[0033] Corneal thickness: At the end of the experiment, H&E staining was used to measure the corneal thickness of the corneal tissue.

[0034] Inflammation level: At the end of the experiment, ELISA was used to detect the levels of IL-1β, IL-17A, and IL-10 in corneal tissue. At the end of the experiment, real-time fluorescence quantitative polymerase chain reaction qRT-PCR was used to detect the expression of TLR4 mRNA levels in corneal tissue (primer sequences: TLR4 sense chain: AGCAGGTGGAATTGTATCGC; β-actin sense chain: CTGTGCCCATCTACGAGGGCTAT).

[0035] The specific experimental results are shown in Tables 1-3 and Figure 1 shown.

[0036] Table 1 Average tear secretion of rats in each group evaluated by phenol red cotton thread method (mm, n=5)

[0037] Table 2 Tear film breakup time of rats in different groups after administration of sodium fluorescein

[0038] As shown in Tables 1 and 2, compared with cyclosporin, the tear secretion of dry eye mice increased after treatment with 0.001wt.% of the inulin lactone preparation composition, and corneal fluorescein sodium staining showed that the tear film breakup time was significantly prolonged and the tear secretion amount was significantly increased. And as the content of inulin lactone in the preparation composition increased, the therapeutic effect of inulin lactone on dry eye was significantly improved. Figure 1 The results showed that the corneal epithelial cells of the rats in the normal control group were well stratified and arranged regularly, the cells at the base were arranged in a columnar shape, and gradually differentiated into squamous epithelial cells towards the corneal epithelium; the corneal epithelial cells of the rats in the dry eye model group proliferated, and the epithelium was significantly thickened; the group treated with scutellaria lactone eye drops could alleviate the degree of corneal hyperplasia, among which Example 3 had a relatively good effect, and no significant change was observed in thickness.

[0039] Table 3 Levels of inflammatory factors and relative expression of TLR4 mRNA in ocular surface tissues of rats in different groups

[0040] Table 3 shows that compared with the normal group, the levels of IL-1β, IL-10, and IL-17A in the corneal tissue of the model group rats were upregulated. After treatment in the positive control group, Example 1, Example 2, and Example 3 groups, the levels of IL-1β, IL-10, and IL-17A in the corneal tissue decreased (p<0.05). Compared with the dry eye control model group, Examples 1 to 3 can effectively reduce the level of TLR4 mRNA. It can be inferred that the scutellaria lactone eye drops can inhibit the signaling pathway where TLR4 is located, induce the reduction of TLR4 mRNA-related gene expression, and achieve the effect of treating dry eye.

Claims

1. The use of scutellaria lactone in the preparation of a drug for treating dry eye, characterized in that: The drug raw materials include inulin lactone, an osmotic pressure regulator, a pH regulator, a stabilizer and distilled water.

2. The use of the inulin lactone according to claim 1 in the preparation of a drug for treating dry eye, characterized in that: The osmotic pressure regulator includes one or more of inorganic salts, monosaccharides and lower polyols, more preferably monosaccharides; the inorganic salts preferably include potassium chloride and / or sodium chloride, more preferably sodium chloride; the monosaccharides preferably include one or more of glucose, fructose and lactose, more preferably lactose; the lower polyols preferably include mannitol and / or xylitol, more preferably mannitol.

3. The use of the inulin lactone according to claim 1 in the preparation of a drug for treating dry eye, characterized in that: The pH regulator includes phosphate buffer, citrate buffer or borate buffer; the pH value of the drug is adjusted to 5-9.

4. The use of inulin lactone according to claim 1 in the preparation of a drug for treating dry eye, characterized in that: The stabilizer includes a nonionic surfactant: one or more of polysorbate, poloxamer, polycarbophil, carbomer, vitamin E polyethylene glycol succinate (TPGS), diethylene glycol monoethyl ether, hydroxypropyl methylcellulose and polyethylene glycol.

5. The use of inulin lactone according to claim 1 in the preparation of a drug for treating dry eye, characterized in that: The mass fraction of inulin lactone in the drug is 0.001% to 0.01%, more preferably 0.005%; the mass fraction of the osmotic pressure regulator in the drug is 0.1% to 4%; the mass fraction of the stabilizer in the drug is 0.1% to 1.5%.

6. The use of inulin lactone according to claim 1 in the preparation of a drug for treating dry eye, characterized in that: The dosage form of the drug includes eye drops.

7. The use of inulin lactone according to claim 1 in the preparation of a medicament for treating dry eye, characterized in that: The dry eye syndrome includes ocular surface inflammatory factors and TLR4 mRNA relative expression.

8. The use of inulin lactone according to claim 1 in the preparation of a drug for treating dry eye, characterized in that: The scutellaria lactone in the medicine is used as an inhibitor of ocular surface inflammation and / or in the preparation of the medicine for preventing and / or treating ocular surface inflammation.

9. The use of inulin lactone according to claim 1 in the preparation of a medicament for treating dry eye, characterized in that: The inulin in the drug inhibits the signal pathway where TLR4 is located and induces the inhibition of TLR4 mRNA related gene expression.

Images