Oleanolic acid derivative and preparation method and application thereof

Abstract

The present invention belongs to the technical field of natural drug chemistry, and specifically relates to an oleanolic acid derivative, a preparation method and application thereof. The oleanolic acid derivative provided by the present invention has a chemical structure shown in Formula 1. The oleanolic acid derivative provided by the present invention can target and enter tumor cells and mitochondria in tumor cells, induce an increase in reactive oxygen species in tumor mitochondria, reduce mitochondrial membrane potential, lead to the release of mitochondrial DNA (mtDNA), and finally induce pyroptosis of tumor cells through inflammasomes, thereby effectively improving the anti-tumor efficacy. In summary, the oleanolic acid derivative with the structure shown in Formula 1 provided by the present invention has a wide range of raw materials for preparation, achieves the killing of tumor cells, has good anti-tumor efficacy, and is convenient for the development and research of anti-tumor drugs.

Description

Technical Field

[0001] The invention belongs to the technical field of natural drug chemistry, and specifically relates to an oleanolic acid derivative and a preparation method and application thereof. Background Art

[0002] Currently, the main treatment for tumors is still surgery, supplemented by radiotherapy and chemotherapy, but the current prognosis is not ideal. Therefore, finding and discovering new drugs with high tumor selectivity has important theoretical and practical significance.

[0003] Mitochondria are the "energy factories" of cells, providing ATP for cells and participating in various cellular processes, such as regulating redox homeostasis, DNA repair, apoptosis, autophagy, and autoinflammatory responses. Abnormal mitochondrial function plays an important role in the occurrence and development of tumors. Mitochondrial dysfunction can lead to excessive production of reactive oxygen species (ROS), which are key regulators of signaling pathways involved in pre-tumor metabolic reprogramming. Alterations in mitochondrial metabolism can promote the production of tumor-associated proteins and tumor metabolites, thereby regulating tumor progression. In addition, when mitochondrial dynamics are dysregulated, the dynamic properties of mitochondria are associated with cancer metastasis, drug resistance, and stem cell differentiation. Given the key role of mitochondria in the pathogenesis of tumors, mitochondria are an attractive target for tumor treatment, and directly destroying mitochondrial structure or delivering chemotherapeutic drugs to mitochondria is expected to effectively treat tumors. However, since effective mitochondrial targeting requires overcoming many physiological and biological barriers, there is still a lack of anticancer drug raw material compounds that can effectively target tumor cell mitochondria, have a wide source of raw materials, and have low manufacturing costs. Summary of the invention

[0004] The purpose of the present invention is to provide an oleanolic acid derivative and a preparation method and application thereof. The oleanolic acid derivative provided by the present invention has a mitochondrial targeting function, can efficiently target the mitochondria of tumor cells, has good anti-tumor efficacy, and has a wide source of raw materials and is simple to prepare, which is convenient for the development and research of anti-tumor drugs.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides an oleanolic acid derivative having a chemical structure shown in Formula 1:

[0007]

[0008] The present invention provides a method for preparing the oleanolic acid derivative, comprising the following steps:

[0009] Oleanolic acid, a condensation reagent, an organic solvent, an organic base and 3-(dimethylamino)-1-propylamine are mixed for condensation reaction to obtain an oleanolic acid derivative having a structure shown in formula 1.

[0010] Preferably, the molar ratio of the oleanolic acid to the 3-(dimethylamino)-1-propylamine is 1 to 2:3;

[0011] The condensation reagent includes 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and 1-hydroxybenzotriazole; the molar ratio of the 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride to the 1-hydroxybenzotriazole is 1:1;

[0012] The organic base is triethylamine; the molar ratio of the oleanolic acid to the organic base is 1:2-3.

[0013] Preferably, the condensation reaction temperature is room temperature;

[0014] After the condensation reaction is completed, a condensation reaction liquid is obtained; the method further comprises: removing solvent from the condensation reaction liquid to obtain a crude condensation reaction product; purifying the crude condensation reaction product by silica gel column chromatography to obtain a pure product of the oleanolic acid derivative; the eluent used for the silica gel column chromatography purification is dichloromethane-methanol.

[0015] The present invention provides a nano-micelle loaded with an oleanolic acid derivative, which is formed by cross-linking the oleanolic acid derivative described in the above technical solution or the oleanolic acid derivative prepared by the preparation method described in the above technical solution with oleanolic acid.

[0016] The present invention provides a method for preparing nanomicelles loaded with oleanolic acid derivatives as described in the above technical solution, comprising the following steps:

[0017] mixing the oleanolic acid derivative, oleanolic acid and an organic solvent to obtain a mixed organic solution;

[0018] The mixed organic solution and the dispersant aqueous solution are mixed and emulsified to obtain the nano micelles loaded with the oleanolic acid derivative.

[0019] Preferably, the mass ratio of the oleanolic acid derivative to oleanolic acid is ≤1:1.

[0020] The present invention provides the use of the oleanolic acid derivatives and their medically acceptable salts described in the above technical scheme, or the oleanolic acid derivatives prepared by the preparation method described in the above technical scheme, or the nanomicelles loaded with oleanolic acid derivatives described in the above technical scheme, or the nanomicelles loaded with oleanolic acid derivatives prepared by the preparation method described in the above technical scheme in the preparation of anti-tumor drugs.

[0021] Preferably, the anti-tumor drug includes an anti-glioma drug, an anti-breast cancer drug or an anti-lung cancer drug.

[0022] The present invention provides an anti-tumor drug composition, comprising active pharmaceutical ingredients and excipients; the active pharmaceutical ingredients include the oleanolic acid derivatives and medically acceptable salts thereof described in the above technical solution, or the oleanolic acid derivatives prepared by the preparation method described in the above technical solution, or the nanomicelles loaded with oleanolic acid derivatives described in the above technical solution, or the nanomicelles loaded with oleanolic acid derivatives prepared by the preparation method described in the above technical solution.

[0023] The present invention provides an oleanolic acid derivative (OTA) having a chemical structure shown in Formula 1. The present invention selects oleanolic acid (OA) as a parent core compound. Oleanolic acid is a pentacyclic triterpenoid compound, which is widely present in various plants and foods such as apple epidermis, papaya fruit, persimmon fruit, plum, loquat, soybean, etc. The present invention introduces a 3-(dimethylamino)-1-propylamine segment through the carboxyl group of oleanolic acid, and the obtained oleanolic acid derivative has the function of targeting mitochondria. The oleanolic acid derivative provided by the present invention can target tumor cells through the EPR effect and target mitochondria in tumor cells by interacting with TOM70, induce the increase of reactive oxygen in tumor mitochondria, reduce mitochondrial membrane potential, lead to the release of mitochondrial DNA (mtDNA), and finally induce tumor cell pyroptosis through inflammasomes, thereby effectively improving the anti-tumor efficacy. In summary, the preparation raw materials of the oleanolic acid derivatives of the structure shown in Formula 1 provided by the present invention are widely available, and the killing of tumor cells is achieved, the anti-tumor efficacy is good, and the development and research of anti-tumor drugs are convenient.

[0024] The present invention provides a method for preparing the oleanolic acid derivative, comprising the following steps: mixing oleanolic acid, a condensation reagent, an organic solvent, an organic base and 3-(dimethylamino)-1-propylamine for condensation reaction to obtain the oleanolic acid derivative with the structure shown in Formula 1. The present invention uses oleanolic acid as a raw material and adopts a condensation method to prepare the oleanolic acid derivative with the structure shown in Formula 1 in one step. The preparation method provided by the present invention has a raw material source method, a short preparation process, and is suitable for industrial sound field applications.

[0025] The present invention provides a nano-micelle loaded with oleanolic acid derivatives, which is formed by cross-linking the oleanolic acid derivatives described in the above technical solution or the oleanolic acid derivatives prepared by the preparation method described in the above technical solution and oleanolic acid. In the present invention, the oleanolic acid derivatives are insoluble in water. The present invention can effectively improve the solubility of the oleanolic acid derivatives by making the oleanolic acid derivatives into nano-micelles, thereby realizing intravenous injection, realizing tumor site aggregation through the EPR effect, and reducing the toxic and side effects of the drug; the nano-micelle loaded with oleanolic acid derivatives provided by the present invention can make the bioactive substance (oleanolic acid derivatives of the structure shown in Formula 1) maintain integrity and biological activity during drug delivery, and not be degraded by enzymes. At the same time, the present invention uses oleanolic acid to promote the formation of nano-micelles loaded with oleanolic acid derivatives. The present invention uses oleanolic acid derivatives and oleanolic acid to form water-in-oil nano-micelles, which improves the delivery efficiency of oleanolic acid derivatives in vivo.

[0026] Furthermore, in the present invention, the mass ratio of the oleanolic acid derivative to oleanolic acid is ≤ 1: 1. The present invention can obtain a nanomicelle product loaded with oleanolic acid derivatives with a more stable structure by controlling the mass ratio of the oleanolic acid derivative to oleanolic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The oleanolic acid derivative OTA prepared in Example 1 1 H NMR spectra;

[0028] Figure 2 The oleanolic acid derivative OTA prepared in Example 1 1 H- 1 H COSY diagram;

[0029] Figure 3 The MS chromatogram of LC-MS / MS analysis of the oleanolic acid derivative OTA prepared in Example 1;

[0030] Figure 4 This is the MS spectrum of the oleanolic acid derivative OTA prepared in Example 1;

[0031] Figure 5 This is a characterization diagram of OTA nanoparticles prepared in Example 2. Figure 5 A in the figure is the scanning electron microscope image of OTA nanoparticles. Figure 5 B in the figure is the particle size of OTA nanoparticles measured by Malvern particle size analyzer; Figure 5 C in the figure is the surface potential of OTA nanoparticles measured by Malvern particle size analyzer;

[0032] Figure 6 This is a diagram showing the localization of OTA in glioma cell mitochondria in Example 3;

[0033] Figure 7 This is a characterization diagram of the killing ability of OTA nanoparticles prepared in Example 2 on tumor cells;

[0034] Figure 8 This is a diagram showing the effect of OTA nanoparticles prepared in Example 2 on mitochondrial membrane potential of glioma cells;

[0035] Fig. 9 This is a diagram showing the effect of OTA nanoparticles prepared in Example 2 on the release of mitochondrial DNA from glioma cells;

[0036] Fig.10 This is a diagram showing the effect of OTA nanoparticles prepared in Example 2 on the activation of inflammasomes in glioma cells;

[0037] Fig.11 This is a characterization diagram of OTA nanoparticles prepared in Example 2 inducing pyroptosis in glioma cells;

[0038] Fig.12 This is a characterization diagram of the OTA nanoparticles prepared in Example 2 targeting the TOM70 protein in mitochondria. DETAILED DESCRIPTION

[0039] The present invention provides an oleanolic acid derivative having a chemical structure shown in Formula 1:

[0040]

[0041] The present invention uses oleanolic acid as the parent core compound, introduces a 3-(dimethylamino)-1-propylamine segment through the carboxyl group of oleanolic acid, and the obtained oleanolic acid derivative has the function of targeting mitochondria, inducing the increase of reactive oxygen in tumor mitochondria, reducing mitochondrial membrane potential, leading to the release of mitochondrial DNA (mtDNA), and finally inducing tumor cell pyroptosis through inflammasomes.

[0042] The present invention provides a method for preparing the oleanolic acid derivative, comprising the following steps:

[0043] Oleanolic acid (OA), a condensation reagent, an organic solvent, an organic base and 3-(dimethylamino)-1-propylamine are mixed for condensation reaction to obtain an oleanolic acid derivative having a structure shown in formula 1.

[0044] In the present invention, unless otherwise specified, all preparation raw materials / components are commercially available products well known to those skilled in the art.

[0045] In the present invention, the condensation reagent includes 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDCI) and 1-hydroxybenzotriazole (HOBt). The organic solvent preferably includes dichloromethane. The organic base is preferably triethylamine. The molar ratio of the oleanolic acid to the 3-(dimethylamino)-1-propylamine is preferably 1 to 2:3, and in the embodiment it can be 2:3. The molar ratio of the EDCI to HOBt is preferably 1:1. The molar ratio of the oleanolic acid to the EDCI is preferably 2:3. The molar ratio of the oleanolic acid to the organic base is preferably 1:2 to 3, and in the embodiment it can also be 1:2. In the present invention, the mixing of oleanolic acid, condensation reagent, organic solvent, organic base and 3-(dimethylamino)-1-propylamine preferably comprises: dissolving the oleanolic acid and condensation reagent in an organic solvent to obtain a premixed solution; then mixing the premixed solution, organic base and 3-(dimethylamino)-1-propylamine to obtain a mixed solution. In the present invention, the mixed solution is preferably subjected to the condensation reaction in a protective gas atmosphere to obtain a condensation reaction liquid. The temperature of the condensation reaction is room temperature. The time of the condensation reaction is preferably 12 to 24 hours. The condensation reaction is carried out under stirring. The protective gas is preferably nitrogen.

[0046] After the condensation reaction is completed, a condensation reaction liquid is obtained; the present invention preferably further comprises: removing solvent from the condensation reaction liquid to obtain a crude condensation reaction product; purifying the crude condensation reaction product by silica gel column chromatography to obtain a pure product of the oleanolic acid derivative; the eluent used for the silica gel column chromatography purification is dichloromethane-methanol. In the present invention, the solvent removal method is preferably reduced pressure evaporation. The elution procedure of the silica gel column chromatography purification is preferably gradient elution, and the volume percentage of dichloromethane in the eluent is preferably changed from 5% to 20%. The pure product of the oleanolic acid derivative obtained by the present invention is a light yellow solid.

[0047] The preparation method of the oleanolic acid derivative provided by the invention is simple to operate, and the reaction raw materials are cheap and easily available.

[0048] The present invention provides a nano-micelle loaded with an oleanolic acid derivative, which is formed by cross-linking the oleanolic acid derivative described in the above technical solution or the oleanolic acid derivative prepared by the preparation method described in the above technical solution with oleanolic acid.

[0049] In the present invention, the OTA is insoluble in water, and OTA itself cannot form nanoparticles but will form gel. The present invention effectively promotes the formation of nanomicelles by compounding oleanolic acid derivatives with oleanolic acid through cross-linking.

[0050] In the present invention, the nanomicelles loaded with oleanolic acid derivatives are oil-in-water nanomicelles. The nanomicelles loaded with oleanolic acid derivatives are spherical in shape, and the average particle size is preferably 236.2±1.7 nm.

[0051] The nano micelles loaded with oleanolic acid derivatives provided by the present invention have the functions of inducing the increase of active oxygen in tumor mitochondria, reducing mitochondrial membrane potential, and causing the release of mitochondrial DNA, thereby causing pyroptosis of tumor cells and improving the anti-tumor efficacy.

[0052] The present invention provides a method for preparing nanomicelles loaded with oleanolic acid derivatives as described in the above technical solution, comprising the following steps:

[0053] mixing the oleanolic acid derivative, oleanolic acid and an organic solvent to obtain a mixed organic solution;

[0054] The mixed organic solution and the dispersant aqueous solution are mixed and emulsified to obtain the nano micelles loaded with the oleanolic acid derivative.

[0055] The present invention mixes the oleanolic acid derivative, oleanolic acid and an organic solvent to obtain a mixed organic solution. In the present invention, the mass ratio of the oleanolic acid derivative and oleanolic acid is preferably ≤1:1, and can be 1:1 in the embodiment. The organic solvent is preferably a mixed solvent of dichloromethane and methanol, and the volume ratio of dichloromethane and methanol in the mixed solvent of dichloromethane and methanol is preferably 9:1. In the mixed organic solution, the mass concentration of the oleanolic acid derivative is preferably 5 mg / mL.

[0056] After obtaining the mixed organic solution, the present invention mixes the mixed organic solution and the dispersant aqueous solution for emulsification to obtain the nanomicelles loaded with oleanolic acid derivatives. In the present invention, the dispersant is preferably polyvinyl alcohol (PVA). The emulsification preferably includes the following steps: dropping the mixed organic solution into the first dispersant aqueous solution for the first emulsification to obtain the first emulsion; dropping the first emulsion into the second dispersant aqueous solution for the second emulsification to obtain the second emulsion. After obtaining the second emulsion, the present invention preferably also includes: removing the organic solvent from the second emulsion and performing solid-liquid separation to obtain a crude product; washing the crude product with water and resuspending it in a buffer solution. The mass percentage of polyvinyl alcohol (PVA) in the first dispersant aqueous solution is preferably 2.5%. The first emulsification is preferably carried out under ultrasonic conditions. The mass percentage of polyvinyl alcohol (PVA) in the second dispersant aqueous solution is preferably 0.3%. The volume ratio of the first dispersant aqueous solution to the second dispersant aqueous solution is preferably 2:35. The second emulsification is preferably under stirring conditions. The method for removing the organic solvent is preferably evaporation, the solid-liquid separation is preferably centrifugal separation, the temperature of the centrifugal separation is preferably 1 to 4°C, and the speed is preferably 15000 to 18000 rpm. The time of the centrifugal separation is preferably 25 minutes. The water washing is preferably deionized water washing. The buffer solution is preferably phosphate buffered saline (PBS).

[0057] The present invention provides the use of the oleanolic acid derivatives and their medically acceptable salts described in the above technical scheme, or the oleanolic acid derivatives prepared by the preparation method described in the above technical scheme, or the nanomicelles loaded with oleanolic acid derivatives described in the above technical scheme, or the nanomicelles loaded with oleanolic acid derivatives prepared by the preparation method described in the above technical scheme in the preparation of anti-tumor drugs.

[0058] In the present invention, the anti-tumor drug preferably includes an anti-glioma drug, an anti-breast cancer drug or an anti-lung cancer drug.

[0059] The present invention provides an anti-tumor drug composition, comprising a pharmaceutically active component and an excipient; the pharmaceutically active component comprises the oleanolic acid derivative and its medically acceptable salt described in the above technical solution or the oleanolic acid derivative prepared by the preparation method described in the above technical solution or the nano-micelle loaded with the oleanolic acid derivative described in the above technical solution or the nano-micelle loaded with the oleanolic acid derivative prepared by the preparation method described in the above technical solution. In the present invention, the excipient is a pharmaceutically acceptable excipient.

[0060] In order to further illustrate the present invention, the technical solutions provided by the present invention are described in detail below in conjunction with embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0061] Example 1

[0062] The present invention provides a method for preparing an oleanolic acid derivative OTA, which specifically comprises the following steps:

[0063] OA (2mmol), EDCI (3mmol) and HOBt (3mmol) were dissolved in dry dichloromethane (10mL), and triethylamine (4mmol) and 3-(dimethylamino)-1-propylamine (3mmol) were added. Nitrogen was replaced and stirred at room temperature overnight. The solvent was evaporated under reduced pressure and purified by silica gel column chromatography (DCM-MeOH gradient elution, the volume concentration of DCM varied from 5 to 20%) to obtain a light yellow solid OTA (580mg). The structure of OTA was identified by 1H NMR (400MHz, DMSO-d6), 1H-1H COSY and high-resolution liquid chromatography-mass spectrometry.

[0064] The product prepared in Example 1 was characterized by NMR, mass spectrometry and HPLC:

[0065] Figure 1 The oleanolic acid derivative OTA prepared in Example 1 1 HNMR spectrum.

[0066] Figure 2 The oleanolic acid derivative OTA prepared in Example 1 1 H- 1 H COSY plot.

[0067] Figure 3 This is the MS chromatogram of the LC-MS / MS analysis of the oleanolic acid derivative OTA prepared in Example 1.

[0068] Figure 4 This is the MS spectrum of the oleanolic acid derivative OTA prepared in Example 1.

[0069] Example 2

[0070] This embodiment provides a method for preparing nano micelles loaded with oleanolic acid derivatives (referred to as OTA nanoparticles, OTA NPs). This embodiment uses a single emulsion method to prepare OTA nanoparticles, which specifically includes the following steps:

[0071] OTA:OA (mass ratio 1:1, 5mg, 5mg) was dissolved in 1mL dichloromethane / methanol (v:v=9 / 1), and then the solution was added dropwise to 2mL 2.5% PVA (polyvinyl alcohol) solution, ultrasonic emulsification, and then the mixture was added dropwise to 35mL 0.3wt% PVA and stirred for 4 hours to evaporate the solvent. OTA nanoparticles were collected by centrifugation at 4°C, 18000rpm, 25min, and then washed 3 times with deionized water, and finally the OTA nanoparticles were resuspended in PBS. The particle morphology was observed by scanning electron microscopy, and the particle size and surface potential were measured by Malvern particle size analyzer.

[0072] Figure 5 This is a characterization diagram of OTA nanoparticles prepared in Example 2. Figure 5 A in the figure is the scanning electron microscope image of OTA nanoparticles. Figure 5 B in the figure is the particle size of OTA nanoparticles measured by Malvern particle size analyzer; Figure 5 C in the figure is the surface potential of OTA nanoparticles measured by Malvern particle size analyzer. Figure 5 From A in Example 2, we can see that the OTA nanoparticles prepared in Example 2 are nanospheres with uniform diameter distribution. Figure 5 From B in the figure, it can be seen that the average particle size of the OTA nanoparticles prepared in Example 2 is 236.2±1.7nm. Figure 5 It can be seen from C in that the surface potential of the OTA nanoparticles prepared in Example 2 is positive.

[0073] Comparative Example 1

[0074] This comparative example provides a method for preparing OA nanoparticles (OANPs). This example uses a single emulsion method to prepare OA nanoparticles, which specifically includes the following steps:

[0075] OA (10 mg) was dissolved in 1 mL of dichloromethane / methanol (v:v=9 / 1), and then the solution was added dropwise to 2 mL of 2.5% PVA (polyvinyl alcohol) solution, ultrasonically emulsified, and then the mixture was added dropwise to 35 mL of 0.3 wt% PVA and stirred for 4 hours to evaporate the solvent. OA nanoparticles were collected by centrifugation at 4°C, 18000 rpm, 25 min, and then washed 3 times with deionized water, and finally the OA nanoparticles were resuspended in PBS.

[0076] Example 3

[0077] This example provides a co-localization test of OTA prepared in Example 1 in glioma cell mitochondria:

[0078] To detect the localization of compound OTA in cell mitochondria, GL261 in the logarithmic growth phase was digested and counted, and 5×10 4The cells were placed in an incubator overnight to adhere to the wall, and OTA nanoparticles encapsulated with coumarin 6 were added and incubated for 12 hours. Then, a certain concentration of Mito-Tracker Deep RedFM (molecular formula C 34 H 36 Cl2N2, molecular weight of 543.58, Mito-Tracker Deep RedFM is a far-infrared fluorescent probe) and incubated for 30 minutes. The culture medium was aspirated, washed 3 times with PBS, and then 1 mL of 4wt% paraformaldehyde was added to fix the cells for 10 minutes, washed 3 times with PBS, and finally 1 mL of nucleic acid dye Hoechst 33342 was added, stained for 10 minutes, washed 3 times with PBS, and observed under a laser confocal microscope. The control group used in this example was OA nanoparticles encapsulating coumarin 6.

[0079] The preparation method of OTA nanoparticles encapsulating coumarin 6 in this embodiment includes: coumarin 6 (C6) is dissolved in an organic solvent (dichloromethane) and configured into a 1mg / ml C6 solution. In order to synthesize nanoparticles encapsulating C6, a mixture of OTA:OA (mass ratio 1:1, 5mg, 5mg) is dissolved in 1mL dichloromethane / methanol (volume ratio 9:1), 50-100uL 1mg / mL C6 solution is added, and 2mL 2.5% polyvinyl alcohol (PVA) is added dropwise after mixing. After ultrasonic treatment on ice for 40 seconds (5 seconds open, 5 seconds closed cycle), the emulsion is added to 35mL 0.3% PVA solution. Next, the solution is placed at 4°C, stirred and evaporated overnight. Then the nanoparticles are collected by centrifugation at 18000rpm for 25 minutes at 4°C, then washed 3 times with deionized water, and the collected nanoparticles are dissolved in a certain amount of PBS to obtain OTA nanoparticles encapsulating coumarin 6.

[0080] The preparation method of OA nanoparticles encapsulating coumarin 6 (control group) in this example is basically the same as the preparation method of OTA nanoparticles encapsulating coumarin 6 described above, except that OTA:OA (mass ratio 1:1, 5 mg, 5 mg) is replaced by 10 mg OA.

[0081] Figure 6 The localization of OTA in mitochondria of glioma cells in Example 3. Figure 6 It can be seen that OTA nanoparticles encapsulating coumarin 6 can be well localized in mitochondria, while the control group is not localized in mitochondria.

[0082] Example 4

[0083] This example provides a test on the killing ability of OTA nanoparticles prepared in Example 2 on glioma cells:

[0084] In order to detect the killing ability of OTA nanoparticles on glioma cells, 200 μL of cell suspension (5×10 4 ), pre-culture the culture plate in an incubator for 24 hours. Add different concentrations of drugs to the wells of the culture plate for treatment. Incubate the culture plate in an incubator for 72 hours, and add 10 μL of CCK-8 solution to each well (be careful not to generate bubbles in the wells, as they will affect the OD value reading). Incubate the culture plate in the incubator for 2 hours, and measure the absorbance at 450nm with a microplate reader. In order to test the killing ability of OTA nanoparticles, three types of glioma cells were used, GL261, PS30 and U87MG, Figure 7 This is a characterization diagram of the killing ability of OTA nanoparticles on tumor cells. Figure 7 It is shown that the OTA nanoparticles prepared in Example 2 have greatly enhanced tumor-killing ability. Figure 7 The control group is OA nanoparticles prepared in Comparative Example 1.

[0085] Example 5

[0086] This example provides a test of the effect of OTA nanoparticles on mitochondrial membrane potential of glioma cells:

[0087] In order to detect the effect of OTA nanoparticles prepared in Example 2 on the mitochondrial membrane potential of glioma cells, JC-1 staining was used for detection. 200 μL of cell suspension (1×10 4 ), and the culture plate was pre-cultured in an incubator for 24 hours. Different concentrations of drugs were added to the wells of the culture plate for treatment. The culture plate was incubated in an incubator for 72 hours, and 5 μM JC-1 solution was added to each well. After incubation for 20 minutes, it was washed once with PBS and detected by Spectramax M5 microplate reader. The excitation / emission of JC-1 monomers was 488 / 545nm, and the excitation / emission of aggregates was 530 / 590nm. Images were acquired using a fluorescence microscope (Keyence BZ series, USA). Figure 8 This is a diagram showing the effect of OTA nanoparticles on mitochondrial membrane potential of glioma cells in Example 5; the results show that compared with the control group, an increase in JC-1 monomers and a decrease in JC-1 aggregates were observed after treatment with OTA nanoparticles, indicating that OTA nanoparticles effectively induced a decrease in mitochondrial membrane potential. Figure 8 The control group is OA nanoparticles prepared in Comparative Example 1.

[0088] Example 6

[0089] This example provides a test of the effect of OTA nanoparticles prepared in Example 2 on the release of mitochondrial DNA from glioma cells:

[0090] In order to detect the effect of OTA nanoparticles prepared in Example 2 on the release of mitochondrial DNA (mtDNA) in glioma, GL261 in the logarithmic growth phase was digested and counted, and 5×10 4 The cells were placed in an incubator overnight to adhere to the wall, OTA nanoparticles were added, and incubated for 12 hours. Then a certain concentration of Mito-Tracker Deep Red FM (molecular formula C 34 H 36 Cl2N2, molecular weight of 543.58, Mito-TrackerDeep RedFM is a far-infrared fluorescent probe, maximum excitation wavelength of 644nm, maximum emission wavelength of 665nm), and incubate with Picogreen for 30 minutes. Aspirate the culture medium, wash 3 times with PBS, then add 1mL 4% paraformaldehyde to fix the cells for 10 minutes, wash 3 times with PBS, and finally add 1mL of nucleic acid dye Hoechst 33342, stain for 10 minutes, wash 3 times with PBS, and observe under a laser confocal microscope. Fig. 9 The effect of OTA nanoparticles on the release of mitochondrial DNA from glioma cells provided in Example 6 is shown in FIG. Fig. 9 As shown in A, after OTA nanoparticle treatment, the mtDNA outside the mitochondria of the cells can be clearly stained, while the control group is not obvious. Next, quantitative PCR was used to quantitatively analyze the mtDNA in the cytoplasm. The specific steps are as follows: 1×10 6 Cells were seeded into each well of a 6-well plate and treated with OA NPs or OTA NPs. After 24 hours, the cells were washed with PBS. Next, 1% NP-40 (100 μL) was added to each well and the cells were collected by scraping. The cell lysate was then transferred to a pre-labeled microcentrifuge tube and incubated on ice for 15 minutes, followed by centrifugation at 13,000 rpm for 15 minutes at 4°C. The supernatant was collected. Cytoplasmic mitochondrial DNA was extracted from the supernatant using the DNeasy Blood and Tissue Kit (QIAGEN, #69504) and quantified by quantitative PCR using the CFX96 Real-Time System (Bio-Rad). Relative expression was calculated by 2-ΔΔCT. Primers include: 16SF, 16SR, ND1F, and ND1R.

[0091] The nucleotide sequence of 16SF is shown in SEQ ID NO.1;

[0092] The SEQ ID NO.1 is: CCGCGAAGGGAAAGATGAAAGAC;

[0093] The nucleotide sequence of 16SR is shown in SEQ ID NO.2;

[0094] The SEQ ID NO.2 is: TCGTTGGTTTCGGGGTTTC;

[0095] The nucleotide sequence of ND1F is shown in SEQ ID NO.3;

[0096] The SEQ ID NO.3 is: CTGAGAAAAACCGGGC;

[0097] The nucleotide sequence of ND1R is shown in SEQ ID NO.4;

[0098] The SEQ ID NO.4 is: CCGCTGCGTATTCTACGTT.

[0099] from Fig. 9 As can be seen from Figure B, after OTA nanoparticle treatment, the mitochondrial DNA content in the cytoplasm was significantly higher than that in the control group, indicating that OTA nanoparticle treatment promoted the release of mtDNA. Fig. 9 The control group is OA nanoparticles prepared in Comparative Example 1.

[0100] Example 7

[0101] This example provides a test of the effect of OTA nanoparticles on the activation of glioma cell inflammasomes:

[0102] In order to detect whether the mtDNA released by OTA nanoparticles can activate inflammasomes, the present invention observed by immunofluorescence chemical staining. GL261 in the logarithmic growth phase were digested and counted, and 5×10 4 Cells were placed in an incubator overnight to adhere to the wall, and OTA nanoparticles were incubated for 12 hours. The culture medium was aspirated, and 1 mL of 4% paraformaldehyde was added to fix the cells for 10 minutes. The cells were washed 3 times with PBS, and the primary antibody (diluted with 1% BSA) was added and placed in a wet box at 4°C overnight; PBS was washed 3 times, 5 minutes each time. The secondary antibody (diluted with 1% BSA) was added and incubated for 30 minutes, and the light was turned off; PBS was washed 3 times, 5 minutes each time. Picogreen was added and incubated for 30 minutes. In the last 10 minutes, the nucleic acid dye Hoechst 33342 was added, and the cells were washed 3 times with PBS and observed under a laser confocal microscope. Fig.10 The results of the effect of OTA nanoparticles on the activation of inflammasomes in glioma cells in Example 7 are shown in FIG. Fig.10 It can be seen that after OTA nanoparticle treatment, melanoma deficiency factor 2 (AIM2 for short), mtDNA and ASC can be well positioned together, indicating that inflammasomes are formed after OTA nanoparticle treatment.

[0103] Example 8

[0104] This example provides a test on the pyroptosis of glioma cells induced by OTA nanoparticles:

[0105] Microscopic observation revealed that OTA nanoparticles can cause tumor cells to swell and expand after treatment, and there are many bubble-like protrusions, which is similar to the phenotype caused by pyroptosis, so the western-blot method was used for detection. Cells in the logarithmic growth phase were added to a 6-well plate and adhered overnight. Then different concentrations of OTA nanoparticles and control particles were added. After treatment for 12 hours, the cells were collected by centrifugation, washed with PBS to remove the blood in the residual culture medium, and RIPA strong lysis buffer containing PMSF was added for 20 minutes of whole cell lysis. During this process, a low temperature environment of 4°C was maintained to ensure protein invariance. After the end, centrifugation was performed at 14000rpm for 20 minutes under low temperature conditions, and the supernatant obtained by centrifugation was the cell whole protein sample required for the experiment. After the protein concentration in the above protein sample was determined by the BCA protein content detection kit, the expression content of different proteins in the sample was detected by SDS-PAGE gel electrophoresis. After the gel was prepared, the same volume of protein sample was added to each well for gel electrophoresis experiment, and the electrophoresis was stopped immediately after appropriate separation. Use the wet method to transfer the target protein to the PVDF membrane. After completion, place the membrane in a solution containing 5% skim milk powder for blocking for 2 hours. Dilute the primary antibody with skim milk powder in the corresponding proportion according to the instructions for use of the antibody, and place the blocked membrane in the primary antibody incubation solution at 4°C overnight to allow it to specifically bind to the target protein. After completion, wash it three times with PBST. Place the washed membrane in the pre-prepared secondary antibody incubation solution and incubate it for a period of time to allow it to bind to the primary antibody, and then wash it with PBST. Prepare an equal volume of ECL developer, cover it on the PVDF membrane, and use a chemiluminescence imaging system after 2 minutes of treatment. The structure of OTA nanoparticles inducing tumor cell pyroptosis is shown in the figure. Fig.11 As shown, the results showed that after OTA nanoparticle treatment, Caspse3 and Caspse8 were activated, and finally cleaved GSDME, leading to cell pyroptosis. It proves that OTA nanoparticles can induce pyroptosis in glioma cells.

[0106] Example 9

[0107] This example provides a test of OTA nanoparticles targeting mitochondrial TOM70 protein:

[0108] In order to detect which protein of the mitochondrial membrane the OTA nanoparticles act on, the present invention uses the IP method for detection. First, the cells are collected and lysed with RIPA. After the lysis, they are centrifuged at 14000 rpm for 20 minutes under low temperature conditions. The supernatant obtained by centrifugation is the cell whole protein sample required for the experiment. Then the OTA nanoparticles prepared in Example 2 and the OA nanoparticles prepared in Comparative Example 1 are added, incubated at 4°C overnight, centrifuged at 800rpm for 20 minutes to collect the nanoparticles, washed three times with PBS, added with loading buffer, boiled at 100°C for 5 minutes, and detected by western-blot. The results are as follows Fig.12 As shown in A, the results showed that only OTA nanoparticles bound to TOM70, proving that OTA nanoparticles targeted the TOM70 protein on the mitochondrial membrane.

[0109] The results were further verified using thermal proteomics analysis technology. First, the cells were collected and lysed with RIPA. After the cells were centrifuged at 14,000 rpm for 20 minutes under low temperature conditions, the supernatant obtained by centrifugation was the total cell protein sample required for the experiment. After the protein concentration in the above protein sample was determined by the BCA protein content detection kit, the protein sample was diluted to 2 mg / mL and then divided into two parts. Each aliquot was mixed with a lysis buffer containing OA NP (control group) or OTA NP in a 1:1 ratio. The reactants were incubated at room temperature for 15 minutes while shaking gently. Then, the solution was divided into seven equal parts and heated in a thermal cycler at 37°C, 45°C, 49°C, 56°C, 58°C, 64°C, and 68°C for 3 minutes. After heating, the samples were equilibrated at room temperature for 5 minutes. The precipitated protein was removed by centrifugation at 21,000 × g for 30 minutes. The soluble fractions were collected and detected by western-blot. The results are as follows Fig.12 As shown in B, the addition of OTA nanoparticles can enhance the stability of TOM70, indicating that OTA nanoparticles interact with TOM70 and are its target protein. Fig.12 The control group is OA nanoparticles prepared in Comparative Example 1.

[0110] From the above examples, it can be seen that the present invention provides an oleanolic acid derivative (OTA) having a chemical structure shown in Formula 1. The present invention selects oleanolic acid (OA) as the parent core compound. Oleanolic acid is a pentacyclic triterpenoid compound, which is widely present in various plants and foods such as apple epidermis, papaya fruit, persimmon fruit, plum, loquat, soybean, etc. The present invention introduces a 3-(dimethylamino)-1-propylamine segment through the carboxyl group of oleanolic acid, and the obtained oleanolic acid derivative has the function of targeting mitochondria. The oleanolic acid derivative provided by the present invention can target tumor cells and mitochondria in tumor cells, induce an increase in reactive oxygen species in tumor mitochondria, reduce mitochondrial membrane potential, lead to mitochondrial DNA (mtDNA) release, and finally induce tumor cell pyroptosis through inflammasomes, thereby effectively improving the anti-tumor efficacy. In summary, the preparation raw materials of the oleanolic acid derivatives of the structure shown in Formula 1 provided by the present invention are widely available, and the killing of tumor cells is achieved, and the anti-tumor efficacy is good.

[0111] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. Other embodiments can be obtained based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An oleanolic acid derivative, characterized in that It has the chemical structure shown in Formula 1:

2. The method for preparing an oleanolic acid derivative according to claim 1, characterized in that: The following steps are involved: Oleanolic acid, a condensation reagent, an organic solvent, an organic base and 3-(dimethylamino)-1-propylamine are mixed for condensation reaction to obtain an oleanolic acid derivative having a structure shown in formula 1.

3. The preparation method according to claim 1, characterized in that: The molar ratio of the oleanolic acid to the 3-(dimethylamino)-1-propylamine is 1 to 2:3; The condensation reagent includes 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and 1-hydroxybenzotriazole; the molar ratio of the 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride to the 1-hydroxybenzotriazole is 1:1; The organic base is triethylamine; the molar ratio of the oleanolic acid to the organic base is 1:2-3.

4. The preparation method according to claim 2 or 3, characterized in that: The temperature of the condensation reaction is room temperature; After the condensation reaction is completed, a condensation reaction liquid is obtained; the method further comprises: removing solvent from the condensation reaction liquid to obtain a crude condensation reaction product; purifying the crude condensation reaction product by silica gel column chromatography to obtain a pure product of the oleanolic acid derivative; the eluent used for the silica gel column chromatography purification is dichloromethane-methanol.

5. A nanomicelle loaded with an oleanolic acid derivative, characterized in that: The oleanolic acid derivative according to claim 1 or the oleanolic acid derivative prepared by the preparation method according to any one of claims 2 to 4 is cross-linked with oleanolic acid.

6. The method for preparing the nanomicelles loaded with oleanolic acid derivatives according to claim 5, characterized in that: The following steps are involved: mixing the oleanolic acid derivative, oleanolic acid and an organic solvent to obtain a mixed organic solution; The mixed organic solution and the dispersant aqueous solution are mixed and emulsified to obtain the nano micelles loaded with the oleanolic acid derivative.

7. The preparation method according to claim 6, characterized in that: The mass ratio of the oleanolic acid derivative to oleanolic acid is ≤1:

1.

8. Use of the oleanolic acid derivative and its medically acceptable salt according to claim 1, or the oleanolic acid derivative prepared by the preparation method according to any one of claims 2 to 4, or the nanomicelles loaded with oleanolic acid derivatives according to claim 5, or the nanomicelles loaded with oleanolic acid derivatives prepared by the preparation method according to claim 6 or 7 in the preparation of antitumor drugs.

9. The use according to claim 8, characterized in that: The anti-tumor drugs include anti-glioma drugs, anti-breast cancer drugs or anti-lung cancer drugs.

10. An anti-tumor pharmaceutical composition, characterized in that: The invention comprises active pharmaceutical ingredients and auxiliary materials; the active pharmaceutical ingredients comprise the oleanolic acid derivative and its medically acceptable salt as described in claim 1, or the oleanolic acid derivative prepared by the preparation method as described in any one of claims 2 to 4, or the nanomicelle loaded with oleanolic acid derivative as described in claim 5, or the nanomicelle loaded with oleanolic acid derivative prepared by the preparation method as described in claim 6 or 7.

Images