Application of sialic acid in the preparation of anti-cell aging products

Abstract

The present invention relates to an application of sialic acid in the preparation of anti-cell aging products, wherein sialic acid can activate the transcriptional activity of SIRT1 and SIRT5, can be used as a SIRT activator, and affect the expression of anti-cell aging genes. Experiments have confirmed that sialic acid can delay cell aging and significantly inhibit the expression of galactosidase in aging cells, has anti-cell aging efficacy, and can be used to prepare anti-cell aging products.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more specifically to an application of sialic acid in the preparation of anti-cell aging products. Background Art

[0002] Cell aging (also called cellular senescence) is a process in which cells gradually lose their ability to divide and eventually enter a state of permanent growth stagnation. This process is closely related to the occurrence and development of many diseases. For example, the impaired function of aging endothelial cells may lead to vascular sclerosis, high blood pressure and heart disease. In addition, the accumulation of aging cells will also affect the repair and regeneration ability of blood vessels; the aging of brain cells is related to neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease; the aging of bone cells can lead to osteopenia and osteoporosis, increasing the risk of fractures; in addition, cellular aging may lead to insulin resistance and decreased pancreatic beta cell function, thereby increasing the risk of type 2 diabetes.

[0003] Fibroblasts are the most common cell type in connective tissue, and they are found in blood vessel walls, bones, and joints. The aging of fibroblasts has many effects on the body. For example, the aging of fibroblasts may cause thinning of blood vessel walls, reduced elasticity, and increase the risk of cardiovascular disease. It may also lead to slow healing of skin wounds and low repair efficiency after tissue damage. It may even lead to abnormal structure and function of tissues, such as vascular sclerosis, decreased bone density, and joint diseases such as joint stiffness. It can be seen that the aging of fibroblasts has a profound impact on multiple systems and organs of the body, which can easily lead to decreased tissue function and increase the risk of various geriatric diseases.

[0004] Sirtuins (silent information regulator-related enzymes) are a class of NAD (nicotinic acid adenine dinucleotide)-dependent deacetylases that play an important role in the regulation of cell aging. In the human body, there are multiple subtypes of Sirtuins, such as SIRT1-SIRT7, each with different focuses and scenarios of action. For example, SIRT1 can activate some anti-aging-related genes through deacetylation and inhibit the expression of genes related to aging. It is considered to be a protein related to longevity. SIRT1 is involved in regulating a wide range of physiological processes, including inflammation, apoptosis, cell senescence, longevity, sugar homeostasis, aging, etc. SIRT3, SIRT4 and SIRT5 are mainly located in mitochondria, and they may affect the process of cell aging by participating in the regulation of mitochondrial metabolism and stress response. Sirtuins are considered to be potential targets for delaying cell aging and treating aging-related diseases. By activating Sirtuins or developing their activators, it may help slow down the aging process and improve aging-related disease states. For example, patent JP5930784B2 provides a natural compound 1'-acetoxychavicol acetate (ACA) extracted from ginger as a sirt gene activator; CN 113768959B provides a solvent extract of the plant body of Peucedanum japonicum Thunb. that can activate Sirtuin-1 and inhibit cell aging caused by oxidative stress.

[0005] Sialic acid (SA), also known as N-acetylneuraminic acid (N-acetylneuraminic acid, Neu5Ac) and sialic acid, is an acetylated derivative of acidic glycosylneuraminic acid. It is widely present in mammalian tissues and is a component of the oligosaccharide chains of mucins, glycoproteins and glycolipids. It is essential for the development and function of the nervous system and has the effects of regulating innate immune function and whitening. However, there is currently no evidence or public information revealing that sialic acid can act as a Sirtuins activator. Therefore, studying the effects of sialic acid on the expression of Sirtuins-related genes will help to explore more application scenarios, especially its application in delaying cell aging will help delay the aging process and prevent aging-related diseases. Summary of the invention

[0006] In view of the above defects or improvement needs of the prior art, the present invention provides an application of sialic acid in the preparation of anti-cell aging products, with the aim of discovering that sialic acid can activate SIRT1 and SIRT5, can act as a Sirtuins activator, delay cell aging by inhibiting the expression of galactosidase, and can be used to prepare anti-cell aging products, thereby solving the technical problem of the lack of application of sialic acid in anti-cell aging.

[0007] To achieve the above object, according to one aspect of the present invention, there is provided a use of sialic acid in the preparation of an anti-cell aging product.

[0008] Preferably, in the application, the anti-cell aging is to activate silent information regulatory factors or enhance the expression of silent information regulatory factors.

[0009] Preferably, in the application, the silent information regulator is SIRT1 and / or SIRT5.

[0010] Preferably, in the application, the silent information regulators are SIRT1 and SIRT5.

[0011] Preferably, in the application, the anti-cell aging product is used to promote cell resumption of division and growth and / or reduce the expression of β-galactosidase.

[0012] Preferably, in the application, the anti-cell aging product is used to reduce the expression level of β-galactosidase in aging cells.

[0013] Preferably, the use, wherein the anti-cell aging product includes a product for preparing a product for preventing age-related diseases related to cell aging.

[0014] Preferably, in the application, the cell aging-related geriatric diseases include cardiovascular diseases, bone and joint diseases, and chronic inflammation.

[0015] Preferably, the product in the application comprises one or more of cosmetics, foods or medicines for resisting cell aging.

[0016] Preferably, in the application, the product is in the form of one or more of aqueous solution, emulsion, cream, gel, powder, block, pill or oil.

[0017] In general, the above technical solutions conceived by the present invention can achieve the following beneficial effects compared with the prior art:

[0018] Since the present invention discovered that sialic acid can activate the transcriptional activity of SIRT1 and SIRT5, it can be used as a SIRT activator, and SIRT1 activation can affect the expression of genes related to anti-aging. Experiments have confirmed that sialic acid can significantly inhibit the expression of galactosidase in aging cells, delay cell aging, and promote cell resumption of division and growth. It has significant anti-cell aging effects and can be used to prepare anti-cell aging products, which is of great significance for delaying the aging process and preventing aging-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is sialic acid that activates SIRT1;

[0020] Figure 2 It is sialic acid that activates SIRT5;

[0021] Figure 3 is the effect of sialic acid on the cell growth curve;

[0022] Figure 4 It is the inhibition of sialic acid on galactosidase expression in aged cells. DETAILED DESCRIPTION

[0023] In order to further explain the technical means and effects adopted by the present invention to achieve the predetermined invention purpose, the specific implementation mode, structure, characteristics and effects of the present invention are described in detail below in combination with the accompanying drawings and preferred embodiments.

[0024] Sirtuins (SIRTs) are a class of nicotinamide adenine dinucleotide (NAD+)-dependent protein deacetylases, which are functionally similar to yeast silent information regulator 2 (Sir2) and contain seven Sir2 homologous proteins (SIRT1-7) in mammals. Studies have shown that SIRTs can not only deacetylate histones, but also deacetylate non-histones. In addition, SIRTs can hydrolyze many acyl groups, such as demalonylation, desuccinylation, demyristoylation and other modifications, to regulate protein post-translational modifications. Since SIRTs can target histones and non-histones, they can not only participate in gene expression and DNA repair, but also participate in immune, inflammatory and metabolic regulation. Different SIRTs have different subcellular localizations and functions. Among them, SIRT1 can activate some anti-aging-related genes through deacetylation and inhibit the expression of genes related to aging. SIRT1 activation can delay cell aging.

[0025] The present invention cultured fibroblasts by adding sialic acid, and the results showed that sialic acid can activate SIRT1 and SIRT5, and can be used as a SIRT activator, and SIRT1 activation can delay cell aging, indicating that sialic acid may have the effect of delaying cell aging. In the process of cell aging, the activity of galactosidase usually increases, and the activity of galactosidase is usually regarded as a biomarker of cell aging. Further, based on the cell aging model, the effect of sialic acid on the expression of galactosidase in aged cells was studied. The results showed that compared with normal cells, the expression of galactosidase in aged cells increased significantly, and the addition of sialic acid to aged cells significantly reduced the expression of galactosidase, and promoted the resumption of cell division and growth, confirming that sialic acid has the effect of anti-cell aging, and can be used to prepare anti-cell aging products.

[0026] Based on this, the present invention provides an application of sialic acid in the preparation of anti-cell aging products.

[0027] The anti-cell aging is to activate the silent information regulatory factor or enhance the expression of the silent information regulatory factor.

[0028] The silent information regulator is SIRT1 and / or SIRT5; in some embodiments, the anti-cellular aging preparation is used to activate or enhance the expression of SIRT1 and SIRT5.

[0029] The anti-cell aging product is used to promote cell recovery division and growth and / or reduce the expression of β-galactosidase. In some embodiments, the product is used to reduce the expression of β-galactosidase in aged fibroblasts.

[0030] The aging of fibroblasts has many effects on the body. For example, the extracellular matrix components produced by aging fibroblasts change, which may lead to abnormal tissue structure and function, such as joint stiffness, vascular sclerosis, cardiovascular disease, bone and joint diseases, etc. In addition, aging fibroblasts may release more inflammatory factors, leading to a chronic inflammatory state, which is related to the occurrence of a variety of geriatric diseases.

[0031] The anti-cell aging products in the present invention include products for preventing cell aging-related elderly diseases, and the cell aging-related elderly diseases include cardiovascular diseases, bone and joint diseases, and chronic inflammation.

[0032] In the present invention, the product comprises one or more of cosmetics, food or medicine for resisting cell aging.

[0033] The product may be in the form of one or more of liquid, emulsion, cream, powder, block or oil.

[0034] The following are examples

[0035] Example 1 Effect of sialic acid on SIRTs gene expression

[0036] 1.1 Cell culture

[0037] (1) Cell selection: humanized fibroblasts HFF-1, SCSP-109; Fibroblasts are one of the most common cell types in connective tissue and are widely distributed in tissues such as skin, bones, muscles, internal organs, and blood vessels.

[0038] (2) Cell culture: In order to explore the effect of N-acetylneuraminic acid (sialic acid, SA) on SIRTs gene expression, HFF-1 cells were cultured with DMEM complete medium (89% DMEM basal medium + 10% fetal bovine serum + 1% double antibody) plus 0.5% SA (cytotoxicity test, the proposed addition of 0.5% SA had no toxic effect on cells), and HFF-1 cells treated with SA were obtained. The specific method is as follows:

[0039] ① Cell recovery: Take out the frozen HFF-1 cells from liquid nitrogen, put them in a 37℃ water bath for quick dissolution, centrifuge at 1200rpm for 5min, discard the supernatant, add 1mL of culture medium, blow gently, and then add to the cell bottle containing 4mL of DMEM complete culture medium. Transfer the cells to a 37℃, 5% CO2 incubator for culture.

[0040] ②Cell passage: Select HFF-1 cells with a growth density of about 80%, discard the old culture medium, add 1-2mL sterile PBS solution, gently rinse 3 times, and then aspirate the PBS in the cell bottle; add 1mL of trypsin digestion solution containing 0.25% EDTA to cover the cells, place the cell bottle in a 37℃, 5% CO2 incubator for digestion for 2-3 minutes, observe the cells under an inverted microscope, and when most of the cells shrink and are in a semi-detached state, add an equal volume of DMEM complete culture medium to terminate the digestion; gently blow the cells to make a cell suspension and transfer it to a 1.5mL centrifuge tube, centrifuge at room temperature, 1300rpm for 5 minutes, and discard the supernatant. Add DMEM complete culture medium to resuspend the cells, divide the cell suspension into two, transfer it to a new cell bottle and add DMEM complete culture medium to 5mL.

[0041] ③Cell plating: When the growth density of HFF-1 cells in the cell bottle is about 80%, discard the old culture medium, add 1-2mL sterile PBS solution, gently rinse 3 times, and then aspirate the PBS in the cell bottle; add 1mL of trypsin digestion solution containing 0.25% EDTA to cover the cells, place the cell bottle in a 37℃, 5% CO2 incubator for digestion for 2-3min, observe the cells under an inverted microscope, and when most of the cells shrink and are in a semi-detached state, add an equal volume of DMEM complete culture medium to terminate the digestion; gently blow the cells to make a cell suspension and transfer them to a 1.5mL centrifuge tube, centrifuge at room temperature, 1300rpm for 5min, and discard the supernatant; gently resuspend with 12mL DMEM complete culture medium, add 2mL of cell suspension to each well, shake gently to evenly move to the incubator.

[0042] ④ Cell drug administration and culture: When the growth density of HFF-1 cells in the well plate reaches about 80%, the experiment is divided into two groups. The control group is replaced with fresh DMEM complete medium without drug addition; the experimental treatment group is added with SA diluted with DMEM complete medium with a final concentration of 0.5%. The cells are placed in a 37°C, 5% CO2 incubator for 24 hours.

[0043] 1.2 RNA extraction

[0044] (1) Discard the culture medium, rinse each well three times with PBS, and aspirate dry;

[0045] (2) Add 300 μL Trizol to each well to lyse the cells, pipette and transfer to a 1.5 mL RNase-free EP tube, add 100 μL chloroform, mix by inversion for 15 seconds, and leave at room temperature for 5 minutes;

[0046] (3) After centrifugation at 4°C, 12,000 rpm for 15 min, the upper aqueous phase was aspirated, the volume was recorded, and the supernatant was transferred to a new RNase-free EP tube;

[0047] (4) Add isopropanol in a volume close to that of the supernatant, gently invert upside down to mix, and leave at room temperature for 10 min;

[0048] (5) Centrifuge at 4°C, 12,000 rpm, for 10 min, discard the supernatant, and allow the RNA to settle to the bottom of the tube. Add 500 mL of pre-cooled 75% ethanol (DEPC-prepared), shake gently, and gently invert to suspend the precipitate;

[0049] (6) Centrifuge at 4°C, 12,000 rpm, 5 min, discard the supernatant, and absorb the ethanol. Centrifuge at 4°C, 12,000 rpm, 30 s, absorb the remaining ethanol, and invert and dry the precipitate at room temperature until it becomes transparent;

[0050] (7) Dissolve the RNA sample in 20 μL of DEPC and incubate at 55°C for 7 min;

[0051] (8) Take 1 μL of sample, use NanoDrop2000 to measure the concentration and purity of the RNA sample, and freeze it at -80°C.

[0052] 1.3 Reverse transcription (RNA→cDNA)

[0053] (1) The total amount of RNA required is 1000 ng. The volume of RNA added to the reaction system is calculated based on the concentration of the RNA sample;

[0054] (2) Reaction system (20 μL):

[0055] RNA Sample V1

[0056] 5x No RT Control Mix 4μL

[0057] Enzyme-free water 16μL-V1

[0058] (3) PCR instrument program settings: 50°C, 15 min, 85°C, 5 s, 4°C∞.

[0059] 1.4qPCR detection

[0060] Real-time fluorescence quantitative PCR (qPCR) was used to quantitatively analyze the target gene SIRT1 in the sample to be tested. After querying the gene sequence of SIRT1 in the PUBMED database, the upstream primer SIRT1-F (GGGGCTGCGGTTCCTAC) of SIRT1 and the downstream primer SIRT1-R (CCGAACAGAAGGTTATCTGGCT) of SIRT1 were designed; the sequence of the upstream primer of SIRT5 was CGTGGTCATCACCCAGAACAT and the sequence of the downstream primer of SIRT5 was CTGCCTCTTCACACCCTTTTC.

[0061] The reaction system (15 μL) is as follows:

[0062] Table 1 qPCR reaction system

[0063]

[0064]

[0065] The qPCR reaction program was set as follows:

[0066] Table 2 qPCR reaction procedure

[0067]

[0068] The transcriptional activity detection of SIRT5 gene is the same as SIRT1.

[0069] 1.5 Experimental Results

[0070] The quantitative analysis results of SIRT1 and SIRT5 target genes are shown in Figure 1 and Figure 2 As shown by Figure 1 and Figure 2 The results showed that compared with the blank control group, the mRNA expression levels of SIRT1 and SIRT5 in cells supplemented with N-acetylneuraminic acid were significantly upregulated, indicating that N-acetylneuraminic acid can enhance the transcriptional activity of SIRT1 and SIRT5 genes and can be used as a transcriptional activator of SIRT1 and SIRT5 genes to activate SIRT1 and SIRT5.

[0071] SIRT1 is an important deacetylase that plays an important role in cellular stress response, especially in combating oxidative stress. SIRT1 activation can promote antioxidant response, which may indirectly affect cell senescence and the expression of β-galactosidase.

[0072] Example 2 Sialic acid delays cell senescence

[0073] 2.1 Cell culture

[0074] Select humanized fibroblasts (HFF-1, SCSP-109) for culture, absorb and discard the old culture medium in the bottle, select cells with a growth density of about 80%, discard the old culture medium, add 1-2mL sterile PBS solution, gently rinse 3 times, and then absorb the PBS in the cell bottle; add 1mL of trypsin digestion solution containing 0.25% EDTA to cover the cells, place the cell bottle in a 37℃, 5% CO2 incubator for digestion for 2-3min, observe the cells under an inverted microscope, and when most of the cells shrink and are in a semi-detached state, add an equal volume of DMEM complete culture medium to terminate digestion; blow the bottle wall 3 times with a pipette, gently blow the cells to make a cell suspension and transfer it to a 1.5mL centrifuge tube, room temperature, 1300rpm, centrifuge for 5min, and discard the supernatant. Add DMEM complete culture medium to resuspend the cells, divide the cell suspension into two, transfer it to a new cell bottle and add DMEM complete culture medium to 5mL. Observe and change the medium after 24h, and pass it in time according to the cell growth.

[0075] 2.2 Analysis of fibroblast growth curve

[0076] Normal and aged (barium sulfate-induced) humanized fibroblasts (10 5 ) were seeded in a 6-well plate, with the number of aged HFF wells being twice that of normal HFF, and cultured in a 37°C, 5% CO2 incubator. Half of the aged cells were then treated with 0.5% SA for 24 hours, and then replaced with complete medium for continued culture, forming three groups, namely, aged HFF group, aged HFF-SA group, and normal HFF group. After that, the cells in each group were digested with trypsin and sampled for cell counting every day for 5 days. The fibroblast growth curve is shown in Figure 2. Figure 3 shown.

[0077] After aging, cells will not undergo apoptosis immediately. Senescent cells will remain in tissues for a long time. As senescent cells accumulate in tissues, the body's functions will decline, such as secretion and material transport functions, and the metabolic rate will slow down. In addition, senescent cells will secrete a variety of cytokines, growth factors, etc., forming an aging-related secretory phenotype. These substances may affect the surrounding cells and tissue microenvironment, and even cause chronic inflammation. Long-term accumulation may also affect the normal functioning of tissues and organs, causing the overall function of the body to decline and increase the risk of geriatric diseases.

[0078] Depend on Figure 3 The results showed that the cell growth rate of aged cells treated with SA was significantly higher than that of the untreated aged control group. Although it was different from the level of normal cells, it also showed that SA treatment could effectively slow down cell aging and increase cell growth.

[0079] 2.3 Determination of aging-related β-galactosidase expression

[0080] During the cell aging process, the activity of β-galactosidase in lysosomes increases. The activity of β-galactosidase is usually regarded as a biomarker of cell aging, which can be used to determine whether the cells have entered the aging state. Real-time quantitative PCR (detection kit) was further used to analyze the expression level of β-galactosidase gene in the aged HFF group, aged HFF-SA group, and normal HFF group. The results are as follows: Figure 4 shown.

[0081] Depend on Figure 4 The results showed that compared with the normal HFF group, the gene expression of galactosidase in the aged HFF group cells was extremely significantly increased, indicating that the gene expression of galactosidase was significantly upregulated during cell aging. Compared with the aged HFF group, the gene expression of galactosidase was significantly downregulated after adding sialic acid to the aged cells, indicating that sialic acid can reduce the gene expression level of galactosidase in aged cells and promote the resumption of cell division and growth, and has an anti-cell aging effect. This may be because sialic acid activates SIRT1 and indirectly affects cell aging and the expression of galactosidase.

[0082] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment as above, it is not used to limit the present invention. Any technical personnel in this field can make some changes or modify the technical contents disclosed above into equivalent embodiments without departing from the scope of the technical solution of the present invention. However, any brief modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. An application of sialic acid in the preparation of anti-cell aging products.

2. The use according to claim 1, characterized in that The anti-cell aging is to activate the silent information regulatory factor or enhance the expression of the silent information regulatory factor.

3. The use according to claim 2, characterized in that The silent information regulator is SIRT1 and / or SIRT5.

4. The use according to claim 3, characterized in that The silent information regulators are SIRT1 and SIRT5.

5. The use according to any one of claims 1 to 4, characterized in that: The anti-cell aging product is used for promoting cell recovery division and growth and / or reducing the expression of β-galactosidase.

6. The use according to claim 5, characterized in that The anti-cell aging product is used for reducing the expression amount of β-galactosidase in aging cells.

7. The use according to claim 1, characterized in that The anti-cell aging product includes a product for preparing a product for preventing elderly diseases related to cell aging.

8. The use according to claim 7, characterized in that The cell aging-related elderly diseases include cardiovascular diseases, bone and joint diseases, or chronic inflammation.

9. The use according to claim 1, characterized in that The product comprises one or more of cosmetics, foods or medicines for resisting cell aging.

10. The use according to claim 9, characterized in that The product may be in the form of one or more of an aqueous solution, an emulsion, a cream, a gel, a powder, a block, a pill or an oil.

Images