Application of CUP in preparation of medicine for preventing and / or treating myocardial remodeling diseases

Abstract

The invention provides application of CUP in preparation of a medicine for preventing and / or treating myocardial remodeling diseases. The nucleotide sequence of the CUP is shown as SEQ NO.1 in a sequence table. The application of the CUP in preparing the medicine for preventing and / or treating the myocardial remodeling disease proves that the CUP participates in the occurrence and development process of the disease in the cardiac tissue subjected to pathological myocardial remodeling, and the CUP treatment can obviously improve the decline of the cardiac function and the change of the cardiac structure of a mouse caused by aortic constriction surgery; the application can be used for relieving cardiac hypertrophy caused by simulated pressure overload of aortic constriction surgery and cardiac atrophy and dysfunction caused by pressure load reduction, relieving occurrence of myocardial remodeling and heart failure, and can be applied to preparation of medicines for preventing and / or treating myocardial remodeling diseases and diagnosis and identification of heart failure diseases.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology and medical technology, and specifically relates to the application of CUP in preparing a medicine for preventing and / or treating myocardial remodeling diseases. Background Art

[0002] Heart disease has been the leading cause of death worldwide for nearly 20 years, and adverse remodeling is one of the main causes of the most devastating heart failure. Because cardiomyocytes cannot regenerate, when they are damaged or the cellular environment changes, cardiomyocytes undergo metabolic and structural changes that lead to myocardial hypertrophy, whether it is physiological hypertrophy caused by exercise or pathological hypertrophy caused by diseases such as hypertension. In addition, cardiomyocytes may also undergo another form of pathological remodeling, called atrophy, which is different from pathological hypertrophy, but it can also harm heart health. Pathological remodeling is triggered by pathological stimuli and may lead to heart failure. This process goes through two stages, compensation and decompensation, and ultimately leads to irreversible changes in the structure and function of myocardial tissue. Therefore, studying the occurrence and development mechanism of pathological cardiac remodeling is of great significance for the prevention and treatment of heart diseases such as heart failure.

[0003] Physiological and pathological causes of myocardial remodeling generally include abnormal activation or inhibition of nerves and endocrines and hemodynamic changes. As mentioned above, because myocardial cells are terminally differentiated cells, when subjected to pathological and physiological stimulation, individual myocardial cells respond to stimulation rather than changes in the number of myocardial cells. In the early stages of myocardial cell response to stimulation, the body is indeed protected, but in long-term stimulation, the response of myocardial cells enters the decompensation stage, and eventually leads to elongation and thinning of myocardial cells. This change is reflected in the heart as dilation and thinning of the ventricular wall and systolic and diastolic dysfunction. In this process, myocardial cells undergo a series of gene expression changes, including increased expression of fetal genes such as atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), and β-myosin heavy chain (β-MHC), as well as decreased fatty acid metabolism capacity / increased glucose metabolism capacity. Therefore, controlling the process of pathological myocardial remodeling is an effective way to achieve the treatment of heart failure.

[0004] As a common feature of many cardiovascular diseases, myocardial remodeling involves a series of complex molecular regulatory networks, among which long non-coding RNA as an important type of regulatory factor has gradually attracted people's attention. In recent years, more and more studies have shown that long non-coding RNA plays an important regulatory role in myocardial remodeling. These long non-coding RNAs participate in biological processes such as myocardial cell proliferation, apoptosis and contraction through various mechanisms, affecting the function and structure of myocardial cells. Long non-coding RNA is an RNA transcript with a length of more than 200 nt and lost protein coding ability. This transcript was once considered useless. However, with the development of molecular biology, people have found that the existence and even the production process of this molecule are involved in the regulation of many life activities, especially in the precise regulation of the body and cells, playing an extremely important role. Therefore, finding and utilizing long non-coding RNAs that have important functions in the process of pathological myocardial remodeling is completely feasible and has good application prospects for combating pathological myocardial remodeling. Summary of the invention

[0005] The object of the present invention is to provide the use of CUP in preparing a medicament for preventing and / or treating myocardial remodeling diseases.

[0006] The purpose of the present invention is to adopt the following technical solutions to achieve:

[0007] The present invention provides an application of CUP in the preparation of a drug for preventing and / or treating myocardial remodeling diseases; the nucleotide sequence of the CUP is shown in the sequence table SEQ NO.1. The CUP of the present invention is a long non-coding RNA from the casein kinase 2 interacting protein 1 (CKIP-1) gene locus, which can resist pathological myocardial remodeling, control the process of pathological myocardial remodeling, and thus achieve effective treatment of heart failure.

[0008] Preferably, the myocardial remodeling disease is caused by pressure overload or weightlessness in space flight.

[0009] Preferably, the prevention and / or treatment of myocardial remodeling diseases is achieved by inhibiting the occurrence of pathological cardiac remodeling through overexpression of CUP.

[0010] Based on the same inventive concept, the present invention also provides a use of an overexpression plasmid containing CUP in the preparation of a drug for preventing and / or treating myocardial remodeling diseases.

[0011] Based on the same inventive concept, the present invention also provides a use of an adeno-associated virus carrying CUP overexpression in the preparation of a drug for treating, preventing and / or treating myocardial remodeling diseases.

[0012] Preferably, in the adeno-associated virus carrying CUP overexpression, the adeno-associated virus vector is an adeno-associated virus vector driven by a myocardium-specific promoter.

[0013] Preferably, the adeno-associated virus vector is an AAV9 vector.

[0014] Preferably, the adeno-associated virus carrying CUP overexpression is used by intravenous injection.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] (1) The present invention confirms that the expression level of CUP in heart tissue samples of heart failure is significantly higher than that in normal heart tissue through experimental studies on the correlation between the expression level of CUP in heart tissue of mice with heart failure and the expression level of myocardial cell remodeling marker genes, observation of the effect of the constructed CUP overexpression plasmid on mouse cardiac function indicators and cardiac hypertrophy, and tail vein injection of adeno-associated virus-packaged CUP sequences. The cardiac function indicators of mice, ejection fraction EF, shortening fraction FS, systolic left ventricular internal diameter and diastolic left ventricular posterior wall thickness, are significantly restored after CUP treatment. The cross-sectional size of the heart and the size of the heart tissue are significantly reduced. The fibrosis and the size of single cardiomyocytes were improved. This result indicates that CUP is involved in the occurrence and development of the disease in the heart tissue undergoing pathological myocardial remodeling. CUP treatment can significantly improve the decline in cardiac function and changes in cardiac structure caused by aortic coarctation in mice, alleviate cardiac hypertrophy and dysfunction caused by aortic coarctation, and alleviate the occurrence of myocardial remodeling and heart failure. It can be used as a therapeutic target and diagnostic target for screening or preparing the prevention and / or treatment of myocardial remodeling diseases, and can be used in the preparation of drugs for the prevention and / or treatment of myocardial remodeling diseases and in the diagnosis and identification of heart failure diseases.

[0017] (2) The present invention also studied the effects of weightlessness-induced myocardial atrophy in tail-suspended mice, and confirmed that the mouse cardiac function indicators ejection fraction EF, shortening fraction FS, systolic left ventricular internal diameter and diastolic left ventricular posterior wall thickness were significantly restored after CUP treatment, and the cross-sectional size of the heart, the fibrosis of the heart tissue and the size of a single myocardial cell were improved. This result shows that CUP treatment can significantly improve the decline in mouse cardiac function and changes in cardiac structure caused by hind limb unloading, alleviate cardiac atrophy and dysfunction caused by weightlessness, alleviate myocardial remodeling and the occurrence of heart failure, and can be used in the preparation of drugs for the prevention and / or treatment of myocardial remodeling diseases caused by weightlessness, as well as in the diagnosis and identification of heart failure caused by weightlessness. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1This is a graph showing changes in CUP expression in the heart tissue of mice in the aortic arch constriction (TAC) model simulating cardiac pressure overload;

[0019] Figure 2A This is a schematic diagram of the principle of the rapid amplification of cDNA ends (RACE) technique for CUP nucleotide sequences;

[0020] Figure 2B Schematic diagram of the rapid amplification of cDNA ends (RACE) process for CUP nucleotide sequences;

[0021] Figure 2C This is a diagram showing the authenticity test results of CUP nucleotides obtained by RACE technology using RNA immunoblotting.

[0022] Figure 2D This is a protein coding ability analysis diagram of CUP nucleotide sequences obtained using the CPC2 sequence coding ability prediction tool;

[0023] Figure 2E This is an analysis diagram of the evolutionary conservation of CUP nucleotide sequences;

[0024] Figure 2F It is the secondary structure analysis diagram of CUP nucleotide sequence;

[0025] Figure 3 Schematic diagram of CUP overexpression plasmid;

[0026] Figure 4 The results of the CUP overexpression on the cardiac function and structural observation indexes LVAW; d, LVAW; s, LVID; d, LVID; s, LVPW; d, LVPW; s, EF (%), FS (%) after TAC in mice;

[0027] Figure 5a The microscopic morphological diagram shows the effect of CUP overexpression on cardiac hypertrophy in mice after TAC.

[0028] Figure 5b This is the result diagram of the effect of CUP overexpression on various observed indicators of cardiac hypertrophy after TAC in mice;

[0029] Figure 6 This is the result diagram of the effect of CUP overexpression on the expression of myocardial remodeling marker genes after TAC in mice;

[0030] Figure 7 The results of the CUP overexpression on the cardiac function and structural observation indexes LVAW; d, LVAW; s, LVID; d, LVID; s, LVPW; d, LVPW; s, EF (%), FS (%) in the mouse heart pressure unload model simulated by tail-hanging weightlessness in hind limbs of mice;

[0031] Figure 8a The microscopic morphological diagram of CUP overexpression on cardiac hypertrophy in the mouse tail-hanging weightlessness model;

[0032] Figure 8b This is the result diagram of the effect of CUP overexpression on various observed indicators of cardiac hypertrophy in the mouse tail-hanging weightlessness model;

[0033] Fig. 9 This is a diagram showing the detection results of trans-acting factors that mediate CUP expression. DETAILED DESCRIPTION

[0034] The following experimental examples are convenient for better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following experimental examples are conventional methods unless otherwise specified. The test materials used in the following experimental examples are purchased from conventional biochemical reagent companies unless otherwise specified. The quantitative experiments in the following experimental examples are repeated three times, and the results are averaged. In order to perform statistical analysis, all quantitative data are described in the form of mean ± SEM. Two-tailed unpaired t-tests are used to compare and statistically analyze the two groups. The statistical difference analysis between multiple groups is performed by one-way or two-way one-way analysis of variance (ANOVA), and after the comparison test, a Post Hoc test is performed to determine the difference between the groups. All statistical analyses are analyzed using GraphPadprism software and SPSS. "*" means P<0.05, "**" means P<0.01, "***" means P<0.001, and "****" means P<0.0001, all indicating statistically significant differences; ns means that the difference is not significant.

[0035] Example 1: Changes in CUP expression in the heart of mice in the TAC-induced cardiac hypertrophy model simulating cardiac pressure overload

[0036] 1. Establishment of pathological myocardial hypertrophy model by TAC (aortic arch constriction) surgery in mice

[0037] C57BL / 6N mice (wild-type (WT) mice) were purchased from Sibeifu (Beijing) Biotechnology Co., Ltd., SPF grade.

[0038] Aortic arch group (TAC group):

[0039] Aortic arch coarctation surgical procedure: 1) Thoracotomy: Take a 7-week-old C57BL / 6N male mouse weighing 20-25g and inject 2,2,2-tribromoethanol (0.1mL / 10g body weight supersaturated solution) intraperitoneally for anesthesia. Use depilatory cream to remove the hair between the mouse's neck and the xiphoid process of the sternum, hook the mouse's upper jaw teeth with a thread, and use medical tape to fix the thread on the operating table. Let the mouse lie on its back on the sticky mouse board, fix the limbs and tail with medical tape, use a pair of ophthalmic scissors to cut a small incision in the skin from the suprasternal fossa, and use thoracotomy scissors to cut down along the sternum to the first rib. Open the chest cavity and expand it with a chest expander. Use two ophthalmic forceps to gently lift the thymus to expose the aortic arch. Use a pair of microtweezers to bluntly peel off the thymus and adipose tissue in the aortic arch area between the brachiocephalic trunk and the left common carotid to expose the surgical site. 2) Aortic arch ligation: Place a No. 26 needle parallel to the aortic arch and tie it with 5-0 non-absorbable sutures. After tying, gently remove the needle, remove the chest expander, and use 5-0 absorbable sutures to suture the muscles and skin in turn. After complete suturing, apply iodine with a cotton swab around the suture.

[0040] Sham group: The thoracotomy procedure was the same as that of the TAC group, but without the aortic arch ligation procedure.

[0041] 2. Detection indicators

[0042] 2.1 Tissue RNA extraction: obtaining high-quality total RNA

[0043] 2.1.1 Reagents and instruments:

[0044] All the crushing tubes, crushing beads, EP tubes, pipette tips, reagents, etc. used must be free of ribonuclease (RNase);

[0045] Trizol: an RNA extraction reagent purchased from Beijing Noble Company, brand model: life15596-026);

[0046] Nanodrop 2000 ultra-micro-volume spectrophotometer: purchased from Thermo Fisher Scientific.

[0047] 2.1.2 Heart tissue extraction:

[0048] Cut about 10 mg of fresh or -80℃ preserved heart tissue, add the cut heart tissue to the crushing tube, add 1 mL Trizol and 3 zirconium oxide crushing beads, put the crushing tube into the crusher, crush the heart tissue, transfer the crushed product into the EP tube, rotate at 4℃ for 20 minutes, add 200μL chloroform to the EP tube, shake vigorously to mix, and then stand for stratification to extract RNA. After the liquid in the EP tube is layered, centrifuge at 12000rpm at 4℃ for 20 minutes, extract the supernatant, add isopropanol of the same volume as the supernatant for alcohol precipitation, and then centrifuge at 4℃ and 12000rpm for 20 minutes, discard the supernatant, add pre-cooled 75% ethanol for washing, centrifuge at 4℃ and centrifugal force 7500rcf for 10 minutes, repeat the centrifugation twice, discard the supernatant, dry the obtained extract, and add an appropriate amount of enzyme-free sterile water to dissolve RNA.

[0049] 2.2 Detection:

[0050] The OD260 / 280 ratio and concentration of RNA in the above extracts were detected using Nanodrop 2000 ultra-micro spectrophotometer. The RNA quality should be maintained at an OD260 / 280 range of 1.90 to 1.95.

[0051] 3. Reverse transcription of RNA:

[0052] The present invention uses a reverse transcription kit from Takara Company, and RNA reverse transcription is performed according to the kit instructions.

[0053] The specific method is as follows:

[0054] The reverse transcription reaction is as follows:

[0055]

[0056] Mix well, react at 37°C for 15 min; react at 85°C for 5 s, place on ice to obtain cDNA after reverse transcription reaction; dilute 20 μL of the cDNA 40 times to 800 μL, and store at -20°C for the next step of real-time quantitative PCR detection.

[0057] 4. Real-time quantitative PCR to detect RNA expression in cells:

[0058] Real-time quantitative PCR was performed using Takara SYBR.

[0059] The specific steps are as follows:

[0060] Configure the PCR reaction system as follows:

[0061]

[0062]

[0063] Mix well and the reaction procedure is as follows:

[0064] Pre-denaturation: 95°C, 5 min;

[0065] Denaturation: 95°C, 5 sec;

[0066] Annealing: 60℃, 30sec;

[0067] A total of 40 cycles.

[0068] After the reaction is completed, the PCR melting curve is obtained, and the purity of the product is determined based on the homogeneity of the melting curve.

[0069] Among them, the primer sequences for detecting myocardial remodeling marker genes in real-time quantitative PCR are shown in Table 1:

[0070] Table 1

[0071] Gapdh-F SEQNO.2:5'-tcaccaccatggagaaggc-3' Gapdh-R SEQNO.3: 5'-gctaagcagttggtggtgca-3' ANP-F SEQNO.4: 5'-ttcgggggtaggattgacag-3' ANP-R SEQNO.5: 5'-cacaccacaagggcttagga-3' BNP-F SEQNO.6:5'-tgtttctgcttttcctttatctg-3' BNP-R SEQNO.7:5'-tctttttgggtgttcttttgtga-3' β-MHC-F SEQNO.8:5'-cctcagcagaggagtacagc-3' β-MHC-R SEQNO.9: 5'-ggctgagccttggattctca-3' CUP-F SEQNO.10: 5'-acagacctcccagcacagtcaa-3' CUP-R SEQNO.11:5'-tgcaacatttggagataaagag-3'

[0072] 5. Analysis of measurement results:

[0073] Figure 1 This is a graph showing the changes in CUP expression in mouse heart tissue in a mouse heart pressure overload model simulated by aortic arch constriction (TAC), where the horizontal axis represents the experimental group (TAC group) and the control group (Sham group), and the vertical axis represents the relative expression of CUP in mice heart / (Gapdh).

[0074] like Figure 1 As shown in the figure, in the heart tissue of the heart failure model mice induced by pressure overload caused by TAC group, the expression of CUP was significantly increased compared with that of Sham group, and this increase was statistically significant (*P<0.05). This result shows that CUP is involved in the occurrence and development of the disease in the heart tissue with pathological cardiac remodeling, and the detection of CUP expression in heart tissue samples is an effective method to accurately identify heart failure.

[0075] Figures 2A-2F This is the basic characteristic diagram of CUP as a non-coding RNA, where:

[0076] Figure 2AThe schematic diagram of the principle of the rapid amplification of cDNA ends (RACE) of CUP nucleotide sequences shows the location of the specific primers (GSP) designed to obtain the 5' end (5'RACE product) and 3' end (3'RACE product) of the CUP sequence and the universal primer binding (UPM) site of the kit. After sequencing the fragments containing the 5' end and 3' end of the CUP sequence, Figure 2A The full-length sequence of CUP was obtained by splicing.

[0077] Figure 2B This is a schematic diagram of the rapid amplification of cDNA ends (5' and 3' ends) (RACE) of CUP nucleotide sequences. The newly discovered long non-coding RNA CUP and the messenger RNA (mRNA) transcribed from its locus are marked in the figure. The HL-1 group is the RACE experimental group for RNA extracted from the cardiomyocyte cell line, and the HEART group is the RACE experimental group for RNA extracted from mouse heart tissue after 4 weeks of TAC. Figure 2B The sizes of the two fragments can be intuitively understood. The sequence information of the CUP nucleotide sequence can be obtained by sequencing and connecting the two fragments. Different lanes in the figure use different annealing temperatures, marked with * and # respectively. The annealing temperatures used from left to right are *: 53°C, 56.4°C, 58.8°C, 61.8°C, 65.4°C, 70.7°C. #: 54.8°C, 56.4°C, 58.8°C, 61.8°C, 65.4°C, 69.5°C, 70.7°C, 72.3°C.

[0078] Figure 2C This is a diagram showing the authenticity test results of CUP nucleotides obtained by RACE technology using RNA immunoblotting. Figure 2C As shown, the CUP nucleotide sequence was detected by immunoblotting, indicating that the CUP sequence actually exists in mouse heart tissue. In the RNA immunoprecipitation experiment, the HL-1 cardiomyocyte cell line derived from mouse heart and mouse heart tissues numbered 1264, 1259, and 1202 were used respectively; the first lane on the left is RNA marker (RNA molecular marker), and its size from bottom to top is 100 nucleotides (nt), 200 nucleotides (nt), 300 nucleotides (nt), and 600 nucleotides (nt).

[0079] Figure 2DThis is a protein coding ability analysis chart of the CUP nucleotide sequence obtained using the CPC2 sequence coding ability prediction tool, where: the vertical axis is CUP, HOTAIR (a long non-coding RNA closely related to tumor occurrence), ACTA1 (ACTA1 Antigen, skeletal muscle actin α1 recombinant protein), GAPDH (glyceraldehyde-3-phosphate dehydrogenase, glyceraldehyde-3-phosphate dehydrogenase), and the horizontal axis is coding probability. CPC2 is a tool for predicting RNA coding ability. This tool determines whether RNA has protein coding ability based on the given sequence information. Figure 2D As shown, the results indicate that CUP lacks protein coding ability, that is, it is a long non-coding RNA.

[0080] Figure 2E This is an evolutionary conservation analysis diagram of CUP nucleotide sequences, where the evolutionary species are mice (Musmusculus), chimpanzees (pan troglodytes), humans (Homo sapiens), macaques (Macaca mulatta), brown rats (Rattus norvegicus), cattle (Bos taurus), and wolves (Canis lupus). Figure 2E The results show that CUP is conserved in mammals, indicating that CUP may have important biological functions.

[0081] Figure 2F The secondary structure analysis diagram of CUP nucleotide sequence is shown in Figure 2. Figure 2F As shown, the CUP sequence has a complex secondary structure, confirming that CUP may have important biological functions.

[0082] In summary, the CUP nucleotide sequence is a long non-coding RNA of about 400 nt in length from the CKIP-1 locus. It is conserved in evolution and has a complex secondary structure, and has important biological functions.

[0083] Example 2: Design of CUP overexpression virus and the effect of intravenous administration on the phenotype of mice after TAC

[0084] 1. Design of CUP overexpression virus

[0085] 1.1 Construction of CUP overexpression plasmid:

[0086] The CUP overexpression fragment was generated by amplification of mouse genomic DNA, and its sequence is SEQ NO.1: GGAGCTGCTGGCAGAGGTTCAGGGACTGGGTGACGGCAAGCGGAAGGCCAAGGACCCCCCACAGTCTCCACCCGACTCGGAGTCGGAGCAGCTGCTGCTGGAGACAGAGAGGCTGCTGGGAGAGGCTTCCTCCAACTGGAGCCAGGCAAAGAGAGTGCTGCAGGAAGTCCGGGAGCTGAGAGAC CTGTACAGGCAGATGGACCTGCAGACCCGGACTCCCACCTCAGACAGACCTCCCAGCACAGTCAATACCGGAAGAGCCTGATGTGAAAGGGGGGGCAGGTCTGAAATTTGGGGGGGCACAGACTCTTTATCTCCAAATGTTGCAGGATAAAGCTTTTTTATTTACCTCAATCCAAAAAAAAAAAAAA.

[0087] 1.2 Construction of CUP overexpression virus vector:

[0088] like Figure 3 The above-described sequence was recorded into an overexpression vector, and the vector was named pcDNA3.1 modified-OE CUP (using the modified pcDNA3.1 plasmid to overexpress CUP), and the CUP overexpression virus AAV9-cTNT-CUP was constructed. Figure 3 The schematic diagram of CUP overexpression plasmid is based on pcDNA3.1, and mainly includes ampicillin resistance promoter (AmpR promoter), ampicillin resistance (AmpR), replication origin (ori), cytomegalovirus enhancer sequence (CMV enhancer), cytomegalovirus promoter sequence (CMV promoter), T7 promoter sequence (T7 promoter), overexpressed CUP sequence, Catabolite activator protein binding site (CAP binding site), lactose operator kit (lac promoter and lac operator), tailing signal (bGH poly (A) signal and SV40 poly (A) signal), kanamycin / neomycin resistance (NeoR / KanR), eukaryotic cell replication origin (f1ori and SV40 ori). Virus construction, packaging and purification were entrusted to Hanheng Biotechnology (Shanghai) Co., Ltd.

[0089] 2. Tail vein injection of CUP overexpression virus in TAC mice

[0090] Tail vein administration:

[0091] TAC surgery was performed on WT mice. The experimental procedure was the same as in Example 1. Three days after TAC surgery, CUP overexpression virus (1*10 11 vg / mouse), and cardiac ultrasound analysis was performed four weeks after TAC surgery.

[0092] 3. Ultrasonic analysis of mouse heart function:

[0093] Before the test, the mouse chest was depilated with depilatory cream to facilitate measurement. The mouse was placed on a warming table with an embedded ECG monitor, and electrode gel was applied to the limbs. The mouse was anesthetized by intraperitoneal injection of 2,2,2-tribromoethanol (0.1 mL / 10 g body weight supersaturated solution). The mouse heart function test was performed using the 770B 30 MHz ultrasound probe configured by Vevo. The B-Model two-dimensional image was obtained from the short axis of the mouse heart. The echocardiographic cardiac function observation indicators were obtained using the system's own software: Systolic Interventricular Septal Thickness (IVSs); Diastolic Left Ventricular Posterior Wall Thickness (LVPWd) and Systolic Left Ventricular Anterior Wall Thickness (LVPWs); Diastolic Left Ventricular Internal Diastolic Diameter (LVD) Diameter, LVIDd) and Systolic Left Ventricular Internal Diameter, LVIDs; Diastolic Left Ventricular Volume, LV Vold) and Systolic Left Ventricular Internal Volume, LV Vols; left ventricular ejection fraction EF was calculated according to the volume formula EF = [(LV Vold-LV Vols) / LVVold] × 100%, and fractional shortening FS was calculated according to the formula FS = [(LVIDd-LVIDs) / LVIDd] × 100%.

[0094] 4. Histopathological section staining:

[0095] 1) Frozen sections:

[0096] (1) Fixation of heart tissue: The heart tissue removed from the mouse chest was fixed with 4% paraformaldehyde fixative for 24 hours.

[0097] (2) Dehydration: The fixed heart tissue is transferred from the fixative to a 30% sucrose solution (30 g sucrose, dissolved in PBS to a volume of 100 ml), and immersed until the heart tissue completely sinks to the bottom, and then dehydrated to obtain a tissue block.

[0098] (3) Trim and embed the tissue block using OCT (Optical Coherence Tomography) technology: Place the tissue block in a culture dish, trim the tissue block with a scalpel, and place the trimmed tissue block on a sample holder for fixation. Squeeze OCT embedding agent on the sample holder to embed the sample, then place it in the cold box of the slicer and wait for the embedding agent to change from transparent to white before starting to slice.

[0099] (4) Slicing: Install the blade, adjust the slice thickness (usually 20 μm) and the slice angle. Install the frozen tissue block on the tissue holder, adjust the angle and distance between the blade and the tissue block, adjust the position and angle of the anti-roll plate, turn the handle of the slicer rotating wheel to slice, and stick the cut tissue slices on the slide. The slices can be stored in a -20℃ refrigerator for staining. The remaining tissue blocks after slicing can be wrapped with tin foil and sealed in a -80℃ refrigerator for use.

[0100] 2) WGA staining (cardiomyocyte wheat germ agglutinin staining):

[0101] (1) Soak the frozen tissue sections in PBS for 30 minutes.

[0102] (2) Take it out and dry the liquid on the surface.

[0103] (3) Dissolve WGA staining solution in sterile PBS buffer (phosphate buffer) at 1 mg / mL and dispense into 1.5 mL EP tubes, dilute at a concentration of 1:200 for later use. The WGA staining solution should be stored at -20°C away from light.

[0104] (4) Drop WGA staining solution on the slices, taking 100 μL / 1 g tissue, and place in a dark place for 30 minutes;

[0105] (5) Immerse the slices in PBS buffer, take them out after 15 minutes, replace the PBS buffer, and repeat twice;

[0106] (6) DAPI (4',6-diamidino-2-phenylindole) fluorescent dye was dropped onto the heart tissue and incubated for 3 minutes;

[0107] (7) Immerse the slices in PBS buffer, take them out after 15 minutes, replace the PBS buffer, and repeat twice;

[0108] (8) Take a drop of neutral resin and add it to the tissue sample. Slowly cover it with a coverslip. Avoid creating bubbles during the whole process. Keep it away from light until the neutral resin is dry. Then, observe it under a laser confocal microscope.

[0109] 3) Conventional hematoxylin-eosin (H&E) staining and Masson trichrome staining: Mouse heart tissue was taken and fixed with 4% paraformaldehyde overnight, then sliced ​​with 6 μm paraffin, stained with hematoxylin-eosin (H&E), and subjected to conventional histological examination. Heart sections were stained with standard Masson trichrome staining to determine the degree of myocardial fibrosis. The stained smears were observed under a microscope, and the morphological analysis and counting of myocardial cells were performed using ImageJ software (public image processing software, from the NIH Institute of the United States).

[0110] 5. Detection of mouse myocardial remodeling marker genes:

[0111] qPCR (real-time fluorescence quantitative nucleic acid amplification detection system) was used to detect the expression of myocardial remodeling marker genes in each group of mice. The experimental operation was the same as in Example 1.

[0112] Figure 4 The figure shows the effect of CUP overexpression on the cardiac function and structural observation indicators LVAW; d, LVAW; s, LVID; d, LVID; s, LVPW; d, LVPW; s, EF (%), and FS (%) after TAC in mice, wherein AAV9-NC is the myocardium-specific adeno-associated virus (AAV) type 9 negative control sequence group, and AAV9-CUP is the CUP overexpression virus vector AAV9-cTcTNT-CUP constructed by the present invention.

[0113] like Figure 4 As shown, compared with the AAV9-NC group, the ejection fraction EF, shortening fraction FS, systolic left ventricular internal diameter LVID;s, diastolic left ventricular posterior wall thickness LVPW;d and other cardiac function indicators in the AAV9-CUP group were significantly restored after CUP treatment. The results showed that in the mouse TAC model, CUP treatment can significantly improve the decline in mouse cardiac function caused by TAC surgery (ejection fraction EF and shortening fraction FS were significantly restored after CUP treatment), as well as the cardiac structural changes caused by TAC surgery (systolic left ventricular internal diameter LVID;s, diastolic left ventricular posterior wall thickness LVPW;d were significantly restored after CUP treatment).

[0114] Figure 5a The microscopic morphological diagram shows the effect of CUP overexpression on cardiac hypertrophy in mice after TAC.

[0115] Figure 5b The results of the effect of CUP overexpression on various observed indicators of cardiac hypertrophy after TAC in mice include: relative cross sectional area of ​​the heart, heart weight / tibia length [HW / TL] ratio (HW / TL), and heart weight / body weight ratio (HW / BW).

[0116] like Figure 5a and Figure 5b As shown, after CUP treatment, the cross-sectional size of the heart, the fibrosis of the heart tissue and the size of individual cardiomyocytes in the AAV9-CUP group were improved compared with those in the AAV9-NC group. The results showed that in the mouse TAC model, CUP treatment can significantly improve the mouse cardiac hypertrophy caused by TAC surgery.

[0117] Figure 6 The results of the effect of CUP overexpression on the expression of myocardial remodeling marker genes after TAC in mice. The detection indicators include: the relative expression of atrial natriuretic peptide ANP, brain natriuretic peptide BNP, α cardiac actin, skeletal α-actin, myosin heavy chain Myh7, and C / EBPβ in mouse heart tissue (GAPDH is used as a standardized internal reference).

[0118] like Figure 6 As shown, compared with the AAV9-NC group, the AAV9-CUP group had atrial natriuretic peptide ANP, brain natriuretic peptide BNP, myosin heavy chain Myh7 and other cardiac fetal genes, which are markers of cardiac remodeling and significantly increased when the heart undergoes remodeling. The results showed that in the mouse TAC model, CUP treatment can significantly improve the expression of genes such as mouse cardiac remodeling caused by TAC surgery.

[0119] Example 3: Effect of CUP on myocardial atrophy induced by tail suspension in mice simulating weightlessness

[0120] 1. Tail vein injection of CUP overexpression virus in tail-suspended weightless (HU) mice

[0121] Establishment of tail vein administration / tail hanging weightlessness (HU) model:

[0122] Before the tail-hanging weightlessness (HU) model was established in WT mice, CUP overexpression virus (1*10 11vg / mouse). Pathological cardiac atrophy was induced in mice by simulating the head-directed distribution of body fluids due to weightlessness by tail suspension. C57 male mice aged 3 to 3.5 months were selected, and the surface of the mouse tail was wiped with alcohol cotton balls to remove grease, dandruff and dirt. The mouse was fixed in a fixed board with the tail exposed. A strip of plaster was cut into strips of about 1 cm wide and 5 cm long, and the cut plaster was used to paste the two sides of the mouse tail, leaving a little distance of about 0.5 cm at the end; then a strip of medical tape was used to fix it horizontally, fixed to the root and middle of the mouse tail to prevent the medical tape from falling off. The hanging rope was passed through the tape, through the small hole of the hanging beam, and clamped and fixed above the hanging beam. The length of the hanging rope was adjusted so that the mouse's hind limbs could not touch the bottom of the cage when stretched, and the head was low, so that the longitudinal axis of the body was at an angle of about 30° with the horizontal plane. After 6 to 8 weeks, echocardiography was performed for cardiac cell morphology and quantity analysis.

[0123] 2. Ultrasound analysis of mouse heart function

[0124] The experimental operation process is the same as in Example 2. It should be noted that the mice in the control group should also be housed in a single cage in a tail-hanging cage. When measuring the echocardiogram, the mice were put down and returned to the tail-hanging cage after the measurement.

[0125] Figure 7 This graph shows the effect of CUP overexpression on the cardiac function and structural observation indicators LVAW; d, LVAW; s, LVID; d, LVID; s, LVPW; d, LVPW; s, EF (%), and FS (%) of mice in the mouse heart pressure unload model simulated by hind limb tail hanging weightlessness. The HU group is the experimental group of mice subjected to the hind limb tail hanging weightlessness treatment, and the Ctrl group is the control group not subjected to the tail hanging weightlessness treatment.

[0126] like Figure 7 As shown, compared with the AAV9-NC group, the ejection fraction EF, shortening fraction FS, systolic left ventricular internal diameter LVID;s, diastolic left ventricular posterior wall thickness LVPW;d and other cardiac function indicators in the AAV9-CUP group were significantly restored after CUP treatment. The results showed that in the tail-hanging weightlessness (HU) model of mice, CUP treatment can significantly improve the decline in mouse cardiac function caused by hindlimb unloading (ejection fraction EF and shortening fraction FS were significantly restored after CUP treatment), as well as the cardiac structural changes caused by HU (systolic left ventricular internal diameter LVID;s was significantly restored after CUP treatment).

[0127] 3. Histopathological section staining

[0128] The mouse heart tissue pathological sections were stained to observe the changes in mouse myocardial cells. The experimental operation process was the same as in Example 2.

[0129] Figure 8aThe microscopic morphological diagram of CUP overexpression on cardiac hypertrophy in the mouse tail-hanging weightlessness model;

[0130] Figure 8b This figure shows the effect of CUP overexpression on various observed indicators of cardiac hypertrophy in the mouse tail-suspension weightlessness model.

[0131] Among them, the observation indicators include: heart weight / tibia length [HW / TL] ratio (HW / TL), heart weight / body weight ratio (HW / BW); the HU group is the experimental group of mice subjected to hind limb tail suspension weightlessness treatment, and the Ctrl group is the control group that has not been subjected to tail suspension weightlessness treatment.

[0132] like Figure 8a and Figure 8b As shown in the data, after CUP treatment, the cross-sectional size of the heart, the fibrosis of the heart tissue and the size of individual cardiomyocytes in the AAV9-CUP group were improved compared with those in the AAV9-NC group. The results showed that in the mouse tail-hanging weightlessness (HU) model, CUP treatment can significantly improve the mouse cardiac hypertrophy caused by HU.

[0133] Example 4: Effect of VDR (vitamin D receptor) binding site on CUP transcription

[0134] 1) Plasmids with mutations in the VDR binding site 2000bp, 1000bp, 500bp, and within 500bp upstream of CUP were constructed, namely, pGL3-Basic--2kbTSS CUP, pGL3-Basic--1kbTSS CUP, pGL3-Basic--500bpTSS CUP, pGL3-Basic--500bp CUPmut, etc.;

[0135] 2) 293T cells (human embryonic kidney cells) reverse transcription;

[0136] 3) Collect cells after 24 hours. Add 200 μL of 1* passive lysis buffer to each well of the 24-well plate and shake vigorously on a shaker for 20 minutes (no need to be at 4°C, normal membrane washing speed is sufficient);

[0137] 4) Pipette 50 μL per well into a clean white 96-well ELISA plate;

[0138] 5) The activities of firefly luciferase and Renilla luciferase (provided by pRL-TK) were detected using a luciferase reporter gene detection system on a chemiluminescence detector (BERTHOLD, Germany), and each value of firefly luciferase was normalized by Renilla luciferase assay.

[0139] Fig. 9The figure is a detection result diagram of the trans-acting factors mediating CUP expression; wherein the vertical axis "Relativeluciferase activity in 293T( / RL-TK)" represents the luciferase expression level in 293T cells after normalization by Renilla fluorescence.

[0140] like Fig. 9 As shown, in the luciferase gene reporter experiment for testing the transcriptional activity of the CUP upstream sequence, compared with the control group with the addition of pGL3-Basic plasmid, the luciferase expression levels of the pGL3-Basic--2kbTSS CUP plasmid group, the pGL3-Basic--1kbTSS CUP plasmid group and the pGL3-Basic--500bpTSS CUP plasmid group were significantly increased after the Renilla fluorescence was normalized, that is, the CUP upstream sequence showed obvious transcriptional activity (increased luciferase reporter gene expression), but after the VDR binding site (VDRE) in the CUP upstream sequence mutated, the transcriptional activity of the CUP upstream sequence almost disappeared.

[0141] In summary, the results of the embodiments of the present invention show that:

[0142] 1. In the experiment of myocardial hypertrophy caused by aortic coarctation surgery in mice (TAC group), it was confirmed that the expression of CUP in the heart tissue of TAC mice was increased, the ejection fraction (EF) and short-axis shortening rate (FS) of the heart of TAC mice were reduced, and the parameters such as ventricular wall thickness, degree of fibrosis, and embryonic gene expression level were higher than those of mice in the sham operation group (Sham group), confirming that the expression of CUP was positively correlated with the degree of heart failure.

[0143] 2. CUP overexpression alleviated the changes in cardiac indicators caused by TAC, indicating that CUP overexpression has a protective effect on pathological myocardial hypertrophy and heart failure caused by TAC.

[0144] 3. The tail vein injection test of CUP overexpression virus packaged by adeno-associated virus can also alleviate the changes in cardiac indexes caused by pathological cardiac atrophy in mice induced by the head-ward distribution of body fluids due to tail-hanging simulated weightlessness. This shows that in vitro administration of CUP overexpression can alleviate myocardial atrophy caused by HU and prevent the occurrence of heart failure.

[0145] 4. CUP is produced through independent transcription, and VDR is a key transcription factor regulating CUP expression.

[0146] The present invention draws the following conclusions through animal experiments and analysis of heart tissue samples: 1. Overexpression of CUP in cardiomyocytes can be achieved by intravenous administration; 2. Overexpression of CUP in cardiomyocytes can counteract myocardial hypertrophy and decreased cardiac function caused by pressure overload; 3. Overexpression of CUP in cardiomyocytes can counteract myocardial atrophy and decreased cardiac function caused by pressure unloading.

[0147] The above are merely embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention are included in the scope of the claims of the present invention to be approved.

Claims

1. A use of CUP in the preparation of a drug for preventing and / or treating myocardial remodeling diseases; the nucleotide sequence of the CUP is shown in the sequence table SEQ NO.

1.

2. The use according to claim 1, characterized in that: The myocardial remodeling disease is caused by pressure overload or weightlessness in aerospace environment.

3. The use according to claim 1, characterized in that: The prevention and / or treatment of myocardial remodeling diseases is achieved by inhibiting the occurrence of pathological cardiac remodeling through overexpression of CUP.

4. Use of an overexpression plasmid containing CUP in the preparation of a drug for preventing and / or treating myocardial remodeling diseases.

5. Use of an adeno-associated virus carrying CUP overexpression in the preparation of a drug for the prevention and / or treatment of myocardial remodeling diseases.

6. The use according to claim 5, characterized in that: In the adeno-associated virus carrying CUP overexpression, the adeno-associated virus vector is an adeno-associated virus vector driven by a myocardium-specific promoter.

7. The use according to claim 6, characterized in that: The adeno-associated virus vector is an AAV9 vector.

8. The use according to claim 5, characterized in that: The adeno-associated virus carrying CUP overexpression is used by intravenous injection.

Images