Application of knockdown of cyclic Magi1 in the preparation of products for the treatment of high altitude cerebral edema

Abstract

The present invention provides an application of knocking down cyclic Magi1 in the preparation of a product for treating high-altitude cerebral edema, and belongs to the field of biomedical technology. The nucleotide sequence of the cyclic Magi1 of the present invention is shown in SEQ ID NO.1 or SEQ ID NO.2, and knocking down cyclic Magi1 treats high-altitude cerebral edema by increasing the level of SOD and reducing the expression level of inflammatory factors. The inventor unexpectedly found that the expression level of cyclic Magi1 in the hippocampus, hypothalamus, medulla oblongata, and cortical areas of the brain tissue of high-altitude cerebral edema model mice was significantly increased. By knocking out or knocking down cyclic Magi1, the weight of mice and the level of SOD in the blood can be significantly increased, the brain water content and the level of brain tissue inflammation can be reduced, and it has a significant effect of alleviating or treating high-altitude cerebral edema. The present invention is expected to provide new ideas for the relief or treatment of high-altitude cerebral edema.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to application of knocking down cyclic Magi1 in preparing products for treating high-altitude cerebral edema. Background Art

[0002] The plateau area occupies 26.8% of my country's territory and has significant characteristics. With the development of the economy, the population of the plains has moved to the plateau, and the prevalence of altitude illness (HAI) has increased. HAI is a series of diseases caused by the low-pressure and low-oxygen environment at high altitudes, such as acute mountain sickness (AMS), cerebral edema (HACE), pulmonary edema (HAPE), etc. Nearly half of the people who enter areas above 3000m for the first time will become ill, and AMS is particularly common. HACE is a severe form of AMS. Common symptoms of patients include headache, vomiting, impaired consciousness and ataxia. When the condition worsens, coma and brain herniation may occur within 1 to 2 days. If not treated in time or transferred to a low altitude area, the mortality rate is extremely high.

[0003] The pathogenesis of HACE involves vasogenic and cytotoxic brain edema, and the exact mechanism is still unclear. In addition, HACE has obvious individual and racial differences, suggesting that differences in gene expression are an important factor in the development of the disease, but the exact regulatory genes are still unclear. In order to effectively prevent and treat AMS / HACE, it is urgent to develop more effective treatments.

[0004] In recent years, circular RNA (circRNA) has become a research hotspot in the biomedical field due to its advantages of abundance in eukaryotic cells, tissue-specific expression, and evolutionary conservation. CircRNA has a unique circular structure, is not affected by RNA exonucleases, has stable expression, and can regulate the expression of other genes by binding to microRNA (miRNA). These characteristics make circRNA play an important role in gene expression regulation and disease occurrence and development.

[0005] The inventors previously discovered that circular RNA Magi1 can be highly expressed in brain tissue and very low in other tissue types. Its expression in the ischemic area in the ischemic stroke model is further increased and can be released into the blood, so it can be used as a potential molecular marker for stroke diagnosis (patent application number: 202210582160.6), and reducing its expression has a therapeutic effect on stroke (patent application number: 202210582170.X). Summary of the invention

[0006] The purpose of the present invention is to provide an application of knocking down cyclic Magi1 in preparing a product for treating high altitude cerebral edema, in order to provide a new method for the treatment of high altitude cerebral edema.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides an application of knocking down cyclic Magi1 in preparing a product for treating high altitude cerebral edema, wherein the nucleotide sequence of the cyclic Magi1 is shown as SEQ ID NO.1 or SEQ ID NO.2.

[0009] SEQ ID NO.1: GCACAACCCGATCTCCCAGAGAAGGAGAAGTGCCTGGCGTGGACTATAACT TTCTGACTGTGAAGGAGTTCTTGGACCTCGAGCAGAGTGGGACTCTTCTGGAAGTCGGCACCTATGAAGGAAACTATTATGGGACACCCAAGCCTCTAGCCAGCCAGTCAGTGGGAAAGTGATCACGACGGATGCCT TGCACAGCCTTCAGTCTGGCTCTAAGCAGTCGACCCCGAAGCGAACCAAGTCCTACAATGATATGCAAAATGCTGGCATAGTCCACGCGGAGAATGAGGAGGAGGATGACGTTCCTGAAATGAACAGCAGCTTTACAG

[0010] SEQ ID NO.2: GCACAACCCGGTCTCCCAGAGAAGGAGAAGTGCCTGGTGTGGATTACAGCT TTCTGACTGTGAAGGAGTTCTTGGACCTCGAGCAGAGCGGGACCCTGTTGGAAGTCGGCACCTATGAAGGAAACTATTATGGGACACCCAAACCTCCTAGCCAGCCAGTCAGTGGGAAAGTGATCACGACGGATGCCT TGCACAGCCTGCAGTCTGGCTCCAAGCAGTCGACCCCTAAGCGAACAAAGTCCTACAATGATATGCAAAATGCTGGCATAGTCCACCCGGAGAATGAGGAGGAGGAGGATGTCCCTGAAATGAACAGTAGCTTTACAG

[0011] Preferably, knocking down cyclic Magi1 treats high altitude cerebral edema by increasing SOD levels and reducing the expression levels of inflammatory factors.

[0012] Preferably, the inflammatory factors include IL-1β, IL-6 and TNF-α.

[0013] The present invention also provides use of a reagent for knocking down cyclic Magi1 in preparing a product for treating high-altitude cerebral edema.

[0014] Preferably, the reagent comprises interfering RNA for knocking out circular Magi1 or RNA in which the expression of circular Magi1 is inhibited obtained by gene editing.

[0015] Preferably, the interfering RNA includes siRNA or shRNA;

[0016] The nucleotide sequences of the shRNA are shown in SEQ ID NO.3 and SEQ ID NO.4;

[0017] The gene editing methods include Cas9 or TALEN technology.

[0018] SEQ ID NO.3: AATTCGCTTTACAGGCACAACCCGTTCAAGAGACGGGTTGTGCCTGTAAAGCTTTTTTG

[0019] SEQ ID NO.4: GATCCAAAAAAGCTTTACAGGCACAACCCGTCTCTTGAACGGGTTGTGCCTGTAAAGCG

[0020] Preferably, the reagent also comprises a delivery vector for the interfering RNA.

[0021] Preferably, the delivery vector comprises a viral vector, minicircle DNA or exosomes.

[0022] Preferably, the viral vector is an adeno-associated viral vector.

[0023] Preferably, the reagent includes AAV-encapsulated shRNA, exosome-encapsulated siRNA or minicircle-carried shRNA.

[0024] Preferably, the high altitude cerebral edema is high altitude cerebral edema caused by low pressure and low oxygen.

[0025] The inventor unexpectedly discovered that the expression of circ-Magi1 (circ-Magi1) in the hippocampus, hypothalamus, medulla oblongata, and cortex of the brain tissue of high-altitude cerebral edema model mice was significantly increased. Knocking out or knocking down circ-Magi1 can significantly increase the weight of mice and the level of SOD in the blood, reduce brain water content and brain tissue inflammation, and have a significant effect in relieving or treating high-altitude cerebral edema. The present invention is expected to provide new ideas for the relief or treatment of high-altitude cerebral edema. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0027] Figure 1 This is a schematic diagram of a low-pressure and low-oxygen chamber;

[0028] Figure 2 The weight changes of mice in the NC group and the HH group in Example 1;

[0029] Figure 3 The staining results of brain tissues of mice in the NC group and the HH group in Example 1;

[0030] Figure 4 The qPCR detection results of circ-Magi1 expression in brain tissues of NC group mice and HH group mice in Example 1;

[0031] Figure 5 The qPCR detection results of circ-Magi1 expression in brain tissues of mice in different treatment groups in Example 2;

[0032] Figure 6 The results of the detection of mouse circ-Magi1 expression in Example 3;

[0033] Figure 7 The detection result of human circ-Magi1 expression in Example 3;

[0034] Figure 8 The expression of human and mouse circ-Magi1 and Magi1 in Example 3;

[0035] Fig. 9 is the vector map of the interference vector pHBAAV-U6-MCS-CMV-EGFP in Example 4;

[0036] Fig.10 This is a schematic diagram of the QC standard judgment for mycoplasma detection in Example 5;

[0037] Fig.11 The results of the detection of circ-Magi1 expression in the brain of each group of mice in Example 6;

[0038] Fig.12 The weight changes of mice in each group in Example 7 are shown below:

[0039] Fig.13 The test results of brain water content of each group of mice in Example 7;

[0040] Fig.14 The HE staining results of brain tissues of mice in each group in Example 7;

[0041] Fig.15 The results of the test of SOD levels in the blood of each group of mice in Example 7;

[0042] Fig.16 These are the test results of the expression levels of inflammatory factors in the brain tissue of each group of mice in Example 7. DETAILED DESCRIPTION

[0043] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0044] The cell lines used in the following examples are all commercially available cell lines, among which the mouse hippocampal neuron cell line (HT22), the human neuron cell line (SH-SY5Y), and the AAV-293 cell line are all conventional commercially available products, and the cell lines derived from the ATCC cell bank can be used. Figure 1 The laboratory was built by Henan Academy of Sciences. The mice used were C57BL male black mice purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd.

[0045] Example 1 Preparation of high altitude cerebral edema model

[0046] Seven-week-old mice were selected, 3 in the control group and 8 in the modeling (low-pressure and low-oxygen group). After one week of adaptive feeding, a low-pressure and low-oxygen chamber was used to maintain the low-pressure and low-oxygen group (HH group) with an air pressure of 50% and an oxygen partial pressure of 9; the control group (NC group) was kept at normal pressure and normal oxygen; each group was maintained for 5 days, and the mice had free access to water and food. After 5 days, the mouse cages were taken out, and the activity, body weight, food intake and other indicators of the mice were observed and tested. The results showed that the activity of the HH group was lower than that of the NC group; the weight of the mice in the NC group increased, and the weight of the HH group decreased ( Figure 2 ); the food intake of the NC group increased, while that of the HH group decreased to a greater extent.

[0047] Staining steps: Take the brain, fix it in 4% paraformaldehyde fixative for 72 hours, transfer it to 60% ethanol, and send it to the pathology room for paraffin embedding. Make paraffin sections with a thickness of 5μm, develop the sections in a 45℃ water bath, and dry them at 37℃ overnight. Dewax the paraffin sections by immersing them in xylene three times, each time for 10 minutes. Rehydrate with gradient alcohol: 100% alcohol three times, 90% alcohol, 80% alcohol, and 70% alcohol once, each time for 5 minutes. Immerse in PBS for about 15 seconds and it can be used for staining. Add hematoxylin dye to the staining jar, immerse for 10 minutes, and rinse with water. After hematoxylin staining, immerse in 1% hydrochloric acid alcohol (1mL hydrochloric acid + 99mL 75% alcohol) for 3 seconds. Differentiate until the tissue appears red, and rinse with running water until the water droplets are clear. Immerse the blued slides in the eosin staining jar and stain for 2 minutes. Rinse with running water until clear. After staining, the slides were placed in 80% alcohol, 90% alcohol once, and 100% alcohol three times for dehydration, each time for 30 seconds; and in xylene three times for transparency, each time for 2 minutes. A drop of neutral gum was added to the slides after dehydration and transparency, and the slides were covered with coverslips, air-dried in a fume hood for one day, and then scanned under a microscope.

[0048] The staining results are as follows Figure 3 As shown, compared with the NC group, the HH group had more necrosis of neurons (HE-stained cytoplasm was dark eosin red, called red neurons), pyknosis of the neuron nuclei, shrinkage and deformation of the cell bodies, and disappearance of Nissl bodies, indicating that the modeling was successful.

[0049] To explore the expression of circ-Magi1 in various parts of mouse brain tissue, samples were collected from various brain regions of the NC group and the HH group, including the olfactory bulb, hippocampus, hypothalamus, pons, midbrain, medulla oblongata, cerebellum, and cortex. The relative expression level of RNA was detected by q-PCR. The test results are shown in Figure 4 As shown, it can be seen that compared with the NC group, the expression of circ-Magi1 and FTL in the hippocampus, hypothalamus, medulla oblongata, and cortex of the HH group was significantly increased.

[0050] Example 2 Expression of circ-Magi1 after hypoxia and hypoxia

[0051] In order to analyze the expression of circ-Magi1 in mouse brain tissue at different low-pressure and low-oxygen periods, the mice were divided into 7 groups, with 3 mice in each group, and fed under low-pressure and low-oxygen conditions for 0h, 6h, 12h, 1d, 2d, 3d and 5d, respectively. The mice were then killed and the brain tissues were taken for RNA extraction. The RNA extraction process was as follows:

[0052] 1. Preparation of RNA samples

[0053] (1) Sample pretreatment: Weigh 0.1 g of brain tissue and place it in a 1.5 mL RNase-free centrifuge tube. Add 200 μL TRIpure Reagent. Cut the tissue into small pieces with scissors. Grind the tissue thoroughly with an electric grinder on ice. Add TRIpure Reagent to make up to 1 mL.

[0054] (2) Add 200 μL of chloroform into the centrifuge tube, shake thoroughly for 15 seconds, and place at room temperature for 3 minutes.

[0055] (3) After centrifugation at 4°C and 12,000 rpm for 15 min, the sample was observed to be divided into three layers. Take 500 μL of the supernatant and transfer it to a new 1.5 mL RNase-free centrifuge tube.

[0056] (4) Add 500 μL of isopropanol, mix well, and let stand at room temperature for 10 min.

[0057] (5) After centrifugation at 4°C and 12,000 rpm for 10 min, a white precipitate was visible at the bottom of the tube.

[0058] (6) Discard the supernatant and add 1 mL of 80% ethanol and wash the RNA by inverting the tube.

[0059] (7) Centrifuge at 4°C, 7500 rpm for 5 min.

[0060] (8) Discard the supernatant and remove as much residual ethanol as possible. Allow the solution to stand at room temperature for 3 min to evaporate the residual ethanol and add 20 μL RNase-free DEPC water to dissolve the RNA.

[0061] (9) The integrity of the extracted RNA samples was checked by agarose gel electrophoresis.

[0062] (10) Use NanoDrop2000 to test the concentration and purity of the extracted RNA samples.

[0063] 2. Preparation of cDNA

[0064] Reverse transcription was performed using the Evo M-MLVRTKitwith gDNAClean for qPCR kit.

[0065] (1) Removal of genomic DNA

[0066] Table 1 Reaction system

[0067] Reagents Dosage gDNACleanReagent 1μL 5×gDNACleanBuffer 2μL Total RNA 1 μg RNase-free water up to 10 μL

[0068] After mixing the above reagents, place them in a PCR instrument and react at 42°C for 2 minutes, and store them at 4°C for later use.

[0069] (2) Reverse transcription reaction

[0070] Table 2 Reverse transcription system

[0071] Reagents Dosage Step (1) reaction solution 10μL EvoM-MLVRTaseEnzymeMix 1μL RTPrimerMix 1μL 5×RTaseReactionBufferMixI 4μL RNase-free water 4μL

[0072] After mixing the above reagents, place in a PCR instrument at 37°C for 15 minutes and 85°C for 5 seconds. The obtained cDNA sample is stored in a -20°C refrigerator. After diluting 50 times, it can be used for subsequent RT-qPCR reactions.

[0073] 3. RT-qPCR

[0074] Table 3 RT-qPCR primer sequences

[0075]

[0076]

[0077] Table 4 Fluorescence quantitative PCR reaction system

[0078] Reagents Dosage 2×SYBR Green qPCR mix 10μL Forward primer (10 μM) 0.5μL Reverseprimer (10 μM) 0.5μL cDNA 5μL <![CDATA[ddH2O]]> 4μL

[0079] The fluorescence quantitative PCR reaction procedure is:

[0080]

[0081] Three replicate wells were set for each sample to reduce random errors.

[0082] qPCR results are as follows Figure 5 As shown, compared with the NC group (i.e., the group fed with hypobaric hypoxia for 0 h), there was no significant difference in circ-Magi1 in mouse brain tissue under hypobaric hypoxia for 6 h, but it was significantly increased under hypobaric hypoxia for 12 h, 1 d, 2 d, 3 d, and 5 d. The q-PCR results of circ-Magi1 in peripheral blood did not change.

[0083] Example 3 Screening of shRNA

[0084] For circular RNA, 11 pairs of human / mouse common effective sequences were designed at the loop interface, as shown in Table 5. The shRNA1 sense chain and antisense chain were synthesized by Sangon Biotechnology Co., Ltd. The two chains were mixed and added with water and buffer for annealing (the reaction system was carried out according to the buffer manual) to form a double-stranded fragment with a sticky end of the restriction site.

[0085] Table 5 Human / mouse common effective sequences

[0086]

[0087]

[0088]

[0089]

[0090] The above double-stranded fragments (i.e., interference fragments) were connected to the pHBAAV-U6-MCS-CMV-EGFP vector by enzyme cutting, and transformed into DH5α competent cells respectively. Positive clones were screened and sequenced for verification. After they were correct, experiments were carried out.

[0091] Mouse hippocampal neuron cell line (HT22) was cultured in a 37°C, 5% CO2 incubator in a HDMEM medium (purchased from Thermo Fisher Scientific) containing 10% FBS (purchased from Helios), transferred to a 6-well plate and cultured to 60% confluence, transfected using Lipo3000 transfection reagent according to the instructions, and the expression of mouse circ-Magi1 was detected after 3 days. The test results are shown in Figure 6 As shown, it can be seen that shRNA1 to shRNA11 all have certain inhibitory effects, among which shRNA10 has the best effect.

[0092] The human neuronal cell line (SH-SY5Y) was cultured in a 37°C, 5% CO2 incubator in a HDMEM medium (purchased from Thermo Fisher Scientific) containing 10% FBS (purchased from Helios), transferred to a 6-well plate and cultured to 60% confluence, and transfected using Lipo3000 transfection reagent according to the instructions. The expression of human circ-Magi1 was detected after 3 days. The results are shown in Figure 7 As shown, it can be seen that shRNA1 to shRNA11 all have certain inhibitory effects, among which shRNA7 has the best effect.

[0093] The length of siRNA is usually 19 to 25 nucleotides. Shorter siRNA sequences are easy to synthesize and transfect, while longer siRNA sequences have better specificity and stability. In order to further reduce the potential inhibition of the linear Magi1 gene (i.e., potential off-target effects) and to facilitate the use of both mice and humans, the siRNA sequences and primers in Table 5 are further optimized to the following sequence: 19-base siRNA-x is consistent with mouse siRNA4, siRNA10; partial sequences in human siRNA4, siRNA5:

[0094] siRNA-x sequence: GCTTTACAGGCACAACCCG (SEQ ID NO. 78)

[0095] shRNA-x sequence:

[0096] shRNA-x positive strand: AATTCGCTTTACAGGCACAACCCGTTCAAGAGACGGGTTGTGCCTGTAAAGCTTTTTTG (SEQ ID NO. 3)

[0097] shRNA-x antisense strand: GATCCAAAAAAGCTTTACAGGCACAACCCGTCTCTTGAACGGGTTGTGCCTGTAAAGCG (SEQ ID NO.4)

[0098] The sense strand and antisense strand mentioned above were synthesized by Sangon Biotech Co., Ltd. After the two strands were mixed, water and buffer were added for annealing (the reaction system was carried out according to the buffer manual) to form a double-stranded fragment with a sticky end of the restriction site.

[0099] The above double-stranded fragments (i.e., interference fragments) were connected to the pHBAAV-U6-MCS-CMV-EGFP vector by enzyme cutting, and transformed into DH5α competent cells respectively. Positive clones were screened and sequenced for verification. After they were correct, experiments were carried out.

[0100] The results were further verified in human neuronal cell line (SH-SY5Y) and mouse hippocampal neuronal cell line (HT22). The specific process is as follows:

[0101] SH-SY5Y and HT22 were transferred to 6-well plates and cultured to 60% confluence, and divided into control group (no transfection), shRNA-NC group (transfected with shRNA-NC) and shRNA-x. Lipo3000 transfection reagent was used and transfected according to the instructions. Each group had 3 replicates. After 3 days, qPCR was used to detect the expression of circ-Magi1. The qPCR primers for circ-Magi1 were the same as those in Example 2. The qPCR primers for Magi1 were as follows:

[0102] Human Magi1 Primers:

[0103] ForwardPrimer:GAACAAGGACCTGCGACATTT(SEQ ID NO.79)

[0104] Reverse Primer:ACAGCATGGCGGTAAAGGTTA(SEQ ID NO.80)

[0105] Mouse Magi1 Primers:

[0106] ForwardPrimer: ATGCAAAATGCTGGCATAGTCC (SEQ ID NO.81)

[0107] Reverse Primer: AGAGTCGGCTGTAAAGCTACT(SEQ ID NO.82)

[0108] The results are as follows Figure 8 As shown, it can be seen that shRNA-x has an inhibitory effect on the expression of both human and mouse circ-Magi1, but has no inhibitory effect on the expression of human and mouse Magi1.

[0109] Example 4 shRNA vector preparation

[0110] The interference vector used was pHBAAV-U6-MCS-CMV-EGFP, and the vector map is shown in Fig. 9 shown.

[0111] 1) The control viral vector siRNA sequence and shRNA sequence are as follows:

[0112] siRNA sequence: TTCTCCGAACGTGTCACGTAA (SEQ ID NO.83)

[0113] shRNA sequences:

[0114] Justice chain: GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTC (SEQ ID NO.84)

[0115] Antisense strand: AATTGAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGAATTACGTGACACGTTCGGAGAACG (SEQ ID NO.85)

[0116] 2) Target gene siRNA sequence and shRNA sequence:

[0117] siRNA sequence: GCTTTACAGGCACAACCCG (SEQ ID NO. 78)

[0118] shRNA sequences:

[0119] Justice chain: AATTCGCTTTACAGGCACAACCCGTTCAAGAGACGGGTTGTGCCTGTAAAGCTTTT TTG (SEQ ID NO.3)

[0120] Antisense strand: GATCCAAAAAAGCTTTACAGGCACAACCCGTCTCTTGAACGGGTTGTGCCTGTAAA GCG (SEQ ID NO.4)

[0121] The double-stranded fragments in 1) and 2) above were respectively connected to the vector by enzyme digestion, and DH5α competent cells were transformed respectively. Positive clones were screened and sequenced for verification. The sequencing results of shRNA1 targeting circular knockdown or knockout of circular RNA Magi1 were compared and analyzed. The sequencing results showed that the sequencing results were consistent with the target sequence, and the target plasmid was successfully constructed. The successfully constructed plasmid was extracted according to the method in the extraction kit manual, and the extracted plasmid was used to transfect cells after being verified by QC.

[0122] Example 5 Preparation of adeno-associated virus-encapsulated shRNA

[0123] 1. Selection of cell lines, strains and adeno-associated virus packaging systems

[0124] Packaging cell line: 293T, adeno-associated virus packaging cells, are anchorage-dependent epithelial cells, and the growth medium is DMEM (containing 10% FBS). The adherent cells grow and proliferate to form a monolayer of cells after culture.

[0125] Bacteria strains: Escherichia coli strain Stbl3, used for amplification of adeno-associated virus vectors and auxiliary packaging vector plasmids.

[0126] Adeno-associated virus packaging system (three-plasmid system): pAAV-RC, pHelper and shuttle plasmid (carrying target gene or shRNA).

[0127] 2. Adeno-associated virus packaging

[0128] Cell culture: AAV-293 cells were subcultured into 100 mm dishes for transfection and placed in an incubator at 37°C, 5% CO2 and 95% relative humidity.

[0129] Transfection: Transfection can be performed when the cell culture density reaches about 80-90% confluence.

[0130] Lipofectamine transfection: OptiMEM needs to be preheated in a 37°C water bath. TM The transfection reagent (purchased from Hanheng Bio) needs to be restored to room temperature before use and needs to be shaken before use. The transfection complex components required for transfection of a 100 mm plate are 10 μg of PAAV-RC plasmid, 20 μg of pHelper plasmid, 10 μg of shuttle plasmid, and 10 μg of Lipofiter TM 120μL.

[0131] Medium change: 6 h after transfection, replace with fresh complete medium containing 10% fetal bovine serum (FBS).

[0132] Cell collection: 72 h after transfection, gently scrape the cells containing AAV particles with a cell scraper and collect them in a 15 mL centrifuge tube. Centrifuge at 150 × g for 3 min to collect the cells, remove the culture supernatant, wash once with PBS, and finally resuspend the cells in 300 μL PBS.

[0133] Cell disruption: Prepare a 37°C constant temperature water bath and liquid nitrogen, and freeze and thaw the centrifuge tube containing cells three times in liquid nitrogen and a 37°C water bath. 4°C, 2000×g, 5 min, remove cell debris, and collect the lysis supernatant containing AAV particles.

[0134] 3. Purification of AAV

[0135] Universal nuclease treatment: Add 0.1 μL Benonase enzyme to each 1 mL of crude virus extract, incubate in 37°C water bath for 1 hour to remove the cell genome and residual plasmid DNA in the virus solution. Centrifuge at 600×g, 4°C for 10 minutes and take the supernatant.

[0136] Column purification was performed according to Biomiga adeno-associated virus purification kit V1469-01, and 4 mL of AAV virus sample liquid obtained by column purification was added to an ultrafiltration tube and centrifuged at 1400 × g for 30 min to obtain about 1 mL of AAV. The purified virus was collected and stored at -80°C.

[0137] 4. Quality testing of adeno-associated viruses

[0138] 1) Sterility testing

[0139] Detection method: Take 10 μL of virus and add it to Hela cells in a 96-well plate for verification. Incubate for 24 hours and then examine under a microscope. QC standard: The culture medium must be clear and transparent, with no obvious particles between cells and no bacterial or fungal contamination.

[0140] 2) Mycoplasma detection

[0141] Detection method: Take 10 μL of virus, incubate in 96℃ water bath for 15 minutes, and then set up PCR reaction system in clean bench. After PCR reaction, perform electrophoresis to determine whether there is mycoplasma contamination.

[0142] QC standard: No obvious mycoplasma bands in the PCR gel image. Fig.10 As shown, if there is a band around 500bp, such as 1, 2, 3, and 6, it means that the sample is contaminated with mycoplasma, and if there is no band at 4 or 5, it means that there is no mycoplasma contamination.

[0143] 3) Titer detection

[0144] Real-time fluorescence quantitative PCR (Quantitative Real-time PCR) and SYBRGreen method were used to detect the AAV genome content and thus determine the AAV titer. The primer sequence used in the fluorescence quantitative PCR was WPRE or ITR, and the primer sequence was as follows:

[0145] F-WPRE: 5'-ACGCTATGTGGATACGCTGC-3' (SEQ ID NO.86)

[0146] R-WPRE: 5'-CGGGCCACAACTCCTCATAA-3' (SEQ ID NO.87)

[0147] F-ITR: 5'-CGGCCTCAGTGAGCGA-3' (SEQ ID NO.88)

[0148] R-ITR: 5'-AGGAACCCCTAGTGATG-3' (SEQ ID NO.89)

[0149] Experimental steps:

[0150] 1) Use DNase I and proteinase K to digest AAV virus samples; DNase I enzyme reaction system is: DNase I enzyme 10μL, buffer 6μL, water 41μL, AAV sample 3μL; 37℃ water bath for 1h, then 100℃ for 10min, then add 2μL proteinase K, 55℃ water bath for 1h, 100℃ for 10min, and centrifuge.

[0151] 2) Dilute the standard plasmid and set the copy gradient of the standard to 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 ;

[0152] 3) Configure the qPCR reaction system, design 3 replicate wells for each sample and standard, configure the system according to the qPCR kit, and perform the qPCR reaction. Use the Ct mean of each group of AAV standards as the ordinate Y, and the logarithm of the corresponding copy number as the abscissa X to make a standard curve, and obtain the function formula and R square value of the standard curve: formula y = -2.851x + 32.296, R 2 =0.9957.

[0153] 3) Calculation of the titer of the sample to be tested. Substitute the Ct mean of the AAV sample to be tested into the standard curve formula, calculate the number of copies of the added AAV template X, and then convert it into titer. The conversion formula is: AAV virus titer = 10x ×40000 (dilution factor) μg / mL

[0154] The results are as follows:

[0155] The titer of virus AVV-shRNA in the experimental group = 1.6×10 12 μg / mL.

[0156] Control virus AAV-NC titer = 1.9 × 10 12 μg / mL.

[0157] Example 6 AAV-encapsulated shRNA knocks down circ-Magi1 in mouse brain

[0158] The mice were divided into three groups: control group (NC group), AAV-NC group and AAV-shRNA group, with 3 mice in each group. The NC group was not treated, the AAV-NC group was injected with AAV-NC, and the AAV-shRNA group was injected with AAV-shRNA. The titer of the injected virus was 1.3×10 12 μg / mL, 5 μL was injected into the cerebral ventricle of each mouse. The expression of circ-Magi1 in the brain of each group of mice was detected one week later. The test results are as follows Fig.11 shown.

[0159] Depend on Fig.11 It can be seen that compared with the control group, the expression level of circ-Magi1 in the AAV-NC group was not different, while the expression level in the AAV-shRNA group was about 0.45 times that of the control group, which was significant. This indicates that the AAV-NC group cannot reduce the expression level of circ-Magi1, while AAV-shRNA can significantly inhibit the expression of circ-Magi1 in brain tissue.

[0160] Example 7 AAV-encapsulated shRNA knockdown / knockout of circ-Magi1 on the prevention / treatment of high altitude cerebral edema

[0161] Eight-week-old healthy male mice were divided into three groups: control group (NC group), model group, and treatment group. The NC group was not injected with AAV and was not stimulated by hypobaric hypoxia. The model group mice were injected with AAV-NC intracerebroventricularly, and the treatment group mice were injected with AAV-shRNA intracerebroventricularly. The virus titers of AAV-NC and AAV-shRNA were both 1.3×10 12 μg / mL, 5 μL was injected into the intracerebral ventricle of each mouse. One week after the injection, the mice in the model group and the mice in the treatment group were placed in a low-pressure and low-oxygen chamber, and the mice in each group were tested on the 9th day.

[0162] 1. Weight change detection

[0163] The low pressure and low oxygen environment of the plateau will put the body in a state of stress and have a certain impact on the gastrointestinal tract, leading to abnormal eating and a significant decline in body weight in a short period of time. The weight of mice was recorded every day. The weight changes of each group on the 9th day compared with the 0th day were as follows: Fig.12 As shown, it can be seen that the weight of mice in the NC group increased slightly; the average weight of mice in the model group decreased by about 0.5g, indicating that they had altitude sickness; the weight of mice in the treatment group remained basically stable, which was significantly different from that of mice in the model group, indicating that AAV-shRNA has a therapeutic effect on altitude sickness.

[0164] 2. Brain water content detection

[0165] On the 9th day, the mice were taken out, and 4 mice were randomly selected from each group. The brain tissue was taken out, the wet weight was weighed, and then placed in an oven. After baking at 60℃ for 3 days, the dry weight was weighed. The brain water content was calculated according to the following formula. The calculation results are as follows: Fig.13 shown.

[0166] Brain water content (%) = (brain wet weight - brain stem weight) / brain stem weight × 100%

[0167] Depend on Fig.13 It can be seen that the brain water content of the model group mice was significantly increased compared with that of the NC group, indicating the occurrence of cerebral edema; the brain water content of the treatment group mice was significantly decreased compared with that of the model group mice, indicating that AAV-shRNA has a significant alleviating effect on cerebral edema caused by altitude sickness.

[0168] 3. Observation of brain tissue morphology

[0169] The mouse brain tissue was stained with HE using the same method as in Example 1. The staining results are shown in Figure 1. Fig.14 As shown. It can be seen that a large number of nerve cell nuclei condensed in the model group mice (as shown by the arrow in the figure, accounting for about 24.8±5.4%), the cell body shrank and deformed, and the Nissl body disappeared, while about 5.8±0.4% of the NC group had nuclear condensation, and the treatment group (about 13.3±1.2%) was significantly relieved compared with the model group, indicating that AAV-shRNA has a significant alleviating effect on high-altitude cerebral edema.

[0170] 4. Serum oxidative stress level detection

[0171] The detection method uses the CuZn / Mn-SOD activity detection kit (WST-8 method):

[0172] Collect mouse blood in anticoagulant tubes, 4 blood samples per group, mix thoroughly by inversion, centrifuge at 4°C, 600 g for 10 min, and take the supernatant into another 1 mL centrifuge tube.

[0173] Preparation of the kit:

[0174] 1) Prepare WST-8 / enzyme working solution: Mix 1 μL enzyme solution, 151 μL SOD detection buffer and 8 μL WST-8 to obtain 160 μL WST-8 / enzyme working solution. Prepare WST-8 enzyme working solution before use and store at 4°C.

[0175] 2) Prepare the reaction start working solution: melt the reaction start solution (40×) and mix well, and dilute each 1 μL of the reaction start solution (40×) with 39 μL of SOD buffer to obtain the reaction start working solution. The reaction start working solution should be prepared before use and stored at 4°C.

[0176] Sample detection: The detection system is shown in Table 6. Samples and blank controls were added to a 96-well plate, mixed, and incubated at 37°C for 30 minutes. The absorbance was measured at 450 nm.

[0177] Table 6 Detection system

[0178] Sample / Standard Blank1 Blank2 Blank3 Samples to be tested 20μL - - 20μL SOD detection working solution - 20μL 40μL 20μL WST-8 / Enzyme working solution 160μL 160μL 160μL 160μL Reaction start-up solution 20μL 20μL - -

[0179] The results of the test are as follows Fig.15 As shown, it can be seen that the SOD in the blood of mice in the NC group was about 105.1U / mL, and that in the AAV-NC group decreased to 66.8U / mL, which was significantly different from that in the NC group; the SOD in the AAV-shRNA treatment group recovered to about 79.8U / mL, which was significantly different from that in the AAV-NC group.

[0180] 5. Detection of the expression level of inflammatory factors in brain tissue

[0181] The primer sequences used are shown in Table 7, and the test results are shown in Table 7. Fig.16 As shown, it can be seen that the IL-1β, IL-6 and TNF-α in the brain tissue of mice in the AAV-NC and AAV-shRNA groups were significantly increased to varying degrees compared with those in the NC group, and the levels of IL-1β, IL-6 and TNF-α in the brain tissue of mice in the AAV-shRNA group were significantly reduced compared with those in the AAV-NC group, and the inflammatory response was significantly alleviated, indicating that knocking down or knocking out circ-Magi1 in brain tissue can significantly reduce the expression level of inflammatory factors in brain tissue.

[0182] Table 7 Primer sequences used in detecting the expression level of inflammatory factors

[0183] Primer name Primer sequence (5'-3') m-Actin-F TCCACACCCGCCACCAG SEQ ID NO.90 m-Actin-R TGACCCATTCCCACCATCACA SEQ ID NO.91 m-circ-Magi1-F TCTGCTCGAGGTCCAAGAAC SEQ ID NO.92 m-circ-Magi1-R CAGTAGCTTTACAGGCACAACC SEQ ID NO.93 m-IL-6-F CTCCCAACAGACCTGTCTATAC SEQ ID NO.94 m-IL-6-R CCATTGCACAACTCTTTTCTCA SEQ ID NO.95 m-IL-1β-F TGAAATGCCACCTTTTGACAG SEQ ID NO.96 m-IL-1β-R CCACAGCCACAATGAGTGATAC SEQ ID NO.97 m-TNF-1α-F GGTGCCTATGTCTCAGCCTCTT SEQ ID NO.98 m-TNF-1α-R GCCATAGAACTGATGAGAGGGAG SEQ ID NO.99

[0184] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of knocking down cyclic Magi1 in preparing a product for treating high altitude cerebral edema, characterized in that: The nucleotide sequence of the circular Magi1 is shown as SEQ ID NO.1 or SEQ ID NO.

2.

2. The use according to claim 1, characterized in that Knockdown of cyclic Magi1 treats high-altitude cerebral edema by increasing SOD levels and reducing the expression levels of inflammatory factors.

3. The use according to claim 2, characterized in that The inflammatory factors include IL-1β, IL-6 and TNF-α.

4. Use of an agent for knocking down cyclic Magi1 in the preparation of a product for treating high-altitude cerebral edema.

5. The use according to claim 4, characterized in that The reagent contains interfering RNA for knocking out circular Magi1 or RNA in which the expression of circular Magi1 is inhibited obtained by gene editing.

6. The use according to claim 5, characterized in that The interfering RNA includes siRNA or shRNA; The nucleotide sequences of the shRNA are shown in SEQ ID NO.3 and SEQ ID NO.4; The gene editing methods include Cas9 or TALEN technology.

7. The use according to claim 6, characterized in that The reagent also includes a delivery carrier for the interfering RNA.

8. The use according to claim 7, characterized in that The delivery vector includes a viral vector, minicircle DNA or exosomes.

9. The use according to claim 8, characterized in that The viral vector is an adeno-associated viral vector.

10. The use according to any one of claims 4 to 9, characterized in that: The high altitude cerebral edema is high altitude cerebral edema caused by low pressure and low oxygen.

Images