Application of PTGR1 gene and inducer thereof in preparation of medicine for preventing and / or treating renal injury diseases

Abstract

The invention discloses application of a PTGR1 gene and an inducer thereof in preparation of drugs for preventing and / or treating renal injury diseases, and belongs to the technical field of biological medicines. The relation between the PTGR1 gene and the renal injury caused by oxidative stress is determined for the first time, it is found that inhibition of PTGR1 gene expression can significantly increase oxidative stress and cytotoxicity caused by aristolochic acid, induction of PTGR1 gene expression can significantly reduce cytotoxicity caused by aristolochic acid, the cell survival rate is increased, and the renal injury caused by oxidative stress can be inhibited. It is proved that high-level expression of the PTGR1 gene has the effect of improving the renal injury caused by oxidative stress represented by the aristolochic acid nephropathy, the PTGR1 gene can serve as a target gene in treatment of the renal injury represented by the aristolochic acid nephropathy, and an inducer / agonist of the PTGR1 gene can be used for preparing a medicine for preventing and / or treating the renal injury disease.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of PTGR1 gene and its inducer in the preparation of drugs for preventing and / or treating kidney damage diseases. Background Art

[0002] Aristolochic acid (AA) is a secondary metabolite naturally present in Aristolochicaceae plants, among which aristolochic acid I (AAI) is one of the most common compounds. The toxicity of aristolochic acid and its impact on human health have received widespread attention. On the one hand, aristolochic acid can be activated by metabolism in animals to produce active intermediates and DNA adducts, induce gene mutations, and thus produce carcinogenic effects, so it is also listed as a Class I carcinogen; on the other hand, aristolochic acid can also cause severe renal damage, which is also called aristolochic acid nephropathy (AAN), characterized by rapid deterioration of renal function, renal scarring, extensive tubulointerstitial fibrosis and atrophy. In renal epithelial cells, aristolochic acid induces the production and release of a large amount of reactive oxygen species (ROS), produces signal molecules such as lipid peroxides, and causes cell apoptosis. Therefore, aristolochic acid nephropathy also represents an important type of renal damage caused by oxidative stress.

[0003] Aristolochic acid is a natural product with a wide range of sources and applications, and has a variety of exposure pathways, including exposure from Chinese herbal medicines and environmental sources into the human food chain. This has led to aristolochic acid nephropathy occurring worldwide, and there is still a lack of corresponding treatment options. Current prevention and treatment strategies are mostly focused on disease prevention or intervention in the acute phase of the disease, such as reducing the exposure to aristolochic acid or reducing the activity of aristolochic acid metabolizing enzymes to reduce the formation of active metabolites; or reducing renal damage caused by oxidative stress caused by aristolochic acid through antioxidant, anti-inflammatory, anti-fibrotic and anti-apoptotic treatments.

[0004] Prostaglandin reductase 1 (PTGR1) is a member of the medium-chain dehydrogenase / reductase (MDR) family, and has the activities of 15-oxopregnanol 13-reductase and leukotriene B4 12-hydroxydehydrogenase. PTGR1 is involved in the metabolic pathway of arachidonic acid and is a key enzyme in regulating the metabolic processes of lipids such as prostaglandins and leukotrienes. It has many important biological functions in maintaining metabolic balance, regulating inflammation, anti-oxidation, cell proliferation and apoptosis. In addition, the expression of the PTGR1 gene is also closely related to the development of various metabolic diseases and tumors, and is considered to be an important biomarker and therapeutic target.

[0005] Although the PTGR1 gene is involved in a variety of physiological and pathological processes, its current research focuses mainly on cancer, such as prostate cancer, liver cancer, and bladder cancer, and it has not yet been used clinically for disease treatment. Based on the fact that the PTGR1 gene can effectively reduce lipid peroxidation products, resist oxidative stress, and reduce cytotoxicity, it may have a certain protective effect on renal damage caused by oxidative stress caused by substances such as aristolochic acid.

[0006] Some lepidopteran insects, represented by the butterfly Pachliopta aristolochiae, feed exclusively on Aristolochiaceae plants and store AA as a means of chemical defense. Therefore, Pachliopta aristolochiae represents a good model for tolerance to aristolochic acid toxicity in nature. Studies on the genome structure and gene expression patterns of Pachliopta aristolochiae will help reveal the adaptive mechanisms of AA metabolism and detoxification, and provide new ways to further understand and prevent AA-induced oxidative stress. Summary of the invention

[0007] The purpose of the present invention is to provide the use of the PTGR1 gene and its inducer in the preparation of drugs for preventing and / or treating kidney damage diseases, to determine for the first time the relationship between the PTGR1 gene and kidney damage represented by aristolochic acid nephropathy, to propose the PTGR1 gene as a target gene in the treatment of kidney damage represented by aristolochic acid nephropathy, and to prepare drugs for preventing or treating kidney damage diseases, especially targeted drugs or small molecule biological preparations.

[0008] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0009] The present invention provides the use of PTGR1 gene and its inducer in preparing medicine for preventing and / or treating kidney injury disease.

[0010] Preferably, the renal damage disease is aristolochic acid nephropathy, including renal damage caused by oxidative stress induced by aristolochic acid.

[0011] Preferably, the drug is a targeted drug, with the PTGR1 gene as a drug target or target gene.

[0012] More preferably, the targeted drug is selected from one or more of siRNA, dsRNA, and shRNA targeting the PTGR1 gene.

[0013] Preferably, the targeted drug is siRNA targeting the PTGR1 gene, and the siRNA includes siRNA-1 and siRNA-2, wherein:

[0014] The sense strand sequence of siRNA-1 is GCCAAAGUUGUGGAAAGUAUU (SEQ ID NO: 1);

[0015] The sequence of the antisense strand of siRNA-1 is UACUUUCCACAACUUUGGCUU (SEQ ID NO: 2);

[0016] The sense strand sequence of siRNA-2 is CAGAGAUUGUUAUCUAUCAGG (SEQ ID NO: 3);

[0017] The antisense strand sequence of siRNA-2 is UGAUAGAUAACAAUCUCUGGG (SEQ ID NO: 4).

[0018] More preferably, the targeted drug is a PTGR1 inducer, which induces high-level expression of the PTGR1 gene; or the targeted drug is a PTGR1 agonist, which activates high-level expression of the PTGR1 gene.

[0019] Preferably, the drug further comprises a pharmaceutically acceptable carrier selected from one or a combination of two or more of a buffer, an encapsulating agent, a filler, an adhesive, a transdermal absorbent, a wetting agent, a disintegrant, an absorption enhancer, a surfactant, a colorant, a flavoring agent and an adsorbent.

[0020] Preferably, the drug is prepared as a pharmaceutically acceptable preparation, and the dosage form is selected from one or a combination of two or more of tablets, capsules, pills, granules, suspensions, oral solutions, sprays, and injections.

[0021] The present invention also provides a pharmaceutical composition, which includes siRNA targeting the PTGR1 gene, wherein the siRNA includes siRNA-1 and siRNA-2, wherein the sense chain sequence of siRNA-1 is shown as SEQ ID NO:1, and the antisense chain sequence is shown as SEQ ID NO:2; the sense chain sequence of siRNA-2 is shown as SEQ ID NO:3, and the antisense chain sequence is shown as SEQ ID NO:4; and also includes a pharmaceutically acceptable carrier.

[0022] The present invention has experimentally found that in the insect Papilio rubrum that feeds on Aristolochrysis, the PTGR1 homologous gene is significantly expanded and expressed at a high level after AAI treatment. By changing the expression level of the PTGR1 gene through RNA interference technology and small molecule inducers, the relationship between the PTGR1 gene and renal damage represented by aristolochic acid nephropathy was determined for the first time, as follows: (1) Inhibition of PTGR1 gene expression can significantly increase the oxidative stress caused by AAI; (2) Inhibition of PTGR1 gene expression can significantly increase the cytotoxicity caused by AAI; (3) Induction of PTGR1 gene expression can significantly reduce the cytotoxicity caused by AAI. In the aristolochic acid nephropathy model, inhibition of PTGR1 gene expression leads to higher levels of oxidative stress biomarker 4-hydroxy-2-nonenal (4-HNE) in AAI-treated cells, and causes more severe cytotoxicity and reduces cell survival rate; while induction of PTGR1 gene expression can significantly reduce the cytotoxicity caused by AAI and improve cell survival rate. Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention determines for the first time the relationship between the PTGR1 gene and renal damage represented by aristolochic acid nephropathy, that is, high expression of the PTGR1 gene has the effect of improving renal damage caused by oxidative stress, and proposes the PTGR1 gene as a drug target or a target gene in treatment, which is applied to the prevention and / or treatment of renal damage represented by aristolochic acid nephropathy, providing a basis and new strategy for the research and treatment of aristolochic acid nephropathy and other renal damage caused by oxidative stress. In particular, it is proposed that siRNA targeting the PTGR1 gene and PTGR1 inducers / agonists are applied to the prevention and / or treatment of renal damage represented by aristolochic acid nephropathy, which has important clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 A: Phylogenetic tree of the PTGR gene family in Papilio rubripes and various lepidopteran insects; B: Bar graph of the number of PTGR genes in Papilio rubripes and various lepidopteran insects.

[0025] Figure 2 It is a bar graph of the PTGR gene expression level of the Swallowtail butterfly larvae in the example, showing the average FPKM values ​​of the AAI treatment group and the control group; * indicates that the Wald test P value is less than 0.05, and *** indicates that the P value is less than 0.001.

[0026] Figure 3A: A bar graph of gene silencing induced by siRNA targeting PTGR1 gene in RT4 cells in the embodiment, showing the relative expression level of PTGR1 gene compared with the negative control, and the data are expressed as mean ± standard error; B: A bar graph of the 4-HNE protein adduct level produced by PTGR1 gene knockdown cells and control group cells after 1 μM AAI treatment for 24 hours; C: The level of 4-HNE protein adduct was detected based on protein immunoblotting (Western Blot), * indicates that the T test P value is less than 0.05, ** indicates that the P value is less than 0.01, and *** indicates that the P value is less than 0.001.

[0027] Figure 4 The cell survival rates of PTGR1 gene knockdown cells and control group cells after being treated with different concentrations of AAI (0-2 μM) in the example.

[0028] Figure 5 A: D3T induces high-level expression of PTGR1 gene in RT4 cells in the embodiment, showing the relative expression level of PTGR1 gene after 62.5 μM and 125 μM D3T treatment compared with the negative control, the data are expressed as mean ± standard error, *** indicates that the T test P value is less than 0.001; B: Cell survival rate of D3T-treated cells and control group cells after treatment with different concentrations of AAI (0-2 μM). DETAILED DESCRIPTION

[0029] In order to make the purpose, technical solution and advantages of the embodiment of the present invention clearer, the technical solution of the embodiment of the present invention will be clearly and completely described in conjunction with the drawings of the embodiment of the present invention. Obviously, the described embodiment is a part of the embodiment of the present invention, not all of the embodiments. Based on the described embodiment of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0030] Unless otherwise specified, the materials, reagents, etc. used in the following examples can be obtained through commercial channels; the experimental methods used can be carried out according to conventional methods or according to the instructions of the product manufacturer unless otherwise specified.

[0031] The cells used in the following examples are human bladder transitional cell papilloma cells (RT4), which were purchased from the Cell Bank of the Chinese Academy of Sciences.

[0032] Example 1 PTGR1 homologous genes significantly expanded in Papilio rubripes and responded to AAI treatment

[0033] 1. Experimental drugs, reagents, materials and instruments

[0034] 1. Experimental Materials

[0035] The larvae of Swallowtail butterfly were reared on leaves of Aristolochia debilis.

[0036] 2. Experimental Reagents

[0037] Aristolochic acid I (ST02160120) was purchased from Shanghai Standard Standard Technology Service Co., Ltd.;

[0038] RNA extraction kit RNeasy Plus Mini Kit was purchased from Qiagen;

[0039] The library construction kit TruSeq RNALibrary Prep Kit was purchased from Illumina.

[0040] 2. Experimental Methods

[0041] 1. Comparative genome analysis of insects

[0042] The protein coding sequences of Papilio rubrum, Papilio rubrum, Papilio citri, Papilio chrysogenum, Papilio orientalis, Papilio taenia, Pieris rapae, Papilio rubrum, Manduca sexta, Bombyx mori, Plutella xylostella and Drosophila melanogaster were obtained from the database and the longest transcripts were extracted. The homology between protein coding genes was determined using OrthoFinder software (v2.5.4), and the phylogenetic tree between species was constructed based on single-copy orthologous genes. The species divergence time was estimated using R8s software, and the gene families with significant expansion or contraction were determined based on the number of homologous genes and phylogenetic relationships using CAFE software (v4.2.1), with the threshold set to a branch-specific P value of less than 0.01.

[0043] 2. Gene family phylogenetic analysis

[0044] MUSCLE software (v3.8) was used to perform multiple sequence alignment of all protein sequences in the gene family, and the maximum likelihood tree was reconstructed using RAxML software, with the amino acid substitution model set to “PROTGAMMAJTT” and the bootstrap value set to 100.

[0045] 3. Identification of differentially expressed genes after exogenous AAI treatment

[0046] The control group was fed with Aristolochia leaves as normal, and the treatment group was additionally sprayed with 1 mg / mL AAI solution on the surface of Aristolochia leaves. After 24 h of treatment, the total RNA of the larvae was extracted using an RNA extraction kit, and the cDNA library was constructed using the kit and sequenced using the Illumina NovaSeq 6000 platform (Hope Group, Wuhan).

[0047] After obtaining the raw sequencing data, Trimmomatic software (v0.39) was used to trim low-quality bases according to the recommended parameters. The high-quality data were aligned to the reference genome of Papilio rubripes using STAR software (v2.7.5) with the parameters set as “--sjdbOverhang 149,--alignIntronMin 20,--alignIntronMax 100000,--outSAMmultNmax1,--outSAMmapqUnique 60”. RSEM software was used to quantify gene expression levels based on the alignment results. DESeq2 software was used to normalize the raw gene expression counts. The threshold for gene expression differences between groups was set to a P value less than 0.05 and a differential expression fold greater than 2 after multiple testing correction.

[0048] 3. Experimental Results

[0049] A total of 11 genes belonging to the PTGR gene family (ParPTGR) were identified in the genome of Papilio rubripes, which are homologous genes of the human PTGR1 gene ( Figure 1 A), comparative analysis showed that this gene family has expanded significantly in Papilio rubripes, with the gene copy number higher than that in other lepidopteran insects, while this gene is absent in Drosophila melanogaster ( Figure 1 B) Of these genes, one copy is highly conserved among Lepidoptera species, while the remaining genes form two gene clusters that originated after the divergence of Papilio rubripes from other closely related groups ( Figure 1 A), indicating that the PTGR gene family may be related to the tolerance and adaptation of Swallowtail butterfly to AA toxicity. In addition, compared with the control group, the expression levels of four PTGR genes in Swallowtail butterfly larvae treated with exogenous AAI were significantly upregulated ( Figure 2 ), indicating that the PTGR gene is related to the response of Papilio rubripes to AAI and may be involved in the metabolism and detoxification of AAI.

[0050] Example 2 Inhibition of PTGR1 gene expression significantly increases oxidative stress caused by AAI

[0051] 1. Experimental drugs, reagents, materials and instruments

[0052] 1. Experimental Reagents

[0053] Invitrogen Lipofectamine 2000 transfection reagent (11668019) was purchased from Thermo Fisher;

[0054] siRNA nucleotide sequences were purchased from Shanghai Aibosi Biotechnology Co., Ltd.;

[0055] RNA extraction kit RNAiso Plus (9109) was purchased from Takara;

[0056] Chloroform (10006818) was purchased from Sinopharm Chemical Reagent Co., Ltd.;

[0057] Isopropanol (80109218) was purchased from Sinopharm Chemical Reagent Co., Ltd.;

[0058] Invitrogen DEPC-treated water (AM9920) was purchased from Thermo Fisher;

[0059] HiScript IIQ RT SuperMix qPCR-specific reverse transcription reagent (genomic DNA removed) (R223-01) was purchased from Novozymes;

[0060] ChamQ Universal SYBR qPCR Master Mix Universal High-Sensitivity Dye-Based Quantitative PCR Detection Kit (Q711-02) was purchased from Novozymes;

[0061] Aristolochic acid I (ST02160120) was purchased from Shanghai Standard Standard Technology Service Co., Ltd.;

[0062] β-Tubulin antibody (M30109s) was purchased from Abmart;

[0063] 4-HNE antibody (MAB3249) was purchased from R&D systems;

[0064] Horseradish peroxidase-labeled goat anti-rabbit IgG (H+L) (A0208) was purchased from Bio-Tech;

[0065] Horseradish peroxidase-labeled goat anti-mouse IgG (H+L) (A0216) was purchased from Bio-Time;

[0066] Clarity Western ECL Substrate (1705060) was purchased from Bio-Rad.

[0067] 2. Experimental Instruments

[0068] Heracell 150i CO2 incubator (Thermo Fisher);

[0069] T100 Thermal Cycler gradient PCR instrument (Bio-Rad);

[0070] LightCycler 480 real-time fluorescence quantitative PCR system (Roche);

[0071] Gel Doc XR+ gel imaging system (Bio-Rad).

[0072] 2. Experimental Methods

[0073] 1. Reducing PTGR1 gene expression level based on RNA interference

[0074] RT4 cells were cultured in an incubator at 37°C with 95% air and 5% CO2 until the logarithmic growth phase. After trypsin digestion, the cells were subcultured in 6-well plates for transfection experiments. Before the experiment, the cell confluence reached 30% to 40%. The transfection reagent was diluted and mixed with serum-free culture medium at a ratio of 50:1, and allowed to stand at room temperature for 5 minutes (Solution A). The siRNA was diluted to a final concentration of 60nM with serum-free culture medium and mixed (Solution B). Solution A and solution B were mixed in equal volumes, gently mixed, and allowed to stand at room temperature for 15 to 20 minutes to form a transfection reagent complex (Solution C). The original culture medium was discarded, 1.5mL of preheated serum-free culture medium was added to each well, 0.5mL of solution C was dripped in, and the mixture was gently shaken and placed in a CO2 incubator at 37°C for culture. 5 to 6 hours after transfection, the culture medium was replaced with a culture medium containing 10% fetal bovine serum. After continuing to culture for 48 hours, the cells were collected for subsequent experiments.

[0075] In this experiment, the treatment group included two different siRNAs targeting the PTGR1 gene, and the negative control group was added with si-control. Three replicate wells were set for each treatment.

[0076] siRNA sequences:

[0077] siRNA-1 positive strand: 5'-GCCAAAGUUGUGGAAAGUAUU-3' (SEQ ID NO: 1);

[0078] siRNA-1 antisense strand: 5′-UACUUUCCACAACUUUGGCUU-3′ (SEQ ID NO: 2);

[0079] siRNA-2 sense strand: 5′-CAGAGAUUGUUAUCUAUCAGG-3′ (SEQ ID NO: 3);

[0080] siRNA-2 antisense strand: 5′-UGAUAGAUAACAAUCUCUGGG-3′ (SEQ ID NO: 4);

[0081] si-control sense strand: 5′-UUCUCCGAACGUGUCACGUTT-3′;

[0082] si-control antisense strand: 5'-ACGUGACACGUUCGGAGAATT-3'.

[0083] 2. qPCR detection of PTGR1 gene expression level

[0084] Total RNA was extracted from cells using an RNA extraction kit, cDNA was synthesized using a reverse transcription kit, qPCR was performed using a quantitative PCR detection kit, and detection was performed using a real-time fluorescence quantitative PCR system. Three technical replicates were set for each sample. -ΔΔCq Methods The relative expression levels of target genes were calculated, and one-way analysis of variance was used for significance testing.

[0085] qPCR detection primer sequences:

[0086] PTGR1 forward: 5′-GGAGCGAGATCCCTCCAAAAT-3′;

[0087] PTGR1 reverse: 5′-GGCTGTTGTCATACTTCTCATGG-3′;

[0088] GAPDH forward: 5′-TCCTCCTGTGACCCTTTCGG-3′;

[0089] GAPDH reverse: 5'-GAAGGCGGCTGGGACTGC-3'.

[0090] 3. AAI treatment and 4-HNE protein immunoblotting detection

[0091] The cells in the treatment group and the control group were made into cell suspensions with a concentration of 9×10 4 cells / mL. 2 mL of cell suspension was added to each well of a 6-well plate, and AAI at a final concentration of 1 μM or an equivalent volume of DMSO was added. After treatment for 24 hours, total cell protein was extracted using a cell lysis buffer containing 2% protease inhibitors and 2% phosphatase inhibitors; the supernatant was collected after centrifugation at 10,000 g for 20 minutes at 4°C, 20% loading buffer was added and mixed, and then boiled at 100°C for 5 minutes, the protein concentration was determined based on the BCA method, and the proteins were separated by polyacrylamide gel electrophoresis, then transferred to a PVDF membrane, blocked with 5% skim milk for 1 hour, and an appropriately diluted primary antibody was added, and incubated overnight at 4°C; after washing, HRP-conjugated secondary antibody was added and incubated at room temperature for 2 hours, and ECL substrate was added for development, and the blot was imaged and quantified using a gel imaging system.

[0092] 3. Experimental Results

[0093] Compared with the negative control group, the expression level of PTGR1 gene in RT4 cells was significantly reduced after transfection with siRNA targeting PTGR1 gene, and the knockdown efficiency was about 50% to 60% ( Figure 3 A). Compared with the control group, the expression level of 4-HNE was significantly increased in PTGR1 knockdown cells after exposure to AAI ( Figure 3 B, C), indicating that decreased PTGR1 expression levels aggravated oxidative stress caused by AAI.

[0094] Example 3 Inhibition of PTGR1 expression increases the toxicity of AAI to RT4 cells

[0095] 1. Experimental drugs, reagents, materials and instruments

[0096] 1. Experimental Reagents

[0097] CCK-8 cell proliferation toxicity detection kit (CK04) was purchased from Dojindo;

[0098] Other experimental reagents are the same as those in Example 2.

[0099] 2. Experimental Instruments

[0100] BioTek Cytation 3 Cell Imaging Multifunctional Detection System (Agilent);

[0101] Other experimental instruments are the same as those in Example 2.

[0102] 2. Experimental Methods

[0103] 1. Reducing PTGR1 gene expression level based on RNA interference

[0104] Same as Example 2.

[0105] 2. qPCR detection of PTGR1 gene expression level

[0106] Same as Example 2.

[0107] 3. Cytotoxicity Assay

[0108] The cells in the treatment and control groups were prepared into cell suspensions with a concentration of 1.5×10 5 cells / mL, add 100 μL of cell suspension to each well of a 96-well plate, add AAI to a final concentration of 0-2 μM, and continue to culture in an incubator for 24 hours. Remove the culture medium, add complete culture medium containing 10% CCK-8 reagent, continue to culture for 2 hours, use a cell imaging microplate detection system to measure the absorbance at 450 nm, and repeat the experiment 3 times to calculate the cell growth inhibition rate.

[0109] 3. Experimental Results

[0110] In the control group, as the concentration of AAI increased, the death rate of RT4 cells gradually increased ( Figure 4 Compared with the control group, the cell death rate of PTGR1 knockdown cells was higher after treatment with the same concentration of AAI ( Figure 4 ), indicating that the cytotoxicity of AAI to RT4 cells increased after the expression of PTGR1 gene was inhibited by siRNA.

[0111] Example 4 Inducing PTGR1 expression reduces the toxicity of AAI to RT4 cells

[0112] 1. Experimental drugs, reagents, materials and instruments

[0113] 1. Experimental Reagents

[0114] D3T (ab141925) was purchased from Abcam.

[0115] Other experimental reagents are the same as those in Examples 2 and 3.

[0116] 2. Experimental Instruments

[0117] Same as Examples 2 and 3.

[0118] 2. Experimental Methods

[0119] 1. D3T induces PTGR1 gene expression

[0120] RT4 cells were cultured in an incubator at 37°C with 95% air and 5% CO2 until the logarithmic growth phase. After digestion with trypsin, the cells were prepared into a 9×10 4 Cell suspension of 10 cells / mL was added to each well of a 6-well plate. D3T with a final concentration of 62.5 μM or 125 μM was added. After culturing for 24 hours, the expression level of PTGR1 gene was detected.

[0121] 2. qPCR detection of PTGR1 gene expression level

[0122] Same as Examples 2 and 3.

[0123] 3. Cytotoxicity Assay

[0124] Same as Example 3.

[0125] 3. Experimental Results

[0126] Compared with the control group, 62.5 μM or 125 μM D3T significantly increased the expression level of PTGR1 gene ( Figure 5 A). In the control group, as the concentration of AAI increased, the death rate of RT4 cells gradually increased ( Figure 5B). Compared with the control group, the cell death rate of D3T-treated cells was lower after treatment with the same concentration of AAI ( Figure 5 B) shows that after inducing PTGR1 gene expression using D3T, the cytotoxicity of AAI to RT4 cells is reduced, indicating that PTGR1 gene and its inducer can be used to prevent and / or treat cytotoxicity caused by oxidative stress caused by AAI.

[0127] It should be understood that the above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments. Those skilled in the art can make improvements or changes without violating the principles of the present invention, and these equivalent improvements or changes should be included in the protection scope of the present invention.

Claims

1. Use of the PTGR1 gene and its inducer in the preparation of drugs for preventing and / or treating kidney damage diseases.

2. The use according to claim 1, characterized in that: The kidney damage disease is aristolochic acid nephropathy.

3. The use according to claim 1, characterized in that: The drug is a targeted drug, with the PTGR1 gene as a drug target or target gene.

4. The use according to claim 3, characterized in that: The targeted drug is selected from one or more of siRNA, dsRNA and shRNA targeting the PTGR1 gene.

5. The use according to claim 4, characterized in that: The targeted drug is siRNA targeting the PTGR1 gene, and the siRNA includes siRNA-1 and siRNA-2, wherein the sense chain sequence of siRNA-1 is shown in SEQ ID NO:1, and the antisense chain sequence is shown in SEQ ID NO:2; the sense chain sequence of siRNA-2 is shown in SEQ ID NO:3, and the antisense chain sequence is shown in SEQ ID NO:

4.

6. The use according to claim 3, characterized in that: The targeted drug is a PTGR1 inducer, which induces high-level expression of the PTGR1 gene; or the targeted drug is a PTGR1 agonist, which activates high-level expression of the PTGR1 gene.

7. The use according to claim 1, characterized in that: The drug also includes a pharmaceutically acceptable carrier, which is selected from one or a combination of two or more of a buffer, an encapsulating agent, a filler, a binder, a transdermal absorbent, a wetting agent, a disintegrant, an absorption promoter, a surfactant, a colorant, a flavoring agent and an adsorbent.

8. The use according to claim 1, characterized in that: The drug is prepared as a pharmaceutically acceptable preparation, and the dosage form is selected from one or a combination of two or more of tablets, capsules, pills, granules, suspensions, oral solutions, sprays, and injections.

9. A pharmaceutical composition, characterized in that The invention comprises siRNA targeting PTGR1 gene, wherein the siRNA comprises siRNA-1 and siRNA-2, wherein the sense strand sequence of siRNA-1 is shown in SEQ ID NO:1, and the antisense strand sequence is shown in SEQ ID NO:2; the sense strand sequence of siRNA-2 is shown in SEQ ID NO:3, and the antisense strand sequence is shown in SEQ ID NO:4; Also included are pharmaceutically acceptable carriers.

Images