Lipid compounds and lipid nanoparticle compositions

Abstract

The present disclosure provides lipid compounds that can be used in combination with other lipid components, such as neutral lipids, cholesterol, and polymer-bound lipids, to form lipid nanoparticles for delivery of therapeutic agents, such as nucleic acid molecules, for therapeutic or prophylactic purposes, including vaccination. Also provided herein are lipid nanoparticle compositions comprising the lipid compounds.

Description

Technical Field

[0001] The present disclosure relates to the field of biomedicine, and in particular to lipid compounds, which can be used in combination with other lipid components, such as neutral lipids, cholesterol and polymer-bound lipids, to form lipid nanoparticles for delivering therapeutic agents (e.g., nucleic acid molecules, including nucleic acid mimetics, such as locked nucleic acids (LNA), peptide nucleic acids (PNA) and morpholinos) in vitro and in vivo for therapeutic or preventive purposes, including vaccination. Background Art

[0002] RNA therapeutics can manipulate gene expression or produce functional proteins, making these drugs suitable for diseases with established genetic targets, including infectious diseases, cancer, and immune diseases. Regardless of their therapeutic mechanism of action, the large size of some functional RNAs (such as mRNA), their anionic charge, and their sensitivity to RNases present in the bloodstream and tissues make it difficult for mRNA to effectively enter cells and act on their own.

[0003] Lipid nanoparticles (LNP) are commonly used carriers for mRNA drugs. LNP is a multi-component system, usually composed of ionizable lipids or cationic lipid compounds, auxiliary lipids, cholesterol, and protective agent polyethylene glycol-lipid conjugates. LNP can encapsulate mRNA in the internal cavity of the structure. This structure can improve the in vivo stability of mRNA and facilitate the function of mRNA. However, the LNP carrier in the preparation is the main cause of adverse reactions such as pain and inflammation after drug injection. In addition, the function of mRNA must be achieved through its translation into corresponding proteins, which requires mRNA to escape from the particles. However, this is very difficult for LNP particles in cells. Finally, when the temperature rises, mRNA has a tendency to dissociate from LNP, so this preparation must be stored at low temperature, which also limits the use of this dosage form worldwide. In summary, although the role of this delivery technology is obvious, there is still a lot of room for optimization.

[0004] Ionizable lipids or cationic lipid compounds are the core components of LNPs. They are the main factors affecting the effectiveness and toxic side effects of LNPs, and are also the main patent barriers for the development of LNPs. Solving the cytotoxicity of ionizable lipids or cationic lipid compounds is one of the key points of LNP technology. During development, a balance needs to be struck between delivery efficiency and toxic side effects. For ionizable lipids or cationic lipids, their cytotoxicity depends on the structure of their hydrophilic head groups. The head group structure of cationic lipids is quaternary amine, and the head group structure of ionizable lipids is tertiary amine. Generally speaking, amphiphilic molecules with quaternary ammonium head groups are more toxic than amphiphilic molecules with tertiary amine head groups. At present, the development at home and abroad is mainly focused on ionizable lipids. Ionizable lipids are protonated at low pH, which makes them positively charged, but remain neutral at physiological pH. They can be protonated and positively charged in a physiological low pH environment, and can be safely cleared after mRNA is delivered. The pH sensitivity of ionizable lipids is conducive to the delivery of mRNA in vivo, because neutral lipids interact less with the anionic membrane of blood cells, thereby improving the biocompatibility of lipid nanoparticles.

[0005] Therefore, ionizable lipids are the focus of patent protection. For example, the main components of the mRNA vaccine delivery system LNP, ALC-0315 (Acuitas / Pfizer) and SM-102 (Moderna), are ionizable lipids whose hydrophilic head groups are tertiary amines. In the field of LNP patents, Arbutus is a leading company in the LNP field. It has extensive and in-depth coverage of a large number of patents in the field of ionizable lipids / cationic lipids, including numerous compound structure patents, LNP compositions and their proportion patents, and application patents.

[0006] Since foreign countries have laid out ionizable lipids earlier, the domestic development of ionizable lipids has been restricted by foreign patents. At present, the main direction for domestic companies to break through patents is to change the head group structure and connecting groups of ionizable lipids. The main development direction of this patent is to change the lipid chain of ionizable lipids and replace the fatty chain of the compound with steroid lipid molecules. Through patent research, there is a similar structure in which cholesterol replaces the fatty chain in the US 9,365,610B2 ​​patent, but the head group structure of the compound in the patent is different from that of this patent. The head group structure used in this patent is an alcohol amine structure similar to ALC-0315 and SM-102, while the head group structure in the US 9,365,610 B2 patent does not contain hydroxyl groups and contains two tertiary amines.

[0007] Nucleic acid delivery has made great progress in recent years. However, gene delivery currently faces many challenges during the treatment process: there is a lack of compounds that can efficiently deliver mRNA in vivo; LNPs prepared from compounds on the market have obvious side effects when used for mRNA delivery; the synthesis process of ionizable lipids is complex; and there are serious patent barriers for ionizable lipids.

[0008] Therefore, it is necessary to address existing technical problems and discover novel ionized lipid compounds to improve LNP delivery efficiency and reduce toxicity. Summary of the invention

[0009] The present disclosure provides lipid compounds, including pharmaceutically acceptable salts, prodrugs or stereoisomers thereof, which can be used alone or in combination with other lipid components, such as neutral lipids, charged lipids, steroids (including, for example, all sterols) and / or their analogs and / or polymer-bound lipids and / or polymers, to form lipid nanoparticles for delivering therapeutic agents (e.g., nucleic acid molecules, including nucleic acid mimics, such as locked nucleic acids (LNA), peptide nucleic acids (PNA) and morpholino nucleic acids). In some cases, the lipid nanoparticles are used to deliver nucleic acids, such as antisense and / or messenger RNA. Also provided is a method for treating various diseases or illnesses using such lipid nanoparticles, such as diseases or illnesses caused by infectious agents and / or protein deficiencies.

[0010] In a first aspect, the present disclosure provides compounds of formula (I):

[0011]

[0012] or a pharmaceutically acceptable salt, tautomer, prodrug or stereoisomer thereof, wherein:

[0013] G 1 and G 2 Each independently is a bond, C1-C 12 Alkylene or C2-C 12 alkenylene;

[0014] L 1 -OC(=O)R 1 、-C(=O)OR 1 、-OC(=O)OR 1 、-C(=O)R 1 、-OR 1 ,

[0015] -S(O) x R 1 、-S-SR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 、-C(=O)NR b R c 、-NR a C(=O)NR b R c 、-OC(=O)NR b Rc 、-NR a C(=O)OR 1 、-SC(=S)R 1 、-C(=S)SR 1 、-C(=S)R 1 、-CH(OH)R 1 、-P(=O)(OR b )(OR c )、-(C6-C 10 Arylene)-R 1 , -(6- to 10-membered heteroarylene)-R 1 or R 1 ;

[0016] R 1 C6-C 24 Alkyl or C6-C 24 Alkenyl or C6-C 24 Alkynyl;

[0017] R a and R b Each independently is H, C1-C 12 Alkyl, C2-C 12 Alkenyl or C2-C 12 Alkynyl;

[0018] R c C1-C 32 Alkyl or C2-C 32 alkenyl;

[0019] L 2 =-OC(=O)L 3 、-C(=O)OL 3 、-OC(=O)OL 3 、-C(=O)L 3 , -OL 3 ,

[0020] -CH(OH)L 3 or L 3 ;

[0021] L 3 For-R 2 =R 3 =R 4 -R 5 or -R 6 -R 7 or -R 8 -R 9 ;

[0022] R 2 C 3-8Cycloalkylene, preferably C6 cycloalkylene or R 2 for R d C 3-8 Cycloalkylene, preferably C6 cycloalkylene, R e and R f Each independently is H or C 1-12 Alkyl, R 3 C1-C 12 Alkylene or C2-C 12 Alkenylene, R 4 is a bicyclic group, preferably a C 5-8 Cycloalkyl C 5-8 Cycloalkyl, more preferably C6 cycloalkylene and C5 cycloalkylene, R 5 C2-C 24 Alkyl or C2-C 24 Alkenyl or C2-C 24 Alkynyl;

[0023] R 6 is a bicyclic group, preferably a C6 aryl group and a C 5-8 Heterocycloalkyl, more preferably C6 arylene and C6 heterocycloalkyl, R 7 C6-C 24 Alkyl or C6-C 24 Alkenyl or C6-C 24 Alkynyl;

[0024] R 8 C1-C 24 Alkylene or C2-C 24 Alkenylene, preferably C6-C 18 Alkylene or C6-C 18 Alkenylene, more preferably C 10 Alkylene or C 10 Alkenylene, R 9 C 5-8 Cycloalkenyl, preferably C6 cycloalkenyl;

[0025] G 3 It is C1-C 12 Alkylene, preferably C2-C6 alkylene, more preferably C2-C4 alkylene;

[0026] R 10 is hydroxyl group;

[0027] x is 0, 1, or 2; and

[0028] wherein each alkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, alkylene, alkenylene, arylene, heteroarylene, cycloalkylene, bicyclolene, aryl is independently optionally substituted.

[0029] In a second aspect, the present disclosure provides a composition comprising the compound described in the first aspect above and a therapeutic or preventive agent. In one embodiment, the composition further comprises one or more structural lipids. In one embodiment, the one or more structural lipids are selected from DSPC, steroids or a combination thereof. In one embodiment, the steroid is cholesterol. In a specific embodiment, the molar ratio of the compound to the DSPC is in the range of 2:1 to about 8:1, preferably about 3:1 to about 5:1, and more preferably about 47.5:10. In a specific embodiment, the molar ratio of the compound to the steroid is in the range of about 5:1 to about 1:1, preferably about 2:1 to about 1:1, and more preferably about 47.5:40.7. In one embodiment, the composition further comprises one or more polymer-bound lipids. In one embodiment, the polymer-bound lipid is DMG-PEG2000 or DMPE-PEG2000. In a specific embodiment, the molar ratio of the compound to the polymer-bound lipid is in the range of about 100:1 to about 20:1, preferably about 50:1 to about 25:1, and more preferably about 47.5:1.8. In a preferred embodiment, the composition comprises the compound described in the first aspect, DSPC, cholesterol, DMG-PEG2000 and a therapeutic agent or a preventive agent. In a specific embodiment, the compound / DMG-PEG2000 / DSPC / cholesterol=47.5 / 10 / 40.7 / 1.8 (mol%).

[0030] In one embodiment, the therapeutic agent or preventive agent comprises one or more selected from the following: small molecule drugs, nucleic acid molecules, proteins. In one embodiment, the nucleic acid molecule comprises at least one mRNA or siRNA or nclRNA encoding an antigen or a fragment or epitope thereof. In one embodiment, the mRNA is a monocistronic mRNA. In one embodiment, the mRNA is a polycistronic mRNA. In one embodiment, the antigen is a pathogenic antigen. In one embodiment, the antigen is a tumor-associated antigen. In one embodiment, the mRNA comprises one or more functional nucleotide analogs. In one embodiment, the functional nucleotide analogs are selected from one or more of the following: pseudouridine, 1-methyl-pseudouridine and 5-methylcytosine.

[0031] In one embodiment, the composition is a nanoparticle.

[0032] In a third aspect, the present disclosure provides a lipid nanoparticle comprising the compound described in the first aspect or the composition described in the second aspect.

[0033] In a fourth aspect, the present disclosure provides a pharmaceutical composition comprising the compound described in the first aspect, the composition described in the second aspect, or the lipid nanoparticles described in the third aspect, and a pharmaceutically acceptable excipient or diluent.

[0034] In a fifth aspect, the present disclosure provides the use of the lipid nanoparticles described in the third aspect above or the pharmaceutical composition described in the fourth aspect above in the preparation of a drug. In one embodiment, the drug is a vaccine, such as a tumor, influenza or rabies vaccine. In one embodiment, the drug is used to therapeutically or prophylactically improve the immune response of a subject in need, wherein the subject is a vertebrate, preferably a mammal, such as a goat, a cow, a pig, a dog, a cat, a donkey, a monkey, an ape, a rodent such as a mouse, a hamster, a rabbit, or a human. In one embodiment, the drug is used for parenteral administration, and wherein parenteral administration includes injection, such as transmucosal injection, intradermal injection, intravenous injection, intramuscular injection, subcutaneous injection. In one embodiment, the drug is used for nasal, oral spray or instillation.

[0035] Additional features of the present disclosure will become apparent to those skilled in the art after considering the following detailed description of specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 is the H NMR spectrum of compound 1.

[0037] Figure 2 is the H NMR spectrum of compound 2.

[0038] Figure 3 is the H NMR spectrum of compound 3.

[0039] Figure 4 is the H NMR spectrum of compound 4.

[0040] Figure 5 This is the H NMR spectrum of compound 5.

[0041] Figure 6 This is the H NMR spectrum of compound 6.

[0042] Figure 7 This is the H NMR spectrum of compound 7.

[0043] Figure 8 This is the H NMR spectrum of compound 8.

[0044] Fig. 9 Small animal fluorescence imaging results are shown.

[0045] Fig.10 Shown is the rate of change in mouse body weight after injection of LNP formulations.

[0046] Fig.11 This is the schematic diagram of the Luciferase fluorescence signal detection principle. DETAILED DESCRIPTION

[0047] The techniques and procedures described or referenced herein include those generally well understood and / or commonly employed by those skilled in the art using routine methods, such as the widely used methods described in, for example, Sambrook et al., Molec μLar Cloning: A Laboratory Manual (3rd ed., 2001); Current Protocols in Molec μLar Biology (Ausubel et al., eds., 2003).

[0048] the term

[0049] Unless otherwise described, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. For the purpose of interpreting this specification, the following term description will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa. All patents, applications, published applications and other publications are incorporated by reference in their entirety. If any description of a term set forth conflicts with any document incorporated herein by reference, the term description set forth below shall prevail.

[0050] As used herein and unless otherwise indicated, the term "lipid" refers to a group of organic compounds, including but not limited to fatty acid esters, and is generally characterized by being poorly soluble in water but soluble in many non-polar organic solvents. Although lipids are generally weakly water-soluble, certain classes of lipids (e.g., lipids modified with polar groups, such as DMG-PEG2000) have limited water solubility and are soluble in water under certain conditions. Known lipid types include biomolecules such as fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides, and phospholipids. Lipids can be divided into at least three categories: (1) "simple lipids", including fats and oils, as well as waxes; (2) "compound lipids", including phospholipids and glycolipids (e.g., DMPE-PEG2000); and (3) "derivatized lipids", such as steroids. In addition, as used herein, lipids also include lipid-like compounds. The term "lipid-like compound" is also referred to as "lipid-like'; refers to a lipid-like compound (e.g., an amphiphilic compound with lipid-like physical properties).

[0051] The term "lipid nanoparticle" or "LNP" refers to a particle having at least one nanometer (nm) size (e.g., 1 to 1,000 nm) containing one or more types of lipid molecules. The LNP provided herein may further contain at least one non-lipid payload molecule (e.g., one or more nucleic acid molecules). In some embodiments, the LNP comprises a non-lipid payload molecule partially or completely encapsulated in a lipid shell. Specifically, in some embodiments, wherein the payload is a negatively charged molecule (e.g., mRNA encoding a viral protein), and the lipid component of the LNP comprises at least one cationic lipid. Without being bound by theory, it is expected that cationic lipids can interact with negatively charged payload molecules and promote the incorporation and / or encapsulation of the payload into the LNP during LNP formation. Other lipids that can form a part of the LNP as provided herein include, but are not limited to, neutral lipids and charged lipids, such as steroids, polymer-bound lipids, and various zwitterionic lipids. In certain embodiments, LNP according to the present disclosure comprises lipids of one or more formulas (I) (and subformulas thereof) as described herein.

[0052] The term "cationic lipid" refers to a lipid that is positively charged at any pH value or hydrogen ion activity of its environment, or can be positively charged in response to the pH value or hydrogen ion activity of its environment (e.g., the environment of its intended use). Therefore, the term "cation" encompasses "permanent cations" and "cationizable". In certain embodiments, the positive charge in the cationic lipid is derived from the presence of a quaternary nitrogen atom. In certain embodiments, the cationic lipid comprises a zwitterionic lipid that is positively charged in the environment of its intended use (e.g., at physiological pH). In certain embodiments, the cationic lipid is a lipid of one or more formulas (I) (and its subformulas) as described herein.

[0053] The term "polymer-bound lipid" refers to a molecule comprising both a lipid portion and a polymer portion. An example of a polymer-bound lipid is a pegylated lipid (PEG-lipid), wherein the polymer portion comprises polyethylene glycol.

[0054] The term "neutral lipid" encompasses any lipid molecule that exists in an uncharged form or in a neutral zwitterionic form at a selected pH value or within a selected pH range. In some embodiments, the selected useful pH value or range corresponds to the pH conditions in the environment of the intended lipid use, such as a physiological pH value. As non-limiting examples, neutral lipids that can be used in conjunction with the present disclosure include, but are not limited to, phosphatidylcholines, such as 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC); phosphatidylethanolamines, such as 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 2-((2,3-bis(oleoyloxy)propyl))dimethylammonio)ethyl hydrogen phosphate (DOCP); sphingomyelin (SM); ceramides; steroids, such as sterols and their derivatives. The neutral lipids provided herein can be synthetic or derived from (isolated or modified from) natural sources or compounds.

[0055] The term "charged lipid" encompasses any lipid molecule that exists in a positively or negatively charged form at a selected pH value or within a selected pH range. In some embodiments, the selected pH value or range corresponds to the pH conditions in the environment of the intended lipid use, such as physiological pH. As a non-limiting example, neutral lipids that can be used in conjunction with the present disclosure include, but are not limited to, phosphatidylserine, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, sterol hemisuccinate, dialkyltrimethylammonium-propane (e.g., DOTAP, DOTMA), dialkyldimethylaminopropane, ethylphosphocholine, dimethylaminoethanecarbamoylsterol (e.g., DC-Chol), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine sodium salt (DOPS-Na), 1,2-dioleoyl-sn-glycero-3-phospho-(1′-racemic-glycerol) sodium salt (DOPG-Na) and 1,2-dioleoyl-sn-glycero-3-phospho-sodium salt (DOPA-Na). The charged lipids provided herein can be synthetic or derived from (isolated or modified from) natural sources or compounds.

[0056] As used herein and unless otherwise specified, the term "alkyl" refers to a saturated straight or branched hydrocarbon chain group consisting solely of carbon and hydrogen atoms. In one embodiment, an alkyl group has, for example, one to twenty-four carbon atoms (C1-C 24 Alkyl), four to twenty carbon atoms (C4-C 20 Alkyl), six to sixteen carbon atoms (C6-C 16alkyl), six to nine carbon atoms (C6-C9 alkyl), one to fifteen carbon atoms (C1-C 15 Alkyl), one to twelve carbon atoms (C1-C 12 The term "alkyl" refers to a group consisting of one to eight carbon atoms (C1-C8 alkyl), one to eight carbon atoms (C1-C8 alkyl), or one to six carbon atoms (C1-C6 alkyl) and is connected to the rest of the molecule by a single bond. Examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (isopropyl), n-butyl, n-pentyl, 1,1-dimethylethyl (tert-butyl), 3-methylhexyl, 2-methylhexyl, and the like. Unless otherwise specified, alkyl is optionally substituted.

[0057] As used herein and unless otherwise indicated, the term "alkenyl" refers to a straight or branched hydrocarbon chain group consisting only of carbon and hydrogen atoms, containing one or more carbon-carbon double bonds. It should be understood by those skilled in the art that the term "alkenyl" also includes groups having "cis" and "trans" configurations, or having "E" and "Z" configurations. In one embodiment, the alkenyl group has, for example, two to twenty-four carbon atoms (C2-C 24 alkenyl), four to twenty carbon atoms (C4-C 20 alkenyl), six to sixteen carbon atoms (C6-C 16 alkenyl), six to nine carbon atoms (C6-C9 alkenyl), two to fifteen carbon atoms (C2-C 15 alkenyl), two to twelve carbon atoms (C2-C 12 The term "alkenyl" refers to a group of carbon atoms (C-C), two to eight carbon atoms (C-C), or two to six carbon atoms (C-C) and is attached to the rest of the molecule by a single bond. Examples of alkenyl groups include, but are not limited to, vinyl, prop-1-enyl, but-1-enyl, pent-1-enyl, pent-1,4-dienyl, and the like. Unless otherwise specified, alkenyl groups are optionally substituted.

[0058] As used herein and unless otherwise indicated, the term "alkynyl" refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, containing one or more carbon-carbon triple bonds. In one embodiment, an alkynyl group has, for example, two to twenty-four carbon atoms (C2-C 24 Alkynyl), four to twenty carbon atoms (C4-C 20 Alkynyl), six to sixteen carbon atoms (C6-C 16 alkynyl), six to nine carbon atoms (C6-C9 alkynyl), two to fifteen carbon atoms (C2-C 15 Alkynyl), two to twelve carbon atoms (C2-C 12Alkynyl groups are substituted with 2 to 8 carbon atoms (C2-C8 alkynyl), 2 to 6 carbon atoms (C2-C6 alkynyl) and are connected to the rest of the molecule by a single bond. Examples of alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, pentynyl, and the like. Unless otherwise indicated, alkynyl groups are optionally substituted.

[0059] As used herein and unless otherwise indicated, the term "alkylene" or "alkylene chain" refers to a straight or branched divalent hydrocarbon chain that connects the rest of the molecule to a radical, which consists only of carbon and hydrogen and is saturated. In one embodiment, an alkylene group has, for example, one to twenty-four carbon atoms (C1-C 24 Alkylene), one to fifteen carbon atoms (C1-C 15 Alkylene), one to twelve carbon atoms (C1-C 12 The alkylene groups are alkylene, ...

[0060] As used herein and unless otherwise indicated, the term "alkenylene" refers to a straight or branched divalent hydrocarbon chain that connects the rest of the molecule to a radical, consisting solely of carbon and hydrogen and containing one or more carbon-carbon double bonds. In one embodiment, an alkenylene group has, for example, two to twenty-four carbon atoms (C2-C 24 alkenyl), two to fifteen carbon atoms (C2-C 15 alkenyl), two to twelve carbon atoms (C2-C 12 Alkenylene is a 1- to 2-carbon-1-alkylene group, a 1- to 3-carbon-1-alkylene group, a 1- to 4-carbon-1-alkylene group, a 1- to 5-carbon-1-alkylene group, a 1- to 6-carbon-1-alkylene group, a 1- to 2-carbon-1-alkylene group, a 1- to 4-carbon-1-alkylene group, a 1- to 6-carbon-1-alkylene group, a 1- to 2 ...

[0061] As used herein and unless otherwise indicated, the term "alkynylene" refers to a straight or branched divalent hydrocarbon chain that connects the rest of the molecule to a radical, consisting solely of carbon and hydrogen and containing one or more carbon-carbon triple bonds. In one embodiment, an alkynylene group has, for example, two to twenty-four carbon atoms (C2-C24 Alkyne), two to fifteen carbon atoms (C2-C 15 Alkyne), two to twelve carbon atoms (C2-C 12 Alkynylidene) is a alkylene radical having two to eight carbon atoms (C2-C8 alkynylene), two to six carbon atoms (C2-C6 alkynylene) or two to four carbon atoms (C2-C4 alkynylene). Examples of alkynylene include, but are not limited to, ethynylene, propynylene, n-butynylene, and the like. Alkynylidene is attached to the rest of the molecule via a single bond or a double bond and to the radical via a single bond or a double bond. The points of attachment of an alkynylene to the rest of the molecule and to the radical may be through one carbon or any two carbons within the chain. Unless otherwise indicated, an alkynylene is optionally substituted.

[0062] As used herein and unless otherwise specified, the term "aryl" refers to a monocyclic aromatic group and / or a polycyclic monovalent aromatic group containing at least one aromatic hydrocarbon ring. In certain embodiments, an aryl group has 6 to 18 ring carbon atoms (C6-C 18 aryl), 6 to 14 ring carbon atoms (C6-C 14 aryl) or 6 to 10 ring carbon atoms (C6-C 10 The term "aryl" also refers to a bicyclic, tricyclic or other polycyclic hydrocarbon ring, wherein at least one ring is aromatic and the other rings may be saturated, partially unsaturated or aromatic, such as dihydronaphthyl, indenyl, dihydroindenyl or tetrahydronaphthyl (tetrahydronaphthyl / tetralinyl). Unless otherwise indicated, aryl is optionally substituted.

[0063] As used herein and unless otherwise specified, the term "arylene" is a divalent aromatic group. Unless otherwise specified, an arylene group is optionally substituted.

[0064] As used herein and unless otherwise indicated, the term "heteroaryl" refers to a monocyclic aromatic group and / or a polycyclic aromatic group containing at least one aromatic ring, wherein at least one aromatic ring contains one or more (e.g., one, one or two, one to three, or one to four) heteroatoms independently selected from O, S, and N. Heteroaryl can be connected to the main structure at any heteroatom or carbon atom. In certain embodiments, heteroaryl has 5 to 20, 5 to 15, or 5 to 10 ring atoms. The term "heteroaryl" also refers to a bicyclic, tricyclic, or other polycyclic ring, wherein at least one ring is an aromatic ring, and the other rings may be saturated, partially unsaturated, or aromatic rings, wherein at least one aromatic ring contains one or more heteroatoms independently selected from O, S, and N. Examples of monocyclic heteroaryls include, but are not limited to, pyrrolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furyl, thienyl, oxadiazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl and triazinyl. Examples of bicyclic heteroaryls include, but are not limited to, indolyl, benzothiazolyl, benzoxazolyl, benzothienyl, quinolyl, tetrahydroisoquinolyl, isoquinolyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuranyl, isobenzofuranyl, chromone, coumarinyl, cinnolinyl, quinoxalinyl, indazolyl, purinyl, pyrrolopyridinyl, furopyridinyl, thienopyridinyl, dihydroisoindolyl and tetrahydroquinolyl. Examples of tricyclic heteroaryl groups include, but are not limited to, carbazolyl, benzindolyl, phenanthrolinyl, acridinyl, phenanthridinyl, and xanthenyl. Unless otherwise specified, heteroaryl groups are optionally substituted.

[0065] As used herein and unless otherwise specified, the term "heteroarylene" is a divalent heteroaryl group. Unless otherwise specified, a heteroarylene group is optionally substituted.

[0066] As used herein and unless otherwise specified, the term "bicyclylene" refers to a divalent aromatic or non-aromatic saturated or partially unsaturated bicyclic ring system that shares two adjacent ring atoms, including carbocyclylene and heterocyclylene, etc. For example, C 5-8 Cycloalkyl and C6 aryl, C 5-8 Cycloalkyl C 3-5 Heteroaryl, C 3-7 Heterocycloalkyl and C6 aryl, C6 3-7 Heterocycloalkyl C 3-5 Heteroaryl, C6 aryl and C6 aryl, C6 aryl 3-5 Heteroaryl and C6 aryl or C6 aryl 3-5 Heteroaryl C 3-5 Heteroaryl, C 5-8 Cycloalkyl C 5-8 Cycloalkyl, C6 cycloalkylene and C5 cycloalkylene, C6 arylene and C 5-8Heterocycloalkyl, C6 arylene and C6 heterocycloalkyl and the like.

[0067] When a group described herein is referred to as "substituted", it may be substituted with one or more any suitable substituents. Illustrative examples of substituents include, but are not limited to, those found in the exemplary compounds and embodiments provided herein, as well as: halogen atoms, such as F, Cl, Br or I; cyano; oxo (=O); hydroxyl (-OH); alkyl; alkenyl; alkynyl; cycloalkyl; aryl; -(C=O)OR'; -O(C=O)R'; -C(=O)R'; -OR'; -S(O) x R';-S-SR';-C(=O)SR';-SC(=O)R';-NR'R';-NR'C(=O)R';-C(=O)NR'R';-NR'C(=O)NR'R';-OC(=O)NR'R';-NR'C(=O)OR';-NR'S(O) x NR'R';-NR'S(O) x R′; and -S(O) x NR'R', wherein: R' is independently H, C1-C 15 alkyl or cycloalkyl, and x is 0, 1 or 2. In some embodiments, the substituent is C1-C 12 In other embodiments, the substituent is a cycloalkyl. In other embodiments, the substituent is a halo, such as a fluoro group. In other embodiments, the substituent is an oxo group. In other embodiments, the substituent is a hydroxyl group. In other embodiments, the substituent is an alkoxy group (-OR'). In other embodiments, the substituent is a carboxyl group. In other embodiments, the substituent is an amino group (-NR'R').

[0068] As used herein and unless otherwise indicated, the term "optionally" or "optionally" (e.g., optionally substituted) means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not. For example, "optionally substituted alkyl" means that the alkyl may or may not be substituted, and that the description includes both substituted alkyl and alkyl without substitution.

[0069] As used herein and unless otherwise indicated, the term "prodrug" of a biologically active compound refers to a compound that can be converted into a biologically active compound under physiological conditions or by solvolysis. In one embodiment, the term "prodrug" refers to a pharmaceutically acceptable metabolic precursor of a biologically active compound. When a prodrug is administered to a subject in need, the prodrug may be inactive, but is converted into a biologically active compound in vivo. Prodrugs typically rapidly transform in vivo to produce the parent biologically active compound, such as by hydrolysis in the blood. Prodrug compounds generally provide advantages of solubility, tissue compatibility or delayed release in mammalian organisms (see Bundgard, H., Design of Prodrugs (1985), pp. 7-9, pp. 21-24 (Elsevier, Amsterdam)). A discussion of prodrugs is provided in Higuchi, T. et al., ACS Symposium Series, Vol. 14; and in Bioreversible Carriers in Drug Design, ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.

[0070] In one embodiment, the term "prodrug" is also intended to include any covalently bonded carriers that release the active compound in vivo when such prodrugs are administered to mammalian subjects. Prodrugs of compounds can be prepared by modifying the functional groups present in the compound in such a way that the modifications can be cleaved in routine operations or in vivo to obtain the parent compound. Prodrugs include compounds in which hydroxyl, amino or sulfhydryl groups are bonded to any group that, when the prodrug of the compound is administered to a mammalian subject, is cleaved to form free hydroxyl, free amino or free sulfhydryl groups, respectively.

[0071] Examples of prodrugs include, but are not limited to, acetate, formate, and benzoate derivatives of alcohol functional groups or amide derivatives of amine functional groups in the compounds provided herein.

[0072] As used herein and unless otherwise indicated, the term "pharmaceutically acceptable salt" includes both acid addition salts and base addition salts.

[0073] Examples of pharmaceutically acceptable acid addition salts include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; and organic acids such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, acid), dodecyl sulfuric acid, ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2-oxoglutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, undecylenic acid, and the like.

[0074] Examples of pharmaceutically acceptable base addition salts include, but are not limited to, salts prepared by adding an inorganic base or an organic base to a free acid compound. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts, and the like. In one embodiment, the inorganic salt is an ammonium salt, a sodium salt, a potassium salt, a calcium salt, and a magnesium salt. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines, including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benethamine, benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine, tromethamine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like. In one embodiment, the organic base is isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.

[0075] The compounds provided herein may contain one or more asymmetric centers, and thus may produce enantiomers, diastereomers, and other stereoisomeric forms, which may be defined as (R)- or (S)-, or as (D)- or (L)- for amino acids, according to absolute stereochemistry. Unless otherwise indicated, the compounds provided herein are intended to include all such possible isomers, as well as racemic and optically pure forms thereof. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)-isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques, such as chromatography and fractional crystallization. Conventional techniques for preparing / separating individual enantiomers include chiral synthesis from suitable optically pure precursors or resolution of racemates (or racemates of salts or derivatives) using, for example, chiral high pressure liquid chromatography (HPLC). When the compounds described herein contain olefinic double bonds or other geometric asymmetric centers, unless otherwise indicated, the compounds are intended to include E and Z geometric isomers. Likewise, all tautomeric forms are also intended to be included.

[0076] As used herein and unless otherwise indicated, the term "isomer" refers to different compounds having the same molecular formula. "Stereoisomers" are isomers that differ only in the arrangement of their atoms in space. "Atropisomers" are stereoisomers resulting from hindered rotation about a single bond. "Enantiomers" are a pair of stereoisomers that are non-superimposable mirror images of each other. A mixture of a pair of enantiomers in any ratio may be referred to as a "racemic" mixture. "Diastereomers" are stereoisomers that have at least two asymmetric atoms but are not mirror images of each other.

[0077] "Stereoisomers" may also include E and Z isomers or mixtures thereof, as well as cis and trans isomers or mixtures thereof. In certain embodiments, the compounds described herein are separated into E or Z isomers. In other embodiments, the compounds described herein are mixtures of E and Z isomers.

[0078] "Tautomers" refers to isomeric forms of a compound that are in equilibrium with each other. The concentrations of the isomeric forms will depend on the environment in which the compound is found, and may vary depending on, for example, whether the compound is a solid or in an organic or aqueous solution.

[0079] It should also be noted that the compounds described herein may contain unnatural proportions of atomic isotopes at one or more atoms. For example, the compounds may be radiolabeled with a radioactive isotope, such as tritium ( 3 H), iodine-125 ( 125 I), sulfur-35( 35 S) or carbon-14 ( 14 C), or may be isotopically enriched, such as deuterium ( 2 H), carbon-13 ( 13C) or nitrogen-15( 15 N). As used herein, an "isotopologue" is an isotopically enriched compound. The term "isotopically enriched" refers to an atom whose isotopic composition is different from the natural isotopic composition of the atom. "Isotopically enriched" may also refer to a compound containing at least one atom whose isotopic composition is different from the natural isotopic composition of the atom. The term "isotopic composition" refers to the amount of each isotope present in a given atom. Radiolabeled and isotopically enriched compounds can be used as therapeutic agents, such as cancer therapeutics; research reagents, such as binding assay reagents; and diagnostic agents, such as in vivo imaging agents. All isotopic variants of the compounds described herein, whether or not radioactive, are intended to be included within the scope of the embodiments provided herein. In some embodiments, isotopologues of the compounds described herein are provided, for example, isotopologues are enriched in deuterium, carbon-13, and / or nitrogen-15. As used herein, "deuterated" refers to a compound in which at least one hydrogen (H) has been replaced by deuterium (as D or 2 H) substitution, that is, the compound is enriched in deuterium at at least one position.

[0080] It should be noted that if there is a discrepancy between a depicted structure and the name of that structure, the depicted structure shall prevail.

[0081] As used herein and unless otherwise indicated, the term "pharmaceutically acceptable carrier, diluent or excipient" includes, but is not limited to, any adjuvant, carrier, excipient, glidant, sweetener, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersant, suspending agent, stabilizer, isotonic agent, solvent or emulsifier approved by the U.S. Food and Drug Administration for acceptable use in humans or livestock.

[0082] The term "composition" is intended to encompass a product containing the specified ingredients (eg, mRNA molecules provided herein), optionally in the specified amounts.

[0083] As used interchangeably herein, the terms "polynucleotide" or "nucleic acid" refer to nucleotide polymers of any length, and include, for example, DNA and RNA. Nucleotides may be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or analogs thereof, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase or by a synthetic reaction. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and analogs thereof. Nucleic acids may be in single-stranded or double-stranded form. As used herein and unless otherwise indicated, "nucleic acid" also includes nucleic acid mimetics, such as locked nucleic acids (LNA), peptide nucleic acids (PNA) and morpholino nucleic acids. As used herein, "oligonucleotide" refers to a short synthetic polynucleotide, which is generally but not necessarily less than about 200 nucleotides in length. The terms "oligonucleotide" and "polynucleotide" are not mutually exclusive. The above description of polynucleotides is equally and fully applicable to oligonucleotides. Unless otherwise indicated, the left-hand end of any single-stranded polynucleotide sequence disclosed herein is the 5' end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5' direction. The direction of 5′ to 3′ addition of the nascent RNA transcript is called the transcription direction; the sequence region on the DNA strand that has the same sequence as the RNA transcript and is located at the 5′ end relative to the 5′ end of the RNA transcript is called the “upstream sequence”; the sequence region on the DNA strand that has the same sequence as the RNA transcript and is located at the 3′ end relative to the 3′ end of the RNA transcript is called the “downstream sequence”.

[0084] "Isolated nucleic acid" refers to nucleic acids, such as RNA, DNA or mixed nucleic acids, that are substantially separated from other genomic DNA sequences and proteins or complexes (such as ribosomes and polymerases) that naturally accompany native sequences. "Isolated" nucleic acid molecules are nucleic acid molecules that are separated from other nucleic acid molecules that are present in the natural source of nucleic acid molecules. In addition, when manufactured by recombinant technology, "isolated" nucleic acid molecules, such as mRNA molecules, may be substantially free of other cell materials or culture media, or when chemically synthesized, they may be substantially free of chemical precursors or other chemicals. In a specific embodiment, one or more nucleic acid molecules encoding antigens as described herein are separated or purified. The term includes nucleic acid sequences removed from their naturally occurring environment, and includes recombinant or cloned DNA or RNA isolates and chemically synthesized analogs or analogs synthesized by heterologous systems. Substantially pure molecules may include isolated forms of molecules.

[0085] The term "coding nucleic acid" or its grammatical equivalents when used to refer to nucleic acid molecules include (a) nucleic acid molecules that can be transcribed to produce mRNA and then translated into peptides and / or polypeptides when in a natural state or by methods well known to those skilled in the art; and (b) mRNA molecules themselves. The antisense strand is the complementary sequence of such nucleic acid molecules, and the coding sequence can be inferred therefrom. The term "coding region" refers to the portion of a coding nucleic acid sequence that is translated into a peptide or polypeptide. The term "untranslated region" or "UTR" refers to the portion of a coding nucleic acid that is not translated into a peptide or polypeptide. Depending on the orientation of the UTR relative to the coding region of the nucleic acid molecule, the UTR is called a 5'-UTR if it is located at the 5' end of the coding region, and the UTR is called a 3'-UTR if it is located at the 3' end of the coding region.

[0086] As used herein, the term "mRNA" refers to a messenger RNA molecule comprising one or more open reading frames (ORFs), which can be translated by a cell or organism having the mRNA to produce one or more peptide or protein products. The region containing one or more ORFs is referred to as the coding region of the mRNA molecule. In certain embodiments, the mRNA molecule further comprises one or more untranslated regions (UTRs).

[0087] In certain embodiments, mRNA is a monocistronic mRNA comprising only one ORF. In certain embodiments, monocistronic mRNA encodes a peptide or protein comprising at least one epitope of a selected antigen (e.g., a pathogenic antigen or a tumor-associated antigen). In other embodiments, mRNA is a polycistronic mRNA comprising two or more ORFs. In certain embodiments, polycistronic mRNA encodes two or more peptides or proteins that may be identical or different from each other. In certain embodiments, each peptide or protein encoded by polycistronic mRNA comprises at least one epitope of a selected antigen. In certain embodiments, different peptides or proteins encoded by polycistronic mRNA each comprise at least one epitope of a different antigen. In any one of the embodiments described herein, the at least one epitope may be at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 epitopes of an antigen.

[0088] The term "nucleobase" encompasses purines and pyrimidines, including the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural or synthetic analogs or derivatives thereof.

[0089] As used herein, the term "functional nucleotide analogue" refers to a modified form of a classical nucleotide A, G, C, U or T, which (a) retains the base pairing properties of the corresponding classical nucleotide and (b) contains at least one chemical modification of the (i) nucleobase, (ii) sugar group, (iii) phosphate group or (iv) any combination of (i) to (iii) of the corresponding natural nucleotide. As used herein, base pairing encompasses not only the classical Watson-Crick adenine-thymine, adenine-uracil or guanine-cytosine base pairs, but also base pairs formed between a classical nucleotide and a functional nucleotide analogue or between a pair of functional nucleotide analogues, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonds to be formed between a modified nucleobase and a classical nucleobase or between two complementary modified nucleobase structures. For example, a functional analogue of guanosine (G) retains the ability to base pair with cytosine (C) or a functional analogue of cytosine. An example of such non-classical base pairing is base pairing between modified nucleotides inosine and adenine, cytosine or uracil. As described herein, functional nucleotide analogs can be naturally occurring or non-naturally occurring. Therefore, nucleic acid molecules containing functional nucleotide analogs can have at least one modified nucleobase, sugar group and / or internucleoside linkage. Exemplary chemical modifications to the nucleobase, sugar group or internucleoside linkage of nucleic acid molecules are provided herein.

[0090] As used herein, the terms "translational enhancer element", "TEE" and "translational enhancer" refer to a region in a nucleic acid molecule that is used to promote the translation of a coding sequence of a nucleic acid into a protein or peptide product, such as via cap-dependent or cap-independent translation. TEEs are typically located in the UTR region of a nucleic acid molecule (e.g., mRNA) and enhance the translation level of a coding sequence located upstream or downstream. For example, a TEE in the 5′-UTR of a nucleic acid molecule can be located between the promoter and the start codon of the nucleic acid molecule. Various TEE sequences are known in the art (Wellensiek et al., Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, August 2013; 10(8):747-750; Chappell et al., PNAS, June 29, 2004, 101(26)9590-9594). Some TEEs are known to be conserved in multiple species (Pánek et al., Nucleic Acids Research, Vol. 41, No. 16, Sept. 1, 2013, pp. 7625-7634).

[0091] As used herein, the term "stem-loop sequence" refers to a single-stranded polynucleotide sequence having at least two regions that are complementary or substantially complementary to each other when read in opposite directions and are therefore capable of base pairing with each other to form at least one double helix and an unpaired loop. The resulting structure is called a stem-loop structure, a hairpin, or a hairpin loop, which is a secondary structure found in many RNA molecules.

[0092] As used herein, the term "peptide" refers to a polymer containing from two to fifty (2-50) amino acid residues linked via one or more covalent peptide bonds. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs or non-natural amino acids).

[0093] The terms "polypeptide" and "protein" are used interchangeably herein to refer to polymers having more than fifty (50) amino acid residues linked by covalent peptide bonds. That is, the description of polypeptides applies equally to the description of proteins, and vice versa. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is a non-naturally occurring amino acid (e.g., an amino acid analog). As used herein, the terms encompass amino acid chains of any length, including full-length proteins (e.g., antigens).

[0094] The term "antigen" refers to a substance that can be recognized by a subject's immune system (including an adaptive immune system) and can trigger an immune response (including an antigen-specific immune response) after the subject is contacted with the antigen. In certain embodiments, the antigen is a protein associated with a diseased cell, such as a cell infected with a pathogen or a neoplastic cell (e.g., a tumor-associated antigen (TAA)).

[0095] In the case of a peptide or polypeptide, as used herein, the term "fragment" refers to a peptide or polypeptide comprising an amino acid sequence that is less than the full length. Such fragments may, for example, come from truncation of the amino terminus, truncation of the carboxyl terminus, and / or internal deletions of residues in the amino acid sequence. Fragments may, for example, be produced by selective RNA splicing or by in vivo protease activity. In certain embodiments, a fragment refers to at least 5 consecutive amino acid residues, at least 10 consecutive amino acid residues, at least 15 consecutive amino acid residues, at least 20 consecutive amino acid residues, at least 25 consecutive amino acid residues, at least 30 consecutive amino acid residues, at least 40 consecutive amino acid residues, at least 50 consecutive amino acid residues, at least 60 consecutive amino acid residues, at least 70 consecutive amino acid residues, at least 80 consecutive amino acid residues, at least 90 consecutive amino acid residues, at least 100 consecutive amino acid residues, at least 110 consecutive amino acid residues, at least 120 consecutive amino acid residues, at least 130 consecutive amino acid residues, at least 140 consecutive amino acid residues, at least 150 consecutive amino acid residues, at least 160 consecutive amino acid residues, at least 170 consecutive amino acid residues, at least 180 consecutive amino acid residues, at least 190 consecutive amino acid residues, at least 200 consecutive amino acid residues, at least 210 consecutive amino acid residues, at least 220 consecutive amino acid residues, at least 230 consecutive amino acid residues, at least 240 consecutive amino acid residues, at least 250 consecutive amino acid residues, at least 260 consecutive amino acid residues, at least 270 consecutive amino acid residues, at least 280 consecutive amino acid residues, at least 290 consecutive amino acid residues, at least 300 consecutive amino acid residues, at least 310 consecutive In some embodiments, the fragment of a polypeptide has an amino acid sequence of at least 100 consecutive amino acid residues, at least 125 consecutive amino acid residues, at least 150 consecutive amino acid residues, at least 175 consecutive amino acid residues, at least 200 consecutive amino acid residues, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900 or at least 950 consecutive amino acid residues. In a specific embodiment, the fragment of a polypeptide retains at least one, at least two, at least three or more functions of the polypeptide.

[0096] "Epitope" is a site on the surface of an antigen molecule that binds to a single antibody molecule, such as a local area on the surface of an antigen that can bind to one or more antigen binding regions of an antibody, and it has antigenic or immunogenic activity in an animal, such as in a mammal (e.g., in a human body), and can cause an immune response. An epitope with immunogenic activity is a portion of a polypeptide that causes an antibody response in an animal. An epitope with antigenic activity is a portion of a polypeptide that is bound by an antibody determined by any method known in the art, including, for example, by immunoassay. Antigenic epitopes are not necessarily immunogenic. Epitopes are usually composed of chemically active surface groups of molecules, such as amino acids or sugar side chains, and have specific three-dimensional structural characteristics and specific charge characteristics. Antibody epitopes can be linear epitopes or conformational epitopes. Linear epitopes are formed by continuous amino acid sequences in proteins. Conformational epitopes are formed by amino acids that are discontinuous in a protein sequence but are bound together when the protein is folded into its three-dimensional structure. When the three-dimensional structure of a protein is in an altered conformation, such as after activation or binding of another protein or ligand, an inductive epitope is formed. In certain embodiments, an epitope is a three-dimensional surface feature of a polypeptide. In other embodiments, an epitope is a linear feature of a polypeptide. Generally, an antigen has several or many different epitopes and can react with many different antibodies.

[0097] As used herein, the term "gene vaccine" refers to a therapeutic or preventive composition comprising at least one nucleic acid molecule encoding an antigen associated with a target disease (e.g., an infectious disease or a neoplastic disease). Administration of a vaccine to a subject ("vaccination") allows the production of encoded peptides or proteins, thereby causing an immune response to the target disease in the subject. In certain embodiments, the immune response includes an adaptive immune response, such as the production of antibodies to the encoded antigen, and / or the activation and proliferation of immune cells that can specifically eliminate diseased cells expressing the antigen. In certain embodiments, the immune response further includes an innate immune response. According to the present disclosure, the vaccine may be administered to a subject before or after the onset of clinical symptoms of the target disease. In some embodiments, vaccination of healthy or asymptomatic subjects makes the vaccinated subject immune or less sensitive to the development of the target disease. In some embodiments, vaccination of subjects showing symptoms of the disease improves the disease condition of the vaccinated subject or treats the disease.

[0098] The terms "innate immune response" and "innate immunity" are recognized in the art and refer to non-specific defense mechanisms initiated by the body's immune system when pathogen-associated molecular patterns are recognized, which involve different forms of cellular activity, including cytokine production and cell death via various pathways. As used herein, the innate immune response includes, but is not limited to, increased production of inflammatory cytokines (e.g., type I interferon or IL-10 production); activation of the NFκB pathway; increased proliferation, maturation, differentiation and / or survival of immune cells, and in some cases, induction of apoptosis. Activation of innate immunity can be detected using methods known in the art, such as measuring (NF)-κB activation.

[0099] The terms "adaptive immune response" and "adaptive immunity" are recognized in the art and refer to antigen-specific defense mechanisms initiated by the body's immune system when a specific antigen is recognized, including humoral responses and cell-mediated responses. As used herein, an adaptive immune response includes a cellular response triggered and / or enhanced by a vaccine composition, such as a genetic composition described herein. In some embodiments, the vaccine composition comprises an antigen that is a target of an antigen-specific adaptive immune response. In other embodiments, the vaccine composition, upon administration, allows the production of an antigen in an immunized subject that is a target of an antigen-specific adaptive immune response. Activation of an adaptive immune response can be detected using methods known in the art, such as measuring the production of antigen-specific antibodies or levels of antigen-specific cell-mediated cytotoxicity.

[0100] The term "antibody" is intended to include polypeptide products of B cells within the scope of immunoglobulin polypeptides, which are capable of binding to specific molecular antigens and are composed of two pairs of identical polypeptide chains, each pair of which has a heavy chain (about 50-70 kDa) and a light chain (about 25 kDa), each amino terminal portion of each chain includes a variable region containing about 100 to about 130 or more amino acids, and each carboxyl terminal portion of each chain includes a constant region. See, for example, Antibody Engineering (Borrebaeck, ed., 2nd ed., 1995); and Kuby, Immunology (3rd ed., 1997). In a specific embodiment, a specific molecular antigen can be bound by the antibodies provided herein, including polypeptides, fragments thereof or epitopes. Antibodies also include, but are not limited to, synthetic antibodies, recombinantly produced antibodies, camelized antibodies, internal antibodies, anti-idiotype (anti-Id) antibodies, and functional fragments of any of the above, which refers to a portion of the antibody heavy chain or light chain polypeptide that retains part or all of the binding activity of the antibody from which the fragment is derived. Non-limiting examples of functional fragments include single-chain Fv (scFv) (e.g., including monospecific, bispecific, etc.), Fab fragments, F(ab') fragments, F(ab)2 fragments, F(ab')2 fragments, disulfide-linked Fv (dsFv), Fd fragments, Fv fragments, bifunctional antibodies, trifunctional antibodies, tetrafunctional antibodies and mini antibodies. Specifically, the antibodies provided herein include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, such as antigen binding domains or molecules containing antigen binding sites (e.g., one or more CDRs of an antibody). Such antibody fragments can be found, for example, in Harlow and Lane, Antibodies: A Laboratory Manual (1989); Mol. Biology and Biotechnology: A Comprehensive Desk Reference (Myers ed., 1995); Huston et al., 1993, Cell Biophysics 22: 189-224; Plüickthun and Skerra, 1989, Meth. Enzymol. 178: 497-515; and Day, Advanced Immunochemistry (2nd ed., 1990). The antibodies provided herein can be any class (e.g., IgG, IgE, IgM, IgD and IgA) or any subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) of immunoglobulin molecules.

[0101] The term "administering" refers to the operation of injecting or otherwise physically delivering a substance (e.g., a lipid nanoparticle composition described herein) present in vitro to a patient's body, such as transmucosal, intradermal, intravenous, intramuscular, and / or any other physical delivery method described herein or known in the art. When treating a disease, disorder, illness, or symptom thereof, the administration of the substance is typically performed after the onset of the disease, disorder, illness, or symptom thereof. When preventing a disease, disorder, illness, or symptom thereof, the administration of the substance is typically performed before the onset of the disease, disorder, illness, or symptom thereof.

[0102] "Long-term" administration, as opposed to an acute mode, refers to administration of one or more agents in a continuous mode (e.g., over a period of time, such as days, weeks, months or years), thereby maintaining the initial therapeutic effect (activity) over a longer period of time. "Intermittent" administration refers to treatment that is not continuous without interruption, but rather is cyclical in nature.

[0103] As used herein, the term "targeted delivery" or verb form "targeting" refers to a process in which the delivered agent (such as the therapeutic payload molecule in the lipid nanoparticle composition as described herein) reaches a specific organ, tissue, cell and / or intracellular compartment (referred to as the target location) compared to delivery to any other organ, tissue, cell or intracellular compartment (referred to as a non-target location). Targeted delivery can be detected using methods known in the art, such as by comparing the concentration of the delivered agent in the target cell population with the concentration of the delivered agent at the non-target cell population after systemic administration. In certain embodiments, targeted delivery makes the concentration at the target location at least 2 times higher than the concentration at the non-target location.

[0104] An "effective amount" is generally an amount sufficient to reduce the severity and / or frequency of symptoms; eliminate symptoms and / or potential causes; prevent the occurrence of symptoms and / or their potential causes; and / or improve or remedy damage caused by a disease, disorder or condition, including, for example, an infection and neoplasm formation or associated therewith. In some embodiments, an effective amount is a therapeutically effective amount or a prophylactically effective amount.

[0105] As used herein, the term "therapeutically effective amount" refers to an amount of an agent (e.g., a vaccine composition) sufficient to reduce and / or improve the severity and / or duration of a given disease, disorder or condition, and / or its associated symptoms (e.g., infectious diseases, such as those caused by viral infection, or neoplastic diseases, such as cancer). The "therapeutically effective amount" of a substance / molecule / agent disclosed herein (e.g., a lipid nanoparticle composition described herein) may vary according to many factors, such as the disease state, age, sex, and weight of the individual, and the ability of the substance / molecule / agent to elicit a desired response in the individual. A therapeutically effective amount includes an amount in which the therapeutically beneficial effects of a substance / molecule / agent outweigh any toxic or deleterious effects thereof. In certain embodiments, the term "therapeutically effective amount" refers to an amount of a lipid nanoparticle composition as described herein or a therapeutic agent or prophylactic agent (e.g., therapeutic mRNA) contained therein that is effective to "treat" a disease, disorder, or condition of a subject or mammal.

[0106] A "prophylactically effective amount" is an amount of a pharmaceutical composition that will have the intended prophylactic effect when administered to a subject, such as preventing a disease, disorder, illness, or related symptoms (e.g., an infectious disease, such as an infectious disease caused by a viral infection, or a neoplastic disease, such as cancer), delaying its onset (or recurrence), or reducing the likelihood of its onset (or recurrence). Typically, but not necessarily, since a prophylactic dose is used for a subject before a disease, disorder, or illness or in its early stages, the prophylactic effective amount may be less than the therapeutically effective amount. A complete therapeutic or prophylactic effect may not occur by administering a single dose, but may only occur after a series of doses are administered. Therefore, a therapeutically or prophylactically effective amount may be administered in one or more administrations.

[0107] The terms "prevent" and "preventing" refer to reducing the likelihood of the onset (or recurrence) of a disease, disorder, condition or associated symptoms (eg, an infectious disease, such as caused by a viral infection, or a neoplastic disease, such as cancer).

[0108] The term "management" refers to the beneficial effects that a subject obtains from a therapy (e.g., a prophylactic or therapeutic agent) that does not result in a cure of the disease. In certain embodiments, one or more therapies (e.g., a prophylactic or therapeutic agent, such as a lipid nanoparticle composition described herein) are administered to a subject to "manage" an infectious or neoplastic disease, one or more symptoms thereof, thereby preventing progression or worsening of the disease.

[0109] The term "prophylactic agent" refers to any agent that can completely or partially inhibit the development, recurrence, onset, or spread of a disease and / or its associated symptoms in a subject.

[0110] The term "therapeutic agent" refers to any agent useful in treating, preventing or alleviating a disease, disorder or condition, including any agent useful in treating, preventing or alleviating one or more symptoms of a disease, disorder or condition and / or its associated symptoms.

[0111] The term "therapy" refers to any regimen, method and / or agent that can be used to prevent, manage, treat and / or improve a disease, disorder or condition. In certain embodiments, the term "therapy" refers to biological therapy, supportive therapy and / or other therapy known to a person skilled in the art, such as a medical professional, that can be used to prevent, manage, treat and / or improve a disease, disorder or condition.

[0112] The term "side effect" encompasses unwanted and / or adverse effects of a therapy (e.g., a preventive or therapeutic agent). An unwanted effect is not necessarily adverse. The adverse effects of a therapy (e.g., a preventive or therapeutic agent) may be harmful, uncomfortable, or risky. Examples of side effects include diarrhea, cough, gastroenteritis, wheezing, nausea, vomiting, anorexia, abdominal cramps, fever, pain, weight loss, dehydration, alopecia, dyspnea, insomnia, dizziness, mucositis, nerve and muscle effects, fatigue, dry mouth, loss of appetite, rash or swelling at the site of application, flu-like symptoms such as fever, chills, and fatigue, digestive tract problems, and allergic reactions. Other undesirable effects experienced by patients are numerous and known in the art. There are many effects described in Physician's Desk Reference (68th edition, 2014).

[0113] The terms "subject" and "patient" are used interchangeably. As used herein, in certain embodiments, the subject is a mammal, such as a non-primate (e.g., cattle, pigs, horses, cats, dogs, rats, etc.) or a primate (e.g., monkeys and humans). In specific embodiments, the subject is a human. In one embodiment, the subject is a mammal (e.g., a human) suffering from an infectious disease or a neoplastic disease. In another embodiment, the subject is a mammal (e.g., a human) at risk of developing an infectious disease or a neoplastic disease.

[0114] By "substantially all" is meant at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or about 100%.

[0115] As used herein and unless otherwise indicated, the term "about" or "approximately" means an acceptable error for a particular value determined by a person of ordinary skill in the art, which depends in part on the manner in which the value is measured or determined. In certain embodiments, the term "about" or "approximately" means within 1, 2, 3, or 4 standard deviations. In certain embodiments, the terms "about" and "approximately" mean within 20%, within 15%, within 10%, within 9%, within 8%, within 7%, within 6%, within 5%, within 4%, within 3%, within 2%, within 1%, within 0.5%, within 0.05%, or less of a given value or range.

[0116] As used herein, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise.

[0117] All publications, patent applications, deposit numbers, and other references cited in this specification are incorporated herein by reference in their entirety to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The publications discussed herein are provided only as of the date of filing of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to predate such publications by virtue of prior invention. In addition, the publication dates provided may differ from the actual publication dates, which may require independent confirmation.

[0118] A number of embodiments of the present invention have been described. However, it should be understood that various modifications can be made without departing from the spirit and scope of the present invention. Therefore, the descriptions in the experimental section and examples are intended to illustrate rather than limit the scope of the invention described in the claims.

[0119] Lipid compounds

[0120] In a first aspect, the present disclosure provides compounds of formula (I):

[0121]

[0122] or a pharmaceutically acceptable salt, tautomer, prodrug or stereoisomer thereof, wherein:

[0123] G 1 and G 2 Each independently is a bond, C1-C 12 Alkylene or C2-C 12 alkenylene;

[0124] L 1 -OC(=O)R 1 、-C(=O)OR 1 、-OC(=O)OR1 、-C(=O)R 1 、-OR 1 ,

[0125] -S(O) x R 1 、-S-SR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 、-C(=O)NR b R c 、-NR a C(=O)NR b R c 、-OC(=O)NR b R c 、-NR a C(=O)OR 1 、-SC(=S)R 1 、-C(=S)SR 1 、-C(=S)R 1 、-CH(OH)R 1 、-P(=O)(OR b )(OR c )、-(C6-C 10 Arylene)-R 1 , -(6- to 10-membered heteroarylene)-R 1 or R 1 ;

[0126] R 1 C6-C 24 Alkyl or C6-C 24 Alkenyl or C6-C 24 Alkynyl;

[0127] R a and R b Each independently is H, C1-C 12 Alkyl, C2-C 12 Alkenyl or C2-C 12 Alkynyl;

[0128] R c C1-C 32 Alkyl or C2-C 32 alkenyl;

[0129] L 2 =-OC(=O)L 3 、-C(=O)OL 3 、-OC(=O)OL 3 、-C(=O)L3 , -OL 3 ,

[0130] -CH(OH)L 3 or L 3 ;

[0131] L 3 For-R 2 =R 3 =R 4 -R 5 or -R 6 -R 7 or -R 8 -R 9 ;

[0132] R 2 C 3-8 Cycloalkylene, preferably C6 cycloalkylene or R 2 for R d C 3-8 Cycloalkylene, preferably C6 cycloalkylene, R e and R f Each independently is H or C 1-12 Alkyl, R 3 C1-C 12 Alkylene or C2-C 12 Alkenylene, R 4 is a bicyclic group, preferably a C 5-8 Cycloalkyl C 5-8 Cycloalkyl, more preferably C6 cycloalkylene and C5 cycloalkylene, R 5 C2-C 24 Alkyl or C2-C 24 Alkenyl or C2-C 24 Alkynyl;

[0133] R 6 is a bicyclic group, preferably a C6 aryl group and a C 5-8 Heterocycloalkyl, more preferably C6 arylene and C6 heterocycloalkyl, R 7 C6-C 24 Alkyl or C6-C 24 Alkenyl or C6-C 24 Alkynyl;

[0134] R 8 C1-C 24 Alkylene or C2-C 24 Alkenylene, preferably C6-C 18 Alkylene or C6-C 18 Alkenylene, more preferably C 10 Alkylene or C 10 Alkenylene, R9 C 5-8 Cycloalkenyl, preferably C6 cycloalkenyl;

[0135] G 3 It is C1-C 12 Alkylene, preferably C2-C6 alkylene, more preferably C2-C4 alkylene;

[0136] R 10 is hydroxyl group;

[0137] x is 0, 1, or 2; and

[0138] wherein each alkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, alkylene, alkenylene, arylene, heteroarylene, cycloalkylene, bicyclolene, aryl is independently optionally substituted.

[0139] In one embodiment, G 1 In one embodiment, G 2 In one embodiment, G 1 and G 2 All are keys.

[0140] In one embodiment, G 1 and G 2 Each independently is C2-C 12 Alkylene or C2-C 12 In one embodiment, G 1 and G 2 Each independently is C2-C 12 In one embodiment, G 1 and G 2 Each independently is C2-C 12 In one embodiment, G 1 and G 2 Each is independently C3-C8 alkylene. 1 and G 2 Each is independently C6-C8 alkylene. 1 is C6 alkylene and G 2 In one embodiment, G 1 is C6 alkylene and G 2 is C7 alkylene. In one embodiment, G 1 is C6 alkylene and G 2 In one embodiment, G 1 is C7 alkylene and G 2 In one embodiment, G 1 is C7 alkylene and G2 In one embodiment, G 1 is C7 alkylene and G 2 In one embodiment, G 1 is C8 alkylene and G 2 In one embodiment, G 1 is C8 alkylene and G 2 In one embodiment, G 1 is C8 alkylene and G 2 It is a C8 alkylene group.

[0141] In one embodiment, G 1 In one embodiment, G 1 In one embodiment, G 1 In one embodiment, G 1 By (another) L 1 Replacement (ie, G 1 Connect to two L 1 ).

[0142] In one embodiment, G 2 In one embodiment, G 2 In one embodiment, G 2 In one embodiment, G 2 By (another) L 2 Replacement (ie, G 2 Connect to two L 2 ).

[0143] In one embodiment, G 1 for In one embodiment, G 1 for

[0144] In one embodiment, G 2 for In one embodiment, G 2 for

[0145] In one embodiment, L 1 Yes-OC(=O)R 1 、-C(=O)OR 1 、-OC(=O)OR 1 、-C(=O)R 1 、-OR 1 、-S(O) x R 1、-S-SR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 、-C(=O)NR b R c 、-NR a C(=O)NR b R c 、-OC(=O)NR b R c 、-NR a C(=O)OR 1 、-SC(=S)R 1 、-C(=S)SR 1 、-C(=S)R 1 、-CH(OH)R 1 OR-P(=O)(OR b )(OR c In one embodiment, L 1 Yes-(C6-C 10 Arylene)-R 1 In one embodiment, L 1 is -(6- to 10-membered heteroarylene)-R 1 In one embodiment, L 1 YesR 1 .

[0146] In one embodiment, L 1 Yes-OC(=O)R 1 、-C(=O)OR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 or -C(=O)NR b R c In one embodiment, L 1 Yes-OC(=O)R 1 、-C(=O)OR 1 、-NR a C(=O)R 1 or -C(=O)NR b R c In one embodiment, L 1 Yes-OC(=O)R 1 In one embodiment, L 1 Yes -C(=O)OR 1 In one embodiment, L1 Yes - NR a C(=O)R 1 In one embodiment, L 1 is -C(=O)NR b R c In one embodiment, L 1 Yes - NR a C(=O)NR b R c In one embodiment, L 1 Yes-OC(=O)NR b R c In one embodiment, L 1 Yes - NR a C(=O)OR 1 In one embodiment, L 1 Yes-OC(=O)OR 1 .

[0147] In one embodiment, R 1 Straight chain C6-C 24 In one embodiment, R 1 It is a straight chain C 10 -C 20 In one embodiment, R 1 It is a straight chain C 15 -C 17 In one embodiment, R 1 is a straight chain C7 alkyl group. 1 is a straight chain C8 alkyl group. 1 is a straight chain C9 alkyl group. 1 It is a straight chain C 10 In one embodiment, R 1 It is a straight chain C 11 In one embodiment, R 1 It is a straight chain C 12 In one embodiment, R 1 It is a straight chain C 13 In one embodiment, R 1 It is a straight chain C 14 In one embodiment, R 1 It is a straight chain C 15 In one embodiment, R 1 It is a straight chain C 16 In one embodiment, R 1 It is a straight chain C 17 In one embodiment, R 1It is a straight chain C 18 In one embodiment, R 1 It is a straight chain C 19 In one embodiment, R 1 It is a straight chain C 20 alkyl.

[0148] In one embodiment, R 1 Straight chain C6-C 24 In one embodiment, R 1 It is a straight chain C 10 -C 20 In one embodiment, R 1 It is a straight chain C 15 -C 17 In one embodiment, R 1 is a straight chain C7 alkenyl. 1 is a straight chain C8 alkenyl. 1 is a straight chain C9 alkenyl. 1 It is a straight chain C 10 In one embodiment, R 1 It is a straight chain C 11 In one embodiment, R 1 It is a straight chain C 12 In one embodiment, R 1 It is a straight chain C 13 In one embodiment, R 1 It is a straight chain C 14 In one embodiment, R 1 It is a straight chain C 15 In one embodiment, R 1 It is a straight chain C 16 In one embodiment, R 1 It is a straight chain C 17 In one embodiment, R 1 It is a straight chain C 18 In one embodiment, R 1 It is a straight chain C 19 In one embodiment, R 1 It is a straight chain C 20 Alkenyl.

[0149] In one embodiment, R 1 For branched C6-C 24 In one embodiment, R 1 It is a branched chain C 10 -C 20 In one embodiment, R1 It is a branched chain C 15 -C 17 In one embodiment, R 1 Yes-R g -CH(R h )(R i ), where R g is C0-C5 alkylene, and R h and R i Independently for C2-C 10 In one embodiment, R 1 Yes-R g -CH(R h )(R i ), where R g is C0-C1 alkylene, and R h and R i are independently C4-C8 alkyl. 1 Yes-R g -CH(R h )(R i ), where R g is a C0 alkylene group, and R h and R i In one embodiment, R 1 Yes-R g -CH(R h )(R i ), where R g is a C0 alkylene group, and R h and R i All are C8 alkyl.

[0150] In one embodiment, R 1 It is a branched C6-C 24 In one embodiment, R 1 Yes-R g -CH(R h )(R i ), where R g is C0-C5 alkylene, and R h and R i Independently for C2-C 10 In one embodiment, R 1 Yes-R g -CH(R h )(R i ), where R g is C0-C1 alkylene, and R h and R i Independently C6-C10 Alkenyl.

[0151] In one embodiment, L 1 for

[0152] In one embodiment, L 1 for

[0153] In one embodiment, L 1 for

[0154] In one embodiment, L 1 for

[0155] In one embodiment, L 1 for

[0156] In one embodiment, L 1 for

[0157] In one embodiment, L 1 for

[0158] In one embodiment, L 1 for

[0159] In one embodiment, L 2 =-OC(=O)L 3 In one embodiment, L 2 -C(=O)OL 3 In one embodiment, L 2 =OC(=O)OL 3 In one embodiment, L 2 -C(=O)L 3 In one embodiment, L 2 For-OL 3 In one embodiment, L 2 -CH(OH)L 3 In one embodiment, L 2 For L 3 .

[0160] In one embodiment, L 3 For-R 2 =R 3 =R 4 -R 5 .

[0161] In one embodiment, L2 -C(=O)OL 3 , and L 3 For-R 2 =R 3 =R 4 -R 5 .

[0162] In one embodiment, R 2 C 3-8 In one embodiment, R 2 is C3 cycloalkylene. In one embodiment, R 2 In one embodiment, R 2 is C5 cycloalkylene. 2 is C6 cycloalkylene. 2 is C7 cycloalkylene. In one embodiment, R 2 It is a C8 cycloalkylene group.

[0163] In one embodiment, R 2 for Where R d C 3-8 Cycloalkylene, R e and R f Each independently is H or C 1-12 In one embodiment, R d is C3 cycloalkylene. In one embodiment, R d In one embodiment, R d is C5 cycloalkylene. d is C6 cycloalkylene. d is C7 cycloalkylene. In one embodiment, R d is C8 cycloalkylene. e is H. In one embodiment, R e C1-C 10 In one embodiment, R e is C1-C8 alkyl. e is C1-C6 alkyl. In one embodiment, R e is C1-C4 alkyl. In one embodiment, R e is C1-C2 alkyl. In one embodiment, R e In one embodiment, R e In one embodiment, R e In one embodiment, Re In one embodiment, R e In one embodiment, R e In one embodiment, R e In one embodiment, R f is H. In one embodiment, R e C1-C 10 In one embodiment, R f is C1-C8 alkyl. f is C1-C6 alkyl. In one embodiment, R f is C1-C4 alkyl. In one embodiment, R f is C1-C2 alkyl. In one embodiment, R f In one embodiment, R f In one embodiment, R f In one embodiment, R f In one embodiment, R f In one embodiment, R f In one embodiment, R f In one embodiment, R 2 for Where R d is C6 cycloalkylene, R e and R f are H. In one embodiment, R 2 for R a’ , R b’ , R c’ , R d’ , R e’ In one embodiment, R 2 for

[0164] In one embodiment, R 3 C1-C 12 In one embodiment, R 3 In one embodiment, R 3 In one embodiment, R 3 is C3 alkylene. 3 is C4 alkylene. 3 is C5 alkylene. 3is C6 alkylene. In one embodiment, R 3 is C7 alkylene. In one embodiment, R 3 In one embodiment, R 3 is C9 alkylene. 3 C 10 In one embodiment, R 3 C 11 In one embodiment, R 3 C 12 Alkylene.

[0165] In one embodiment, R 3 C1-C 12 In one embodiment, R 3 In one embodiment, R 3 In one embodiment, R 3 In one embodiment, R 3 In one embodiment, R 3 In one embodiment, R 3 In one embodiment, R 3 In one embodiment, R 3 In one embodiment, R 3 In one embodiment, R 3 C 10 In one embodiment, R 3 C 11 In one embodiment, R 3 C 12 Alkenylene.

[0166] In one embodiment, R 3 for

[0167] In one embodiment, R 4 In one embodiment, R 4 Sub-C 5-8 Cycloalkyl C 5-8 In one embodiment, R 4 is C6 cycloalkylene and C5 cycloalkylene. 4 for R f’ , R g’ , R h’ , R i’, R j’ , R k’ , R l’ , R m’ In one embodiment, R 4 for R f’ , R g’ , R h’ , R i’ , R j’ , R k’ , R l’ , R m’ In one embodiment, R 4 for

[0168] In one embodiment, R 5 Straight chain C2-C 24 In one embodiment, R 5 It is a straight chain C6-C 16 In one embodiment, R 5 is a straight chain C8-C9 alkyl group. 5 is a straight chain C2 alkyl group. 5 is a straight chain C3 alkyl group. 5 is a straight chain C4 alkyl group. 5 is a straight chain C5 alkyl group. 5 is a straight chain C6 alkyl group. 5 is a straight chain C7 alkyl group. 5 is a straight chain C8 alkyl group. 5 is a straight chain C9 alkyl group. 5 It is a straight chain C 10 In one embodiment, R 5 It is a straight chain C 11 In one embodiment, R 5 It is a straight chain C 12 In one embodiment, R 5 It is a straight chain C 13 In one embodiment, R 5 It is a straight chain C 14 In one embodiment, R 5 It is a straight chain C 15 In one embodiment, R 5 It is a straight chain C 16 In one embodiment, R 5It is a straight chain C 17 In one embodiment, R 5 It is a straight chain C 18 In one embodiment, R 5 It is a straight chain C 19 In one embodiment, R 5 It is a straight chain C 20 In one embodiment, R 5 It is a straight chain C 21 In one embodiment, R 5 It is a straight chain C 22 In one embodiment, R 5 It is a straight chain C 23 In one embodiment, R 5 It is a straight chain C 24 alkyl.

[0169] In one embodiment, R 5 Straight chain C2-C 24 In one embodiment, R 5 It is a straight chain C6-C 16 In one embodiment, R 5 is a straight chain C8-C9 alkenyl. 5 is a straight chain C2 alkenyl. 5 is a straight chain C3 alkenyl. 5 is a straight chain C4 alkenyl. 5 is a straight chain C5 alkenyl. 5 is a straight chain C6 alkenyl. 5 is a straight chain C7 alkenyl. 5 is a straight chain C8 alkenyl. 5 is a straight chain C9 alkenyl. 5 It is a straight chain C 10 In one embodiment, R 5 It is a straight chain C 11 In one embodiment, R 5 It is a straight chain C 12 In one embodiment, R 5 It is a straight chain C 13 In one embodiment, R 5 It is a straight chain C 14 In one embodiment, R 5 It is a straight chain C 15 In one embodiment, R 5It is a straight chain C 16 In one embodiment, R 5 It is a straight chain C 17 In one embodiment, R 5 It is a straight chain C 18 In one embodiment, R 5 It is a straight chain C 19 In one embodiment, R 5 It is a straight chain C 20 In one embodiment, R 5 It is a straight chain C 21 In one embodiment, R 5 It is a straight chain C 22 In one embodiment, R 5 It is a straight chain C 23 In one embodiment, R 5 It is a straight chain C 24 Alkenyl.

[0170] In one embodiment, R 5 For branched chain C2-C 24 In one embodiment, R 5 It is a branched C6-C 16 In one embodiment, R 5 is a branched C8-C9 alkyl group. 5 is a branched C2 alkyl group. 5 is a branched C3 alkyl group. 5 is a branched C4 alkyl group. 5 is a branched C5 alkyl group. 5 is a branched C6 alkyl group. 5 is a branched C7 alkyl group. 5 is a branched C8 alkyl group. 5 is a branched C9 alkyl group. 5 It is a branched chain C 10 In one embodiment, R 5 It is a branched chain C 11 In one embodiment, R 5 It is a branched chain C 12 In one embodiment, R 5 It is a branched chain C 13 In one embodiment, R 5 It is a branched chain C 14 In one embodiment, R 5It is a branched chain C 15 In one embodiment, R 5 It is a branched chain C 16 In one embodiment, R 5 It is a branched chain C 17 In one embodiment, R 5 It is a branched chain C 18 In one embodiment, R 5 It is a branched chain C 19 In one embodiment, R 5 It is a branched chain C 20 In one embodiment, R 5 It is a branched chain C 21 In one embodiment, R 5 It is a branched chain C 22 In one embodiment, R 5 It is a branched chain C 23 In one embodiment, R 5 It is a branched chain C 24 In one embodiment, R 5 for

[0171] In one embodiment, R 5 For branched chain C2-C 24 In one embodiment, R 5 It is a branched C6-C 16 In one embodiment, R 5 is a branched C8-C9 alkenyl group. 5 is a branched C2 alkenyl group. 5 is a branched C3 alkenyl. In one embodiment, R 5 is a branched C4 alkenyl. In one embodiment, R 5 is a branched C5 alkenyl. 5 is a branched C6 alkenyl. 5 is a branched C7 alkenyl. In one embodiment, R 5 is a branched C8 alkenyl. 5 is a branched C9 alkenyl. 5 It is a branched chain C 10 In one embodiment, R 5 It is a branched chain C 11 In one embodiment, R 5 It is a branched chain C 12 In one embodiment, R 5 It is a branched chain C13 In one embodiment, R 5 It is a branched chain C 14 In one embodiment, R 5 It is a branched chain C 15 In one embodiment, R 5 It is a branched chain C 16 In one embodiment, R 5 It is a branched chain C 17 In one embodiment, R 5 It is a branched chain C 18 In one embodiment, R 5 It is a branched chain C 19 In one embodiment, R 5 It is a branched chain C 20 In one embodiment, R 5 It is a branched chain C 21 In one embodiment, R 5 It is a branched chain C 22 In one embodiment, R 5 It is a branched chain C 23 In one embodiment, R 5 It is a branched chain C 24 In one embodiment, R 5 yes

[0172] In one embodiment, L 3 for:

[0173]

[0174] R a’ , R b’ , R c’ , R d’ , R e’ are independently selected from H, C1-C6 alkyl, and

[0175] R f’ , R g’ , R h’ , R i’ , R j’ , R k’ , R l’ , R m’ Independently selected from H, C1-C6 alkyl.

[0176] In one embodiment, L 3 for:

[0177]

[0178] In one embodiment, L 3 for:

[0179]

[0180] In one embodiment, L 3 For-R 6 -R 7 .

[0181] In one embodiment, L 2 -C(=O)OL 3 , L 3 For-R 6 -R 7 .

[0182] In one embodiment, R 6 In one embodiment, R 6 is C6 aryl and C 5-8 In one embodiment, R 6 is C6 arylene and C6 heterocycloalkyl. In one embodiment, R 6 for R n’ , R o’ , R p’ , R q’ , R r’ , R s’ , are independently selected from H, C1-C6 alkyl. In one embodiment, R 6 for R n’ , R o’ , R p’ , R q’ , R r’ , R s’ In one embodiment, R 6 for

[0183] In one embodiment, R 7 Straight chain C6-C 24 In one embodiment, R 7 For straight chain C 12 -C 18 In one embodiment, R 7 is a straight chain C6 alkyl group. 7 is a straight chain C7 alkyl group. 7 is a straight chain C8 alkyl group. 7 is a straight chain C9 alkyl group.7 It is a straight chain C 10 In one embodiment, R 7 It is a straight chain C 11 In one embodiment, R 7 It is a straight chain C 12 In one embodiment, R 7 It is a straight chain C 13 In one embodiment, R 7 It is a straight chain C 14 In one embodiment, R 7 It is a straight chain C 15 In one embodiment, R 7 It is a straight chain C 16 In one embodiment, R 7 It is a straight chain C 17 In one embodiment, R 7 It is a straight chain C 18 In one embodiment, R 7 It is a straight chain C 19 In one embodiment, R 7 It is a straight chain C 20 In one embodiment, R 7 It is a straight chain C 21 In one embodiment, R 7 It is a straight chain C 22 In one embodiment, R 7 It is a straight chain C 23 In one embodiment, R 7 It is a straight chain C 24 alkyl.

[0184] In one embodiment, R 7 Straight chain C6-C 24 In one embodiment, R 7 For straight chain C 12 -C 18 In one embodiment, R 7 is a straight chain C6 alkenyl. 7 is a straight chain C7 alkenyl. 7 is a straight chain C8 alkenyl. 7 is a straight chain C9 alkenyl. 7 It is a straight chain C 10 In one embodiment, R 7 It is a straight chain C 11 In one embodiment, R 7 It is a straight chain C12 In one embodiment, R 7 It is a straight chain C 13 In one embodiment, R 7 It is a straight chain C 14 In one embodiment, R 7 It is a straight chain C 15 In one embodiment, R 7 It is a straight chain C 16 In one embodiment, R 7 It is a straight chain C 17 In one embodiment, R 7 It is a straight chain C 18 In one embodiment, R 7 It is a straight chain C 19 In one embodiment, R 7 It is a straight chain C 20 In one embodiment, R 7 It is a straight chain C 21 In one embodiment, R 7 It is a straight chain C 22 In one embodiment, R 7 It is a straight chain C 23 In one embodiment, R 7 It is a straight chain C 24 Alkenyl.

[0185] In one embodiment, R 7 For branched C6-C 24 In one embodiment, R 7 For branched chain C 12 -C 18 In one embodiment, R 7 is a branched C6 alkyl group. 7 is a branched C7 alkyl group. 7 is a branched C8 alkyl group. 7 is a branched C9 alkyl group. 7 It is a branched chain C 10 In one embodiment, R 7 It is a branched chain C 11 In one embodiment, R 7 It is a branched chain C 12 In one embodiment, R 7 It is a branched chain C 13 In one embodiment, R 7 It is a branched chain C 14In one embodiment, R 7 It is a branched chain C 15 In one embodiment, R 7 It is a branched chain C 16 In one embodiment, R 7 It is a branched chain C 17 In one embodiment, R 7 It is a branched chain C 18 In one embodiment, R 7 It is a branched chain C 19 In one embodiment, R 7 It is a branched chain C 20 In one embodiment, R 7 It is a branched chain C 21 In one embodiment, R 7 It is a branched chain C 22 In one embodiment, R 7 It is a branched chain C 23 In one embodiment, R 7 It is a branched chain C 24 In one embodiment, R 7 for

[0186] In one embodiment, L 3 for:

[0187]

[0188] In one embodiment, L 3 For-R 8 -R 9 .

[0189] In one embodiment, L 2 =-OC(=O)L 3 , and L 3 For-R 8 -R 9 .

[0190] In one embodiment, R 8 Straight chain C1-C 24 In one embodiment, R 8 Straight chain C6-C 18 In one embodiment, R 8 is a straight chain C6 alkylene group. 8 is a straight chain C7 alkylene group. 8 is a straight chain C8 alkylene group. 8is a straight chain C9 alkylene group. 8 For straight chain C 10 In one embodiment, R 8 For straight chain C 11 In one embodiment, R 8 For straight chain C 12 In one embodiment, R 8 For straight chain C 13 In one embodiment, R 8 For straight chain C 14 In one embodiment, R 8 For straight chain C 15 In one embodiment, R 8 For straight chain C 16 In one embodiment, R 8 For straight chain C 17 In one embodiment, R 8 For straight chain C 18 Alkylene.

[0191] In one embodiment, R 8 Straight chain C1-C 24 In one embodiment, R 8 Straight chain C6-C 18 In one embodiment, R 8 is a straight chain C6 alkenylene. 8 is a straight chain C7 alkenylene. 8 is a straight chain C8 alkenylene. 8 is a straight chain C9 alkenylene. 8 For straight chain C 10 In one embodiment, R 8 For straight chain C 11 In one embodiment, R 8 For straight chain C 12 In one embodiment, R 8 For straight chain C 13 In one embodiment, R 8 For straight chain C 14 In one embodiment, R 8 For straight chain C 15 In one embodiment, R 8 For straight chain C 16 In one embodiment, R 8 For straight chain C 17In one embodiment, R 8 For straight chain C 18 Alkenylene.

[0192] In one embodiment, R 8 For branched chain C1-C 24 In one embodiment, R 8 For branched C6-C 18 In one embodiment, R 8 is a branched C6 alkylene group. 8 is a branched C7 alkylene group. 8 is a branched C8 alkylene group. 8 is a branched C9 alkylene group. 8 For branched chain C 10 In one embodiment, R 8 For branched chain C 11 In one embodiment, R 8 For branched chain C 12 In one embodiment, R 8 For branched chain C 13 In one embodiment, R 8 For branched chain C 14 In one embodiment, R 8 For branched chain C 15 In one embodiment, R 8 For branched chain C 16 In one embodiment, R 8 For branched chain C 17 In one embodiment, R 8 For branched chain C 18 Alkylene.

[0193] In one embodiment, R 8 For branched chain C1-C 24 In one embodiment, R 8 For branched C6-C 18 In one embodiment, R 8 is a branched C6 alkenylene. 8 is a branched C7 alkenylene. 8 is a branched C8 alkenylene. 8 is a branched C9 alkenylene group. 8 For branched chain C 10 In one embodiment, R8 For branched chain C 11 In one embodiment, R 8 For branched chain C 12 In one embodiment, R 8 For branched chain C 13 In one embodiment, R 8 For branched chain C 14 In one embodiment, R 8 For branched chain C 15 In one embodiment, R 8 For branched chain C 16 In one embodiment, R 8 For branched chain C 17 In one embodiment, R 8 For branched chain C 18 In one embodiment, R 8 for

[0194] In one embodiment, R 9 C 5-8 In one embodiment, R 9 is a C5 cycloalkenyl group. 9 is a C6 cycloalkenyl group. 9 is a C7 cycloalkenyl group. 9 is a C8 cycloalkenyl group. 9 for R t’ , R u’ , R v’ , R w’ , R x’ , R y’ In one embodiment, R 9 for R t’ , R u’ , R v’ , R w’ , R x’ , R y’ In one embodiment, R 9 for

[0195] In one embodiment, L 3 for:

[0196]

[0197] In one embodiment, G 3 C2-C 12 In one embodiment, G 3 is C2-C6 alkylene. 3 is C2-C4 alkylene. 3 In one embodiment, G 3 In one embodiment, G 3 In one embodiment, G 3 In one embodiment, G 3 In one embodiment, G 3 In one embodiment, G 3 In one embodiment, G 3 In one embodiment, G 3 C 10 In one embodiment, G 3 C 11 In one embodiment, G 3 C 12 In one embodiment, G 3 for In one embodiment, G 3 for

[0198] In one embodiment, the compound is a compound in the following table or a pharmaceutically acceptable salt, tautomer, prodrug or stereoisomer thereof.

[0199]

[0200]

[0201]

[0202] It should be understood that any embodiment of the compound provided herein as shown above, and any specific substituent and / or variable of the compound provided herein as shown above can be independently combined with other embodiments of the compound and / or substituent and / or variable to form the above embodiment not specifically set forth. In addition, in the case of listing the substituent and / or variable list of any specific group or variable, it should be understood that each individual substituent and / or variable can be deleted from specific embodiments and / or claims, and the remaining substituent and / or variable list will be considered to be within the scope of the embodiment provided herein.

[0203] It is understood that in the present specification, combinations of substituents and / or variables in the various formulae depicted are permissible only if such contributions result in stable compounds.

[0204] Nanoparticle composition

[0205] In one aspect, described herein are nanoparticle compositions comprising a lipid compound as described herein. In certain embodiments, the nanoparticle composition comprises a compound according to formula (I) (and subformulae thereof) as described herein.

[0206] In some embodiments, when measured, for example, by dynamic light scattering (DLS), transmission electron microscopy, scanning electron microscopy or another method, the maximum size of the nanoparticle composition provided herein is 1 μm or shorter (e.g., ≤1 μm, <900nm, ≤800nm, <700nm, ≤600nm, <500nm, <400nm, ≤300nm, ≤200nm, ≤175nm, ≤150nm, ≤125nm, ≤100nm, ≤75nm, ≤50nm or shorter). In one embodiment, the lipid nanoparticles provided herein have at least one dimension in the range of about 40nm to about 200nm. In one embodiment, the at least one dimension is in the range of about 40nm to about 100nm.

[0207] Nanoparticle compositions that can be used in conjunction with the present disclosure include, for example, lipid nanoparticles (LNPs), nanolipoprotein particles, liposomes, lipid vesicles, and lipid complexes. In some embodiments, the nanoparticle composition is a vesicle comprising one or more lipid bilayers. In some embodiments, the nanoparticle composition comprises two or more concentric bilayers separated by aqueous compartments. The lipid bilayers can be functionalized and / or cross-linked to each other. The lipid bilayer can include one or more ligands, proteins, or channels.

[0208] The characteristics of a nanoparticle composition can depend on its components. For example, a nanoparticle composition comprising cholesterol as a structural lipid can have different characteristics than a nanoparticle composition comprising a different structural lipid. Similarly, the characteristics of a nanoparticle composition can depend on the absolute or relative amounts of its components. For example, a nanoparticle composition comprising a higher mole fraction of phospholipids can have different characteristics than a nanoparticle composition comprising a lower mole fraction of phospholipids. Characteristics can also vary depending on the method and conditions of preparation of the nanoparticle composition.

[0209] Nanoparticle compositions can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of nanoparticle compositions. Zeta potential can be measured using dynamic light scattering or potentiometric methods (e.g., potentiometric titration). Dynamic light scattering can also be used to determine particle size. Instruments such as Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, Worcestershire, UK) can also be used to measure multiple features of nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.

[0210] Dh (size): The average size of the nanoparticle composition can be between tens of nanometers and hundreds of nanometers. For example, the average size can be about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average size of the nanoparticle composition may be about 50nm to about 100nm, about 50nm to about 90nm, about 50nm to about 80nm, about 50nm to about 70nm, about 50nm to about 60nm, about 60nm to about 100nm, about 60nm to about 90nm, about 60nm to about 80nm, about 60nm to about 70nm, about 70nm to about 100nm, about 70nm to about 90nm, about 70nm to about 80nm, about 80nm to about 100nm, about 80nm to about 90nm, or about 90nm to about 100nm. In certain embodiments, the average size of the nanoparticle composition may be about 70nm to about 100nm. In some embodiments, the average size may be about 80nm. In other embodiments, the average size may be about 100nm.

[0211] PDI: The nanoparticle composition can be relatively homogeneous. The polydispersity index can be used to indicate the homogeneity of the nanoparticle composition, such as the particle size distribution of the nanoparticle composition. A smaller polydispersity index (e.g., less than 0.3) generally indicates a narrower particle size distribution. The polydispersity index of the nanoparticle composition can be from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition can be from about 0.10 to about 0.20.

[0212] Encapsulation efficiency: The encapsulation efficiency of a therapeutic and / or prophylactic agent describes the amount of a therapeutic and / or prophylactic agent encapsulated or otherwise associated with a nanoparticle composition after preparation relative to the initial amount provided. The encapsulation efficiency is desirably high (e.g., close to 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of a therapeutic and / or prophylactic agent in a solution containing a nanoparticle composition before and after the nanoparticle composition is destroyed with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and / or prophylactic agents (e.g., RNA) in a solution. For the nanoparticle compositions described herein, the encapsulation efficiency of the therapeutic and / or prophylactic agent may be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In certain embodiments, the encapsulation efficiency may be at least 90%.

[0213] Zeta potential: The zeta potential of a nanoparticle composition can be used to indicate the kinetic potential of the composition. For example, the zeta potential can describe the surface charge of a nanoparticle composition. Nanoparticle compositions with relatively low positive or negative charges are generally desirable because higher charged materials can interact undesirably with cells, tissues, and other components in the body. In some embodiments, the zeta potential of the nanoparticle composition may be from about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0214] In another embodiment, the self-replicating RNA may be formulated in liposomes. As a non-limiting example, the self-replicating RNA may be formulated in liposomes as described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety. In one aspect, the liposomes may include lipids having a pKa value that is favorable for delivering mRNA. In another aspect, the liposomes may have a substantially neutral surface charge at physiological pH and may therefore be effectively used for immunization (see, for example, the liposomes described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety).

[0215] In some embodiments, the nanoparticle composition comprises a lipid component comprising at least one lipid, such as a compound according to one of formula (I) (and its subformulae) as described herein. For example, in some embodiments, the nanoparticle composition may comprise a lipid component comprising a compound provided herein. The nanoparticle composition may also comprise one or more other lipid or non-lipid components as described below.

[0216] Cationic / ionizable lipids

[0217] As described herein, in some embodiments, the nanoparticle compositions provided herein include, in addition to the lipids according to formula (I) (and its subformulae), one or more charged or ionizable lipids. Without being bound by theory, it is expected that certain charged or zwitterionic lipid components of the nanoparticle compositions are similar to lipid components in cell membranes, thereby improving the cellular uptake of nanoparticles. Exemplary charged or ionizable lipids that can form part of the nanoparticle compositions of the present invention include, but are not limited to, 3-(didodecylamino)-N1,N1,4-tri(dodecyl)-1-piperazineethylamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tri(dodecyl)-1,4-piperazinediethylamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-trioctadecane (KL25), 1,2-dilinoleyloxy-N,N -dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), 4-(dimethylamino)butyric acid heptaheptacontriacont-6,9,28,31-tetraen-19-yl ester (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane ( DODMA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadec-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadec-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), nDMA(2R)), (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z-,12Z)-octadec-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2S)), (12Z,15Z)-N,N-dimethyl-2-nonylheneicosadeca-12,15-dien-1-amine, N,N-dimethyl-1-{(1S,2R)-2-octylcyclopropyl}heptadecan-8-amine.Additional exemplary charged or ionizable lipids that can form part of the nanoparticle compositions of the present invention include lipids (e.g., Lipid 5) described in Sabnis et al., "A Novel Amino Lipid Series for mRNA Delivery: Improved Endosomal Escape and Sustained Pharmacology and Safety in Non-human Primates," Molec μLar Therapy, Vol. 26, No. 6, 2018, which is incorporated herein by reference in its entirety.

[0218] In some embodiments, suitable cationic lipids include N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA); N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP); 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC); 1,2-dilauroyl-sn-glycero-3-ethylphosphocholine (DLEPC); 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DLEPC); alkali (DMEPC); 1,2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (14:1); N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-amino-propyl)amino]butylcarboxamido)ethyl]-3,4-di[oleyloxy]-benzamide (MVL5); dioctadecylamido-glycyl tetramine (DOGS); 3b-[N-(N′,N′-dimethylaminoethyl)carbamoyl]cholesterol (DC-Chol); dioctadecyl bromide 1,2-Dioleoyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE); 1,2-Dioleoyl-3-dimethyl-hydroxyethylammonium bromide (DORIE); 1,2-Dioleoyloxypropyl-3-dimethylhydroxyethylammonium chloride (DORI); Dialkylated amino acids (DILA2) (e.g. C18: 1-norArg-C16); Dioleyldimethylammonium chloride (DODAC); 1-Palmitoyl Acyl-2-oleoyl-sn-glycero-3-ethylphosphocholine (POEPC); 1,2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (MOEPC); (R)-5-(dimethylamino)pentane-1,2-diyl dioleate hydrochloride (DODAPen-Cl); (R)-5-guanidinopentane-1,2-diyl dioleate hydrochloride (DOPen-G); and (R)-N,N,N-trimethyl-4,5-bis(oleoyloxy)pentan-1-amineium chloride (DOTAPen). Cationic lipids with charged head groups at physiological pH are also suitable, such as primary amines (e.g., DODAGN', N'-dioctadecyl-N-4,8-diaza-10-aminodecanoyl glycine amide) and guanidinium head groups (e.g., bis-guanidinium-sperm triamine-cholesterol (BGSC), bis-guanidinium-tren-cholesterol (BGTC), PONA, and (R)-5-guanidinopentane-1,2-diyl dioleate hydrochloride (DOPen-G)). Another suitable cationic lipid is (R)-5-(dimethylamino)pentane-1,2-diyl dioleate hydrochloride (DODAPen-Cl).In certain embodiments, the cationic lipid is a specific enantiomer or racemic form, and includes various salt forms (e.g., chlorides or sulfates) of the above-mentioned cationic lipids. For example, in some embodiments, the cationic lipid is N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP-Cl) or N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium sulfate (DOTAP-sulfate). In some embodiments, the cationic lipid is an ionizable cationic lipid, such as dioctadecyl dimethyl ammonium bromide (DDAB); 1,2-dilinoleyloxy-3-dimethylaminopropane (DLinDMA); 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA); 4-(dimethylamino)butyric acid triheptadecanoyl-6,9,28,31-tetraen-19-yl ester (DLin-MC3-DMA); 1,2-dioleoyloxy-3-dimethylaminopropane (DODAP); 1,2-dioleyloxy-3-dimethylaminopropane (DODMA); and N-morpholinyl cholesterol (Mo-CHOL). In certain embodiments, the lipid nanoparticle includes a combination of two or more cationic lipids (e.g., two or more of the above cationic lipids).

[0219] In addition, in some embodiments, the charged or ionizable lipid that can form part of the nanoparticle composition of the present invention is a lipid that includes a cyclic amine group. Additional cationic lipids suitable for use in the formulations and methods disclosed herein include those described in WO2015199952, WO2016176330, and WO2015011633, the entire contents of each case are incorporated herein by reference in their entirety.

[0220] Polymer-bound lipids

[0221] In some embodiments, the lipid component of the nanoparticle composition may include one or more polymer-bound lipids, such as PEGylated lipids (PEG lipids). Without being bound by theory, it is expected that the polymer-bound lipid component in the nanoparticle composition can improve colloidal stability and / or reduce the protein absorption of nanoparticles. The lipid that can be combined with the exemplary polymer used in the present disclosure includes but is not limited to PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol and its mixture. For example, PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, ceramide-PEG2000 or Chol-PEG2000.

[0222] In one embodiment, the polymer-bound lipid is a pegylated lipid. For example, some embodiments include pegylated diacylglycerol (PEG-DAG), such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG); pegylated phosphatidylethanolamine (PEG-PE); PEG succinate diacylglycerol (PEG-S-DAG), such as 4-O-(2', 3'-di-tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG); pegylated ceramide (PEG-cer); or PEG dialkoxypropyl carbamate, such as ω-methoxy(polyethoxy)ethyl-N-(2,3-di-tetradecanoyloxy)propyl)carbamate or 2,3-di-tetradecanoyloxy)propyl-N-(ω-methoxy)(polyethoxy)ethyl)carbamate.

[0223] In one embodiment, the polymer-bound lipid is present at a concentration in the range of 1.0 mol% to 1.5 mol%. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.5 mol%.

[0224] In one embodiment, the molar ratio of ionizable lipid to polymer-bound lipid is in the range of about 100:1 to about 20:1, about 35:1 to about 25:1, preferably about 47.5:1.8.

[0225] In one embodiment, the PEGylated lipid has the formula:

[0226]

[0227] or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein:

[0228] R 12 and R 13 Each is independently a linear or branched saturated or unsaturated alkyl chain containing 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester bonds; and

[0229] w has an average value in the range of 30 to 60.

[0230] In one embodiment, R 12 and R 13Each independently is a linear saturated alkyl chain containing 12 to 16 carbon atoms. In other embodiments, the average w is in the range of 42 to 55, for example, the average w is 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 or 55. In some specific embodiments, the average w is about 49.

[0231] In one embodiment, the PEGylated lipid has the formula:

[0232]

[0233] The average w is about 49.

[0234] In one embodiment, the PEGylated lipid is DMG-PEG2000, which has the formula:

[0235]

[0236] Structural lipids

[0237] In some embodiments, the lipid component of the nanoparticle composition may include one or more structural lipids. Without being bound by theory, it is expected that the structural lipids can stabilize the amphiphilic structure of the nanoparticle, such as, but not limited to, the lipid bilayer structure of the nanoparticle. Exemplary structural lipids that can be used in conjunction with the present disclosure include, but are not limited to, cholesterol, fecal sterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, tomatine, ursolic acid, alpha-tocopherol, and mixtures thereof. In certain embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid includes cholesterol and corticosteroids (e.g., prednisolone, dexamethasone, prednisone, and hydrocortisone) or a combination thereof.

[0238] In one embodiment, the lipid nanoparticle provided herein comprises a steroid or a steroid analog. In one embodiment, a steroid or a steroid analog is cholesterol. In one embodiment, a steroid is present in a concentration within the range of 39 mol % to 49 mol %, 40 mol % to 46 mol %, 40 mol % to 44 mol %, 40 mol % to 42 mol %, 42 mol % to 44 mol % or 44 mol % to 46 mol %. In one embodiment, a steroid is present in a concentration of 40 mol %, 41 mol %, 42 mol %, 43 mol %, 44 mol %, 45 mol % or 46 mol %.

[0239] In one embodiment, the steroid is present at a concentration in the range of 32 mol% to 50 mol% steroid. In one embodiment, the molar ratio of ionizable lipid to cholesterol is in the range of about 5:1 to about 1:1, preferably about 2:1 to about 1:1, more preferably about 49:39.5.

[0240] Phospholipids

[0241] In some embodiments, the lipid component of nanoparticle composition may include one or more phospholipids, such as one or more (many) unsaturated lipids. Phospholipids are also used as the structural lipids of LNP formulations generally, because they can spontaneously organize into lipid bilayers, and higher phase transition temperatures enhance the film stability of LNPs. Without being bound by theory, it is expected that phospholipids can be assembled into one or more lipid bilayer structures. Exemplary phospholipids that can form part of the nanoparticle compositions of the invention include, but are not limited to, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycerophosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-3-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0Diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-docosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME In some embodiments, the nanoparticle composition comprises DSPC. In some embodiments, the nanoparticle composition comprises DOPE. In some embodiments, the nanoparticle composition comprises both DSPC and DOPE.

[0242] Additional exemplary neutral lipids include, for example, dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE) and dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoylphosphatidylethanolamine (SOPE) and 1,2-ditransoleoyl-sn-glycero-3-phosphoethanolamine (trans-DOPE). In one embodiment, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). In one embodiment, the neutral lipid is selected from DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM.

[0243] In one embodiment, the neutral lipid is phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidic acid (PA), or phosphatidylglycerol (PG).

[0244] Additional phospholipids that may form part of the nanoparticle compositions of the present invention also include those described in WO2017 / 112865, the entire contents of which are incorporated herein by reference in their entirety.

[0245] Therapeutic Payload

[0246] According to the present disclosure, the nanoparticle compositions described herein may further comprise one or more therapeutic and / or prophylactic agents. These therapeutic and / or prophylactic agents are sometimes referred to as "therapeutic payloads" or "payloads" in the present disclosure. In some embodiments, the therapeutic payload may be administered in vivo or in vitro using nanoparticles as a delivery vehicle.

[0247] In some embodiments, the nanoparticle composition comprises as a therapeutic payload: a small molecule compound (e.g., a small molecule drug), such as an anticancer agent (e.g., vincristine, doxorubicin, mitoxantrone, camptothecin, cisplatin, bleomycin, cyclophosphamide, methotrexate, and streptozotocin), an anti-tumor agent (e.g., actinomycin D, vincristine, vinblastine, cytosine arabinoside, arabinoside), anthracyclines, alkylating agents, platinum compounds, antimetabolites and nucleoside analogs such as methotrexate and purine and pyrimidine analogs), anti-infectives, local anesthetics (such as dibucaine and chlorpromazine), beta-adrenergic blocking agents (such as propranolol, timolol and labetalol), antihypertensives (such as clonidine and hydralazine), antidepressants (such as imipramine, amitriptyline and doxepin), anticonvulsants (such as phenytoin), antihistamines

[0013] The invention also includes antihistamines, antiseptics, and topical agents (e.g., diphenhydramine, chlorpheniramine, and promethazine), antibiotics / antibacterials (e.g., gentamycin, ciprofloxacin, and cefoxitin), antifungals (e.g., miconazole, terconazole, econazole, isoconazole, butaconazole, clotrimazole, itraconazole, nystatin, naftifine, and amphotericin B), antiparasitics, hormones, hormone antagonists, immunomodulators, neurotransmitter antagonists, antiglaucoma agents, vitamins, anesthetics, and imaging agents.

[0248] In some embodiments, the therapeutic payload comprises a cytotoxin, a radioactive ion, a chemotherapeutic agent, a vaccine, a compound that provokes an immune response, and / or another therapeutic and / or prophylactic agent. Cytotoxins or cytotoxic agents include any agent that may be harmful to cells. Examples include, but are not limited to, paclitaxel, cytochalasin B, gramicidin D, ethidium bromide, bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracinedione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids, such as maytansinol, rachelmycin (CC-1065), and analogs or homologs thereof. Radioactive ions include, but are not limited to, iodine (eg, iodine-125 or iodine-131), strontium-89, phosphorus, palladium, cesium, iridium, phosphate, cobalt, yttrium-90, samarium-153, and praseodymium.

[0249] In other embodiments, the therapeutic payload of the nanoparticle compositions of the invention can include, but are not limited to, therapeutic and / or prophylactic agents, such as antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, dacarbazine), alkylating agents (e.g., mechlorethamine, thiotepa, chlorambucil, razithromycin (CC-1065), melphalan, carmustine (BSNU), lomustine ( lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunomycin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, milramycin and anthramycin (AMC)), and antimitotic agents (e.g., vincristine, vinblastine, paclitaxel and maytansine compounds).

[0250] In some embodiments, the nanoparticle composition comprises biomolecules such as peptides and polypeptides as therapeutic payloads. The biomolecules forming part of the nanoparticle composition of the present invention may be of natural origin or synthetic. For example, in some embodiments, the therapeutic payload of the nanoparticle composition of the present invention may include, but is not limited to, gentamicin, amikacin, insulin, erythropoietin (EPO), granulocyte colony stimulating factor (G-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), factor VIR, luteinizing hormone releasing hormone (LHRH) analogs, interferon, heparin, hepatitis B surface antigen, typhoid vaccine, cholera vaccine, and peptides and polypeptides.

[0251] Nucleic Acids

[0252] In some embodiments, the nanoparticle compositions of the present invention include one or more nucleic acid molecules (e.g., DNA or RNA molecules) as therapeutic payloads. Exemplary forms of nucleic acid molecules that may be included in the nanoparticle compositions of the present invention as therapeutic payloads include, but are not limited to, one or more of the following: deoxyribonucleic acid (DNA), ribonucleic acid (RNA), including messenger mRNA (mRNA), hybrids thereof, RNAi inducers, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA that induces the formation of triple helices, aptamers, vectors, and the like. In certain embodiments, the therapeutic payload comprises RNA. RNA molecules that may be included in the nanoparticle compositions of the present invention as therapeutic payloads include, but are not limited to, shortmers, agomirs, antagomirs, antisenses, ribozymes, small interfering RNAs (siRNAs), asymmetric interfering RNAs (aiRNAs), microRNAs (miRNAs), Dicer-substrate RNAs (dsRNAs), small hairpin RNAs (shRNAs), transfer RNAs (tRNAs), messenger RNAs (mRNAs), and other forms of RNA molecules known in the art. In certain embodiments, the RNA is mRNA.

[0253] In other embodiments, the nanoparticle composition comprises siRNA molecules as therapeutic payloads. Specifically, in some embodiments, siRNA molecules can selectively interfere with and downregulate the expression of a gene of interest. For example, in some embodiments, after administering a nanoparticle composition comprising siRNA to a subject in need, the siRNA payload selectively silences genes associated with a particular disease, disorder, or condition. In some embodiments, the siRNA molecule comprises a sequence complementary to an mRNA sequence encoding a protein product of interest. In some embodiments, the siRNA molecule is an immunomodulatory siRNA.

[0254] In some embodiments, the nanoparticle composition comprises a shRNA molecule or a vector encoding a shRNA molecule as a therapeutic payload. Specifically, in some embodiments, the therapeutic payload produces shRNA in the target cell after being administered to the target cell. The constructs and mechanisms associated with shRNA are well known in the relevant art.

[0255] In some embodiments, nanoparticle compositions include mRNA molecules as therapeutic payloads. Specifically, in some embodiments, the mRNA molecules encode polypeptides of interest, including any naturally or non-naturally occurring or otherwise modified polypeptides. The polypeptides encoded by the mRNA can have any size and can have any secondary structure or activity. In some embodiments, the polypeptides encoded by the mRNA payload can have a therapeutic effect when expressed in a cell.

[0256] In some embodiments, the nucleic acid molecules of the present disclosure include mRNA molecules. In specific embodiments, the nucleic acid molecules include at least one coding region (e.g., open reading frame (ORF)) encoding a peptide or polypeptide of interest. In some embodiments, the nucleic acid molecules also include at least one non-translated region (UTR). In specific embodiments, the non-translated region (UTR) is located upstream (5' end) of the coding region and is referred to herein as 5'-UTR. In specific embodiments, the non-translated region (UTR) is located downstream (3' end) of the coding region and is referred to herein as 3'-UTR. In specific embodiments, the nucleic acid molecules include both 5'-UTR and 3'-UTR. In some embodiments, the 5'-UTR includes a 5'-cap structure. In some embodiments, the nucleic acid molecules include a Kozak sequence (e.g., in the 5'-UTR). In some embodiments, the nucleic acid molecules include a poly-A region (e.g., in the 3'-UTR). In some embodiments, the nucleic acid molecules include a polyadenylation signal (e.g., in the 3'-UTR). In some embodiments, the nucleic acid molecules include a stabilizing region (e.g., in the 3'-UTR). In some embodiments, the nucleic acid molecule comprises a secondary structure. In some embodiments, the secondary structure is a stem-loop. In some embodiments, the nucleic acid molecule comprises a stem-loop sequence (e.g., in a 5′-UTR and / or a 3′-UTR). In some embodiments, the nucleic acid molecule comprises one or more intronic regions that can be excised during splicing. In specific embodiments, the nucleic acid molecule comprises one or more regions selected from a 5′-UTR and a coding region. In specific embodiments, the nucleic acid molecule comprises one or more regions selected from a coding region and a 3′-UTR. In specific embodiments, the nucleic acid molecule comprises one or more regions selected from a 5′-UTR, a coding region, and a 3′-UTR.

[0257] Coding region

[0258] In some embodiments, nucleic acid molecules of the present disclosure include at least one coding region. In some embodiments, the coding region is an open reading frame (ORF) encoding a single peptide or protein. In some embodiments, the coding region includes at least two ORFs, each ORF encoding a peptide or protein. In embodiments where the coding region includes more than one ORF, the encoded peptides and / or proteins may be identical or different from each other. In some embodiments, a plurality of ORFs in the coding region are separated by non-coding sequences. In specific embodiments, the non-coding sequence separating two ORFs includes an internal ribosome entry site (IRES).

[0259] Without being bound by theory, it is expected that an internal ribosome entry site (IRES) can be used as a sole ribosome binding site, or as one of multiple ribosome binding sites of an mRNA. An mRNA molecule comprising more than one functional ribosome binding site can encode several peptides or polypeptides that are independently translated by ribosomes (e.g., polycistronic mRNA). Therefore, in some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise one or more internal ribosome entry sites (IRES). Examples of IRES sequences that can be used in conjunction with the present disclosure include, but are not limited to, those from picornaviruses (e.g., FMDV), insect viruses (CFFV), polioviruses (PV), encephalomyocarditis viruses (ECMV), foot-and-mouth disease virus (FMDV), hepatitis C virus (HCV), swine fever virus (CSFV), murine leukemia virus (MLV), simian immunodeficiency virus (sIV), or cricket paralysis virus (CrPV).

[0260] In various embodiments, the nucleic acid molecules of the present disclosure encode at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more peptides or proteins. The peptides and proteins encoded by the nucleic acid molecules may be the same or different. In some embodiments, the nucleic acid molecules of the present disclosure encode dipeptides (e.g., carnosine and anserine). In some embodiments, the nucleic acid molecules encode tripeptides. In some embodiments, the nucleic acid molecules encode tetrapeptides. In some embodiments, the nucleic acid molecules encode pentapeptides. In some embodiments, the nucleic acid molecules encode hexapeptides. In some embodiments, the nucleic acid molecules encode heptapeptides. In some embodiments, the nucleic acid molecules encode octapeptides. In some embodiments, the nucleic acid molecules encode nonapeptides. In some embodiments, the nucleic acid molecules encode decapeptides. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 15 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 50 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 100 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 150 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 300 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 500 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 1000 amino acids.

[0261] In some embodiments, the length of the nucleic acid molecules of the present disclosure is at least about 30 nucleotides (nt). In some embodiments, the length of the nucleic acid molecules is at least about 35nt. In some embodiments, the length of the nucleic acid molecules is at least about 40nt. In some embodiments, the length of the nucleic acid molecules is at least about 45nt. In some embodiments, the length of the nucleic acid molecules is at least about 50nt. In some embodiments, the length of the nucleic acid molecules is at least about 55nt. In some embodiments, the length of the nucleic acid molecules is at least about 60nt. In some embodiments, the length of the nucleic acid molecules is at least about 65nt. In some embodiments, the length of the nucleic acid molecules is at least about 70nt. In some embodiments, the length of the nucleic acid molecules is at least about 75nt. In some embodiments, the length of the nucleic acid molecules is at least about 80nt. In some embodiments, the length of the nucleic acid molecules is at least about 85nt. In some embodiments, the length of the nucleic acid molecules is at least about 90nt. In some embodiments, the length of the nucleic acid molecules is at least about 95nt. In some embodiments, the length of the nucleic acid molecules is at least about 100nt. In some embodiments, the length of the nucleic acid molecules is at least about 120nt. In some embodiments, the length of the nucleic acid molecule is at least about 140nt. In some embodiments, the length of the nucleic acid molecule is at least about 160nt. In some embodiments, the length of the nucleic acid molecule is at least about 180nt. In some embodiments, the length of the nucleic acid molecule is at least about 200nt. In some embodiments, the length of the nucleic acid molecule is at least about 250nt. In some embodiments, the length of the nucleic acid molecule is at least about 300nt. In some embodiments, the length of the nucleic acid molecule is at least about 400nt. In some embodiments, the length of the nucleic acid molecule is at least about 500nt. In some embodiments, the length of the nucleic acid molecule is at least about 600nt. In some embodiments, the length of the nucleic acid molecule is at least about 700nt. In some embodiments, the length of the nucleic acid molecule is at least about 800nt. In some embodiments, the length of the nucleic acid molecule is at least about 900nt. In some embodiments, the length of the nucleic acid molecule is at least about 1000nt. In some embodiments, the length of the nucleic acid molecule is at least about 1100nt. In some embodiments, the length of the nucleic acid molecule is at least about 1200nt. In some embodiments, the length of the nucleic acid molecule is at least about 1300nt. In some embodiments, the length of the nucleic acid molecule is at least about 1400nt. In some embodiments, the length of the nucleic acid molecule is at least about 1500nt. In some embodiments, the length of the nucleic acid molecule is at least about 1600nt. In some embodiments, the length of the nucleic acid molecule is at least about 1700nt. In some embodiments, the length of the nucleic acid molecule is at least about 1800nt. In some embodiments, the length of the nucleic acid molecule is at least about 1900nt.In some embodiments, the length of the nucleic acid molecule is at least about 2000nt. In some embodiments, the length of the nucleic acid molecule is at least about 2500nt. In some embodiments, the length of the nucleic acid molecule is at least about 3000nt. In some embodiments, the length of the nucleic acid molecule is at least about 3500nt. In some embodiments, the length of the nucleic acid molecule is at least about 4000nt. In some embodiments, the length of the nucleic acid molecule is at least about 4500nt. In some embodiments, the length of the nucleic acid molecule is at least about 5000nt.

[0262] In certain embodiments, the therapeutic payload comprises a vaccine composition as described herein (e.g., a gene vaccine). In some embodiments, the therapeutic payload comprises a compound capable of inducing immunity to one or more target diseases or diseases. In some embodiments, the target disease is associated with or caused by a pathogen infection, such as a coronavirus, influenza virus, measles virus, human papillomavirus (HPV), rabies virus, meningitis virus, pertussis virus, tetanus virus, plague virus, hepatitis virus, and tuberculosis virus. In some embodiments, the therapeutic payload comprises a nucleic acid sequence (e.g., mRNA) encoding a pathogen-specific pathogenic protein or its antigenic fragment or epitope. After the vaccine is administered to a vaccinated subject, the encoded pathogenic protein (or its antigenic fragment or epitope) is allowed to be expressed, thereby inducing immunity to the pathogen in the subject.

[0263] In some embodiments, the target disease is associated with or caused by the neoplastic growth of cells (e.g., cancer). In some embodiments, the therapeutic payload comprises a nucleic acid sequence (e.g., mRNA) encoding a tumor-associated antigen (TAA) or an antigenic fragment or epitope thereof that is specific to cancer. After administration to a vaccinated subject, the vaccine allows the expression of the encoded TAA (or its antigenic fragment or epitope), thereby inducing immunity against neoplastic cells expressing the TAA in the subject.

[0264] 5'-cap structure

[0265] Without being bound by theory, it is expected that the 5'-cap structure of the polynucleotide is involved in nuclear export and increases polynucleotide stability, and binds to mRNA cap binding protein (CBP), which is responsible for polynucleotide stability in the cell and causes translational competence via the association of CBP with poly-A binding protein to form mature circular mRNA species. The 5'-cap structure further facilitates the removal of 5'-proximal introns during mRNA splicing. Therefore, in some embodiments, the nucleic acid molecules of the present disclosure include a 5'-cap structure.

[0266] Nucleic acid molecules can be capped at the 5' end by the cell's endogenous transcriptional machinery, thereby generating a 5'-ppp-5'-triphosphate linkage between the terminal guanosine cap residue of the polynucleotide and the sense nucleotide transcribed at the 5' end. This 5'-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose sugars of the terminal and / or anteterminal transcribed nucleotides at the 5' end of the polynucleotide can also be optionally 2'-O-methylated. 5'-Decapping via hydrolysis and cleavage of the guanylate cap structure can target nucleic acid molecules, such as mRNA molecules, for degradation.

[0267] In some embodiments, the nucleic acid molecules of the present disclosure comprise one or more changes to a native 5'-cap structure produced by an endogenous process. Without being bound by theory, modifications to the 5'-cap may increase the stability of the polynucleotide, increase the half-life of the polynucleotide, and may increase the translation efficiency of the polynucleotide.

[0268] Exemplary changes to the natural 5'-cap structure include the creation of a non-hydrolyzable cap structure to prevent decapping and thereby increase the half-life of the polynucleotide. In some embodiments, because hydrolysis of the cap structure requires cleavage of the 5'-ppp-5' phosphodiester linkage, in some embodiments, modified nucleotides may be used during the capping reaction. For example, in some embodiments, the Vaccinia Capping Enzyme from New England Biolabs (Ipswich, Mass.) may be used for α-thioguanosine nucleotides to create phosphorothioate linkages in the 5'-ppp-5' cap according to the manufacturer's instructions. Additional modified guanosine nucleotides, such as α-methylphosphonic acid and selenophosphorothioate nucleotides, may be used.

[0269] Additional exemplary alterations to the native 5′-cap structure also include modifications at the 2′ and / or 3′ position of the capped guanosine triphosphate (GTP), replacement of the sugar ring oxygen (producing the oxygen of the carbocyclic ring) with a methylene moiety (CH2), modifications at the triphosphate bridge portion of the cap structure, or modifications at the nucleobase (G) portion.

[0270] Additional exemplary changes to the natural 5'-cap structure include, but are not limited to, 2'-O-methylation of the ribose of the nucleotide at the 5'-terminus of the polynucleotide and / or the 5'-terminal front nucleotide on the sugar 2'-hydroxyl group (as described above). A plurality of different 5'-cap structures can be used to produce the 5'-cap of a polynucleotide (e.g., an mRNA molecule). Additional exemplary 5'-cap structures that can be used in conjunction with the present disclosure further include those 5'-cap structures described in International Patent Publication Nos. WO2008127688, WO 2008016473, and WO 2011015347, the entire contents of each of which are incorporated herein by reference.

[0271] In various embodiments, the 5'-terminal cap may include a cap analog. Cap analogs are also referred to herein as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, which differ in chemical structure from a natural (i.e., endogenous, wild-type or physiological) 5'-cap while retaining cap function. Cap analogs can be chemically (i.e., non-enzymatically) or enzymatically synthesized and / or attached to a polynucleotide.

[0272] For example, the anti-reverse cap analog (ARCA) cap contains two guanosines linked via a 5′-5′-triphosphate group, wherein one of the guanosines contains an N7-methyl group as well as a 3′-O-methyl group (i.e., N7, 3′-O-dimethyl-guanosine-5′-triphosphate-5′-guanosine, i.e., m7G-3′mppp-G, which can be equivalently referred to as 3′O-Me-m7G(5′)ppp(5′)G). The 3′-O atom of the other, unchanged guanosine is linked to the 5′-terminal nucleotide of the capped polynucleotide (e.g., mRNA). The N7- and 3′-O-methylated guanosines provide the terminal portion of the capped polynucleotide (e.g., mRNA). Another exemplary cap structure is mCAP, which is similar to ARCA but has a 2′-O-methyl group on the guanosine (i.e., N7, 2′-O-dimethyl-guanosine-5′-triphosphate-5′-guanosine, i.e., m7Gm-ppp-G).

[0273] In some embodiments, the cap analog may be a dinucleotide cap analog. As a non-limiting example, a dinucleotide cap analog may be modified with a boranophosphate or a phophoroselenoate at different phosphate positions, such as the dinucleotide cap analogs described in U.S. Pat. No. 8,519,110, the entire contents of which are incorporated herein by reference in their entirety.

[0274] In some embodiments, the cap analog may be a N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analogs include N7-(4-chlorophenoxyethyl)-G(5′)ppp(5′)G and N7-(4-chlorophenoxyethyl)-m3′-OG(5′)ppp(5′)G cap analogs (see, e.g., Kore et al., Bioorganic & Medicinal Chemistry 2013 21:4570-4574 for various cap analogs and methods for synthesizing cap analogs; the entire contents of which are incorporated herein by reference). In other embodiments, the cap analog that can be used in conjunction with the nucleic acid molecules of the present disclosure is a 4-chloro / bromophenoxyethyl analog.

[0275] In various embodiments, the cap analog may include a guanosine analog. Useful guanosine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2′-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0276] Without being bound by theory, it is expected that although cap analogs allow simultaneous capping of polynucleotides in in vitro transcription reactions, up to 20% of transcripts remain uncapped. This, along with the structural differences between cap analogs and the natural 5′-cap structure of polynucleotides produced by the cell's endogenous transcription machinery, may lead to reduced translational capacity and reduced cellular stability.

[0277] Therefore, in some embodiments, the nucleic acid molecules of the present disclosure may also be capped after transcription using an enzyme to produce a more authentic 5′-cap structure. As used herein, the phrase “more authentic” refers to a feature that closely reflects or mimics an endogenous or wild-type feature in structure or function. That is, a “more authentic” feature better represents endogenous, wild-type, natural or physiological cell functions and / or structures than synthetic features or analogs of the prior art, or it outperforms the corresponding endogenous, wild-type, natural or physiological features in one or more aspects. Non-limiting examples of more authentic 5′-cap structures that can be used in conjunction with the nucleic acid molecules of the present disclosure are structures that have enhanced binding to cap-binding proteins, increased half-life, reduced sensitivity to 5′-endonucleases, and / or reduced 5′-decapping, compared to synthetic 5′-cap structures known in the art (or compared to wild-type, natural or physiological 5′-cap structures). For example, in some embodiments, a recombinant vaccinia virus capping enzyme and a recombinant 2'-O-methyltransferase can generate a classic 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of a polynucleotide and a guanosine cap nucleotide, wherein the cap guanosine contains an N7-methylation and the 5'-terminal nucleotide of the polynucleotide contains a 2'-O-methyl group. This structure is referred to as a cap 1 structure. This cap results in higher translational capacity, cellular stability, and reduced activation of cellular proinflammatory cytokines compared to other 5' cap analog structures known in the art, for example. Other exemplary cap structures include 7mG(5')ppp(5')N,pN2p (cap 0), 7mG(5')ppp(5')NlmpNp (cap 1), 7mG(5')-ppp(5')NlmpN2mp (cap 2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (cap 4).

[0278] Without being bound by theory, it is contemplated that the nucleic acid molecules of the present disclosure can be capped after transcription, and because this method is relatively efficient, nearly 100% of the nucleic acid molecules can be capped.

[0279] Untranslated region (UTR)

[0280] In some embodiments, the nucleic acid molecules of the present disclosure include one or more untranslated regions (UTRs). In some embodiments, the UTR is located upstream of the coding region in the nucleic acid molecule and is referred to as the 5′-UTR. In some embodiments, the UTR is located downstream of the coding region in the nucleic acid molecule and is referred to as the 3′-UTR. The sequence of the UTR may be homologous or heterologous to the sequence of the coding region found in the nucleic acid molecule. Multiple UTRs may be included in the nucleic acid molecule and may have the same or different sequences and / or gene origins. According to the present disclosure, any portion of the UTR in the nucleic acid molecule (including without any portion) may be codon optimized, and any portion may contain one or more different structural or chemical modifications independently before and / or after codon optimization.

[0281] In some embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure comprise UTRs and coding regions that are homologous to each other. In other embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure comprise UTRs and coding regions that are heterologous to each other. In some embodiments, to monitor the activity of UTR sequences, nucleic acid molecules comprising coding sequences of UTRs and detectable probes may be administered in vitro (e.g., cells or tissue cultures) or in vivo (e.g., to a subject), and the effects of UTR sequences (e.g., regulating expression levels, cellular localization of the encoded product, or half-life of the encoded product) may be measured using methods known in the art.

[0282] In some embodiments, the UTR of the nucleic acid molecule (e.g., mRNA) of the present disclosure includes at least one translation enhancer element (TEE), which acts to increase the amount of the polypeptide or protein produced by the nucleic acid molecule. In some embodiments, the TEE is located in the 5′-UTR of the nucleic acid molecule. In other embodiments, the TEE is located at the 3′-UTR of the nucleic acid molecule. In other embodiments, at least two TEEs are located at the 5′-UTR and 3′-UTR of the nucleic acid molecule, respectively. In some embodiments, the nucleic acid molecule (e.g., mRNA) of the present disclosure may include one or more copies of the TEE sequence or include more than one different TEE sequence. In some embodiments, the different TEE sequences present in the nucleic acid molecule of the present disclosure may be homologous or heterologous relative to each other.

[0283] Various TEE sequences are known in the art and can be used in conjunction with the present disclosure. For example, in some embodiments, the TEE can be an internal ribosome entry site (IRES), HCV-IRES, or an IRES element. Chappell et al., Proc. Natl. Acad. Sci. USA 101: 9590-9594, 2004; Zhou et al., Proc. Natl. Acad. Sci. 102: 6273-6278, 2005. Additional internal ribosome entry sites (IRES) that can be used in conjunction with the present disclosure include, but are not limited to, those described in U.S. Pat. No. 7,468,275, U.S. Pat. Publication No. 2007 / 0048776, and U.S. Pat. Publication No. 2011 / 0124100, and International Patent Publication No. WO2007 / 025008 and International Patent Publication No. WO2001 / 055369, the contents of each of which are incorporated herein by reference in their entirety. In some embodiments, the TEE can be the TEE described in Supplementary Table 1 and Supplementary Table 2 of Wellensiek et al., Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug; 10(8):747-750; the contents of each document are incorporated herein by reference in their entirety.

[0284] Additional exemplary TEEs that may be used in conjunction with the present disclosure include, but are not limited to, U.S. Patent No. 6,310,197, U.S. Patent No. 6,849,405, U.S. Patent No. 7,456,273, U.S. Patent No. 7,183,395, U.S. Patent Publication No. 2009 / 0226470, U.S. Patent Publication No. 2013 / 0177581, U.S. Patent Publication No. 2007 / 0048776, U.S. Patent Publication No. 2011 / 0124100, U.S. Patent Publication No. The TEE sequences described in International Patent Publication No. 2009 / 0093049, International Patent Publication No. WO2009 / 075886, International Patent Publication No. WO2012 / 009644 and International Patent Publication No. WO1999 / 024595, International Patent Publication No. WO2007 / 025008, International Patent Publication No. WO2001 / 055371, European Patent No. 2610341, and European Patent No. 2610340, the contents of each of which are incorporated herein by reference in their entirety.

[0285] In various embodiments, nucleic acid molecules (e.g., mRNA) disclosed herein include at least one UTR, which includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55 or more than 60 TEE sequences. In some embodiments, the TEE sequence in the UTR of the nucleic acid molecule is a copy of the same TEE sequence. In other embodiments, at least two TEE sequences in the UTR of the nucleic acid molecule have different TEE sequences. In some embodiments, a plurality of different TEE sequences are arranged in the UTR region of the nucleic acid molecule in one or more repetitive patterns. For the purpose of illustration only, the repetition pattern may be, for example, ABABAB, AABBAABBAAB, ABCABCABC, etc., wherein in these exemplary patterns, each capital letter (A, B or C) represents a different TEE sequence. In some embodiments, in the UTR of a nucleic acid molecule, at least two TEE sequences are continuous with each other (i.e., there is no spacer sequence therebetween). In other embodiments, at least two TEE sequences are separated by a spacer sequence. In some embodiments, UTR may include a TEE sequence-spacer sequence module, which is repeated in UTR at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times or more. In any embodiment described in this paragraph, UTR may be 5′-UTR, 3′-UTR or both 5′-UTR and 3′-UTR of a nucleic acid molecule.

[0286] In some embodiments, the UTR of the nucleic acid molecule (e.g., mRNA) of the present disclosure comprises at least one translation inhibition element, which acts to reduce the amount of polypeptide or protein produced by the nucleic acid molecule. In some embodiments, the UTR of the nucleic acid molecule comprises one or more miR sequences or fragments thereof (e.g., miR seed sequences) recognized by one or more microRNAs. In some embodiments, the UTR of the nucleic acid molecule comprises one or more stem-loop structures that downregulate the translation activity of the nucleic acid molecule. Other mechanisms for inhibiting the translation activity associated with nucleic acid molecules are known in the art. In any of the embodiments described in this paragraph, the UTR may be a 5′-UTR, a 3′-UTR, or both a 5′-UTR and a 3′-UTR of the nucleic acid molecule.

[0287] Polyadenylation (Poly-A) region

[0288] During natural RNA processing, long chains of adenosine nucleotides (poly-A regions) are often added to messenger RNA (mRNA) molecules to increase the stability of the molecule. Immediately after transcription, the 3'-end of the transcript is cleaved to release the 3'-hydroxyl. Next, poly-A polymerase adds a string of adenosine nucleotides to the RNA. This process is called polyadenylation, and a poly-A region of between 100 and 250 residues in length is added. Without being bound by theory, it is expected that the poly-A region can confer a number of advantages to the nucleic acid molecules of the present disclosure.

[0289] Therefore, in some embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure comprise polyadenylation signals. In some embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure comprise one or more polyadenylation (poly-A) regions. In some embodiments, the poly-A region is entirely composed of adenine nucleotides or functional analogs thereof. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 3' end. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 5' end. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 5' end and at least one poly-A region at its 3' end.

[0290] According to the present disclosure, in different embodiments, the poly-A region may have different lengths. Specifically, in some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 30 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 35 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 40 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 45 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 50 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 55 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 60 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 65 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 70 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 75 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 80 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 85 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 90 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 95 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 100 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 110 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 120 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 130 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 140 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 150 nucleotides. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 160 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 170 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 180 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 190 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 200 nucleotides in length.In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 225 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 250 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 275 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 300 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 350 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 400 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 450 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 500 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 600 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 700 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 800 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 900 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1000 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1100 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1200 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1300 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1400 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1500 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1600 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1700 nucleotides. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 1800 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 1900 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 2000 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 2250 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 2500 nucleotides in length.In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 2750 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 3000 nucleotides in length.

[0291] In some embodiments, the length of the poly-A region in the nucleic acid molecule can be selected based on the total length of the nucleic acid molecule or a portion thereof (e.g., the length of the coding region of the nucleic acid molecule or the length of the open reading frame, etc.). For example, in some embodiments, the poly-A region accounts for about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the total length of the nucleic acid molecule containing the poly-A region.

[0292] Without being bound by theory, it is expected that certain RNA binding proteins can bind to the poly-A region located at the 3' end of the mRNA molecule. These poly-A binding proteins (PABPs) can regulate mRNA expression, for example, interact with the translation initiation machinery in the cell and / or protect the 3'-poly-A tail from degradation. Therefore, in some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise at least one binding site for a poly-A binding protein (PABP). In other embodiments, the nucleic acid molecule is formed into a conjugate or complex with the PABP before being loaded into a delivery vehicle (e.g., a lipid nanoparticle).

[0293] In some embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure comprise poly-AG quadruplexes. G quadruplexes are circular arrays of four hydrogen-bonded guanosine nucleotides that can be formed by G-rich sequences in DNA and RNA. In this embodiment, the G quadruplex is incorporated into one end of the poly-A region. The stability, protein yield, and other parameters of the resulting polynucleotide (e.g., mRNA) can be analyzed, including half-life at different time points. It has been found that the protein yield of the poly-AG quadruplex structure is equal to at least 75% of the protein yield observed using only a poly-A region containing 120 nucleotides.

[0294] In some embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure may include a poly-A region and may be stabilized by adding a 3′-stabilizing region. In some embodiments, the 3′-stabilizing region that can be used to stabilize nucleic acid molecules (e.g., mRNA) includes a poly-A or poly-AG quadruplex structure as described in International Patent Publication No. WO2013 / 103659, the contents of which are incorporated herein by reference in their entirety.

[0295] In other embodiments, 3′-stabilizing regions that can be used in conjunction with the nucleic acid molecules of the present disclosure include chain terminating nucleosides such as, but not limited to, 3′-deoxyadenosine (cordycepin); 3′-deoxyuridine; 3′-deoxycytosine; 3′-deoxyguanosine; 3′-deoxythymidine; 2′,3′-dideoxynucleosides, such as 2′,3′-dideoxyadenosine, 2′,3′-dideoxyuridine, 2′,3′-dideoxycytosine, 2′,3′-dideoxyguanosine, 2′,3′-dideoxythymidine; 2′-deoxynucleosides; or O-methyl nucleosides: 3′-deoxynucleosides; 2′,3′-dideoxynucleosides; 3′-O-methyl nucleosides; 3′-O-ethyl nucleosides; 3′-arabinoside, as well as other alternative nucleosides known in the art and / or described herein.

[0296] Secondary structure

[0297] Without being bound by theory, it is expected that the stem-loop structure can guide RNA folding, protect the structural stability of nucleic acid molecules (e.g., mRNA), provide recognition sites for RNA binding proteins, and serve as substrates for enzymatic reactions. For example, the incorporation of miR sequences and / or TEE sequences will change the shape of the stem-loop region, thereby increasing and / or decreasing translation (Kedde et al., A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221and miR-222accessibility. Nat Cell Biol., 2010 Oct; 12(10): 1014-20, the contents of which are incorporated herein by reference in their entirety).

[0298] Thus, in some embodiments, the nucleic acid molecules described herein (e.g., mRNA) or a portion thereof may be in a stem-loop structure, such as, but not limited to, a histone stem-loop. In some embodiments, the stem-loop structure is formed by a stem-loop sequence of about 25 or about 26 nucleotides in length, such as, but not limited to, the structure described in International Patent Publication No. WO2013 / 103659, the contents of which are incorporated herein by reference in their entirety. Additional examples of stem-loop sequences include sequences described in International Patent Publication No. WO2012 / 019780 and International Patent Publication No. WO201502667, the contents of each of which are incorporated herein by reference. In some embodiments, the stem-loop sequence comprises TEE as described herein. In some embodiments, the stem-loop sequence comprises a miR sequence as described herein. In a specific embodiment, the stem-loop sequence may include a miR-122 seed sequence. In a specific embodiment, the nucleic acid molecule comprises a stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 1). In other embodiments, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 2).

[0299] In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure include a stem-loop sequence located upstream of the coding region (at the 5' end) in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 5'-UTR of the nucleic acid molecule. In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure include a stem-loop sequence located downstream of the coding region (at the 3' end) in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 3'-UTR of the nucleic acid molecule. In some cases, the nucleic acid molecule may contain more than one stem-loop sequence. In some embodiments, the nucleic acid molecule includes at least one stem-loop sequence in the 5'-UTR and at least one stem-loop sequence in the 3'-UTR.

[0300] In some embodiments, the nucleic acid molecule comprising a stem-loop structure further comprises a stabilizing region. In some embodiments, the stabilizing region comprises at least one chain terminating nucleoside, which acts to slow degradation and thereby increase the half-life of the nucleic acid molecule. Exemplary chain-terminating nucleosides that can be used in conjunction with the nucleic acid molecules of the present disclosure include, but are not limited to, 3′-deoxyadenosine (cordycepin); 3′-deoxyuridine; 3′-deoxycytosine; 3′-deoxyguanosine; 3′-deoxythymidine; 2′,3′-dideoxynucleosides, such as 2′,3′-dideoxyadenosine, 2′,3′-dideoxyuridine, 2′,3′-dideoxycytosine, 2′,3′-dideoxyguanosine, 2′,3′-dideoxythymidine; 2′-deoxynucleosides; or O-methyl nucleosides; 3′-deoxynucleosides; 2′,3′-dideoxynucleosides; 3′-O-methyl nucleosides; 3′-O-ethyl nucleosides; 3′-arabinoside, as well as other alternative nucleosides known in the art and / or described herein. In other embodiments, the stem-loop structure can be stabilized by altering the 3'-region of the polynucleotide, which alterations can prevent and / or inhibit the addition of oligo(U) (International Patent Publication No. WO2013 / 103659, which is herein incorporated by reference in its entirety).

[0301] In some embodiments, the nucleic acid molecules of the present disclosure include at least one stem-loop sequence and a poly-A region or a polyadenylation signal. Non-limiting examples of polynucleotide sequences including at least one stem-loop sequence and a poly-A region or a polyadenylation signal include sequences described in International Patent Publication No. WO2013 / 120497, International Patent Publication No. WO2013 / 120629, International Patent Publication No. WO2013 / 120500, International Patent Publication No. WO2013 / 120627, International Patent Publication No. WO2013 / 120498, International Patent Publication No. WO2013 / 120626, International Patent Publication No. WO2013 / 120499, and International Patent Publication No. WO2013 / 120628, each of which is incorporated herein by reference in its entirety.

[0302] In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal may encode a pathogen antigen or a fragment thereof, such as the polynucleotide sequences described in International Patent Publication No. WO2013 / 120499 and International Patent Publication No. WO2013 / 120628, the contents of each of which are incorporated herein by reference in their entirety.

[0303] In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal may encode a therapeutic protein, such as the polynucleotide sequences described in International Patent Publication No. WO2013 / 120497 and International Patent Publication No. WO2013 / 120629, the contents of each of which are incorporated herein by reference in their entirety.

[0304] In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal may encode a tumor antigen or a fragment thereof, such as the polynucleotide sequences described in International Patent Publication No. WO2013 / 120500 and International Patent Publication No. WO2013 / 120627, the contents of each of which are incorporated herein by reference in their entirety.

[0305] In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal may encode a sensitizing antigen or an autoimmune self-antigen, such as the polynucleotide sequences described in International Patent Publication No. WO2013 / 120498 and International Patent Publication No. WO2013 / 120626, the contents of each of which are incorporated herein by reference in their entirety.

[0306] Functional nucleotide analogs

[0307] In some embodiments, the payload nucleic acid molecules described herein contain only classical nucleotides selected from A (adenosine), G (guanosine), C (cytosine), U (uridine), and T (thymidine). Without being bound by theory, it is expected that certain functional nucleotide analogs can confer useful properties on nucleic acid molecules. In the context of the present disclosure, examples of such useful properties include, but are not limited to, increased stability of nucleic acid molecules, reduced immunogenicity of nucleic acid molecules in inducing innate immune responses, increased production of proteins encoded by nucleic acid molecules, increased intracellular delivery and / or retention of nucleic acid molecules, and / or reduced cytotoxicity of nucleic acid molecules, etc.

[0308] Therefore, in some embodiments, the effective load nucleic acid molecule comprises at least one functional nucleotide analog as described herein. In some embodiments, the functional nucleotide analog contains at least one chemical modification for a nucleobase, a sugar group and / or a phosphate group. Therefore, the effective load nucleic acid molecule comprising at least one functional nucleotide analog contains at least one chemical modification for a nucleobase, a sugar group and / or an internucleoside linkage. Exemplary chemical modifications to the nucleobase, sugar group or internucleoside linkage of a nucleic acid molecule are provided herein.

[0309] As described herein, nucleotides ranging from 0% to 100% of all nucleotides in a payload nucleic acid molecule can be functional nucleotide analogs as described herein. For example, in various embodiments, about 1% to about 20%, about 1% to about 25%, about 1% to about 50%, about 1% to about 60%, about 1% to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70 In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein, and the nucleotides of the present invention are functional nucleotide analogs as described herein. In any one of these embodiments, the functional nucleotide analogs can be present in any position of the nucleic acid molecule, including the 5′-end, the 3′-end and / or one or more internal positions. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and / or different types of internucleoside linkages (eg, backbone structures).

[0310] As described herein, ranging from 0% to 100% of all nucleotides of one type (e.g., all purine-containing nucleotides as a type, or all pyrimidine-containing nucleotides as a type, or all A, G, C, T, or U as a type) in a payload nucleic acid molecule can be functional nucleotide analogs as described herein. For example, in various embodiments, about 1% to about 20%, about 1% to about 25%, about 1% to about 50%, about 1% to about 60%, about 1% to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 10% to about 80%, In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In any one of these embodiments, the functional nucleotide analogs can be present in any position of the nucleic acid molecule, including the 5'-end, the 3'-end and / or one or more internal positions. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and / or different types of internucleoside linkages (eg, backbone structures).

[0311] Nucleobase modification

[0312] In some embodiments, the functional nucleotide analogs contain non-classical nucleobases. In some embodiments, the classical nucleobases in the nucleotide (e.g., adenine, guanine, uracil, thymine, and cytosine) can be modified or replaced to provide one or more functional analogs of the nucleotide. Exemplary modifications of nucleobases include, but are not limited to, one or more substitutions or modifications, including, but not limited to, alkyl, aryl, halo, oxo, hydroxyl, alkoxy, and / or thio substitutions; one or more fused rings or ring openings, oxidations, and / or reductions.

[0313] In some embodiments, the non-classical nucleobase is a modified uracil. Exemplary nucleobases and nucleosides with modified uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-azauracil, 6-azauracil, 2-thio-5-azauracil, 2-thiouracil (s2U), 4-thio-uracil (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho5U), 5-aminoallyl-uracil, 5-halouracil (e.g., 5-iodouracil or 5-bromouracil), 3-methyluracil (m3U), 5-methoxyuracil (mo5U), uracil 5- Oxyacetic acid (cmo5U), uracil 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uracil (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm5U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm5U), 5-methoxycarbonylmethyl-uracil (mcm5U), 5-methoxycarbonylmethyl-2-thiouracil (mcm5s2U), 5-aminomethyl-2-thiouracil (nm5s2U), 5-methylaminomethyl-uracil (mnm5U), 5-methylaminomethyl-2- Thiouracil (mnm5s2U), 5-methylaminomethyl-2-selenouracil (mnm5se2U), 5-carbamoylmethyluracil (ncm5U), 5-carboxymethylaminomethyl-uracil (cmnm5U), 5-carboxymethylaminomethyl-2-thiouracil (cmnm5s2U), 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-taurinemethyl-uracil (τm5U), 1-taurinemethyl-pseudouridine, 5-taurinemethyl-2-thiouracil (τm55s2U), 1-taurinemethyl-4- thio-pseudouridine, 5-methyl-uracil (m5U, i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (Et1ψ), 5-methyl-2-thio-uracil (m5s2U), 1-methyl-4-thio-pseudouridine (m1s4ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m3ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyl-dihydrouracil (m5D), 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp3U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3ψ), 5-(isopentenylaminomethyl)uracil (m5U), 5-(isopentenylaminomethyl)-2-thio-uracil (m5s2U), 5,2'-O-dimethyl-uridine (m5Um), 2-thio-2'-O-methyl-uridine (s2Um), 5-methoxycarbonyl 5-(carbamoylmethyl)-2'-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm5Um), 3,2'-O-dimethyl-uridine (m3Um) and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm5Um), 1-thio-uracil, deoxythymidine, 5-(2-methoxycarbonylvinyl)-uracil, 5-(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil and 5-[3-(1-E-propenylamino)]uracil.

[0314] In some embodiments, the non-classical nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having modified cytosine include 5-azacytosine, 6-azacytosine, pseudoisocytidine, 3-methylcytosine (m3C), N4-acetylcytosine (ac4C), 5-formylcytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5-hydroxymethyl -cytosine (hm5C), 1-methyl-pseudoisocytidine, pyrrolocytidine, pyrrolopseudoisocytidine, 2-thiocytosine (s2C), 2-thio-5-methylcytosine, 4-thiopseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebμLarine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytosine, 2-methoxy-5-methyl-cytosine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine (k2C), 5,2'-O-dimethyl-cytidine (m5Cm), N4-ethyl Acyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O-dimethyl-cytidine (m4Cm), 5-formyl-2'-O-methyl-cytidine (fSCm), N4,N4,2'-O-trimethyl-cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3-azidopropyl)-cytosine and 5-(2-azidoethyl)-cytosine.

[0315] In some embodiments, the non-classical nucleobase is a modified adenine. Exemplary nucleobases and nucleosides with alternative adenines include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza -2,6-diaminopurine, 1-methyl-adenine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A), N6-isopentenyl-adenine (i6A), 2-methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycylcarbamoyl N6-methyl-N6-threonylcarbamoyl-adenine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxynorvalylcarbamoyl-adenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A) , 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, N6,2'-O-dimethyl-adenosine (m6Am), N6,N6,2'-O-trimethyl-adenosine (m62Am), 1,2'-O-dimethyl-adenosine (m1Am), 2-amino-N6-methyl-purine, 1-thio-adenine, 8-azido-adenine, N6-(19-amino-pentaoxahedronadecanyl)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine and N6-hydroxymethyl-adenine.

[0316] In some embodiments, the non-classical nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having a modified guanine include inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methyl wyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxy wybutosine (o2yW), hydroxy wybutosine (OHyW), undermodified hydroxy wybutosine (OHyW*), 7-deaza- Guanine, queuosine (Q), epoxyqueuosine (oQ), galactosylqueuosine (galQ), mannosylqueuosine (manQ), 7-cyano-7-deaza-guanine (preQO), 7-aminomethyl-7-deaza-guanine (preQ1), archaeosine (G+), 7-deaza-8-aza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methyl guanine (m7G), 6-thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl-guanine (m1G), N2-methyl-guanine (m2G), N2,N2-dimethyl-guanine (m22G), N2,7-dimethyl-guanine (m2,7G), N2,N2,7-dimethyl-guanine (m2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thio-guanine, N2-methyl-6- Thio-guanine, N2,N2-dimethyl-6-thio-guanine, N2-methyl-2'-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1-methyl-2'-O-methyl-guanosine (m1Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m2,7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m1Im), 1-thio-guanine and O-6-methyl-guanine.

[0317] In some embodiments, the non-classical nucleobase of the functional nucleotide analog can independently be a purine, a pyrimidine, a purine analog, or a pyrimidine analog. For example, in some embodiments, the non-classical nucleobase can be a modified adenine, cytosine, guanine, uracil, or hypoxanthine. In other embodiments, non-classical nucleobases may also include, for example, naturally occurring and synthetic derivatives of bases, including pyrazolo[3,4-d]pyrimidine; 5-methylcytosine (5-me-C); 5-hydroxymethylcytosine; xanthine; hypoxanthine; 2-aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine and 2-thiocytosine; 5-propynyluracil and cytosine; 6-azouracil, cytosine and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo (e.g., 8-bromo), 8-amino, 8-thiol , 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines; 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines; 7-methylguanine and 7-methyladenine; 8-azaguanine and 8-azaadenine; deazaguanine, 7-deazaguanine, 3-deazaguanine; deazaadenine, 7-deazaadenine, 3-deazaadenine; pyrazolo[3,4-d]pyrimidine; imidazo[1,5-a]1,3,5-triazinone; 9-deazapurine; imidazo[4,5-d]pyrazine; thiazolo[4,5-d]pyrimidine; pyrazin-2-one; 1,2,4-triazine; pyridazine; or 1,3,5-triazine.

[0318] Sugar modification

[0319] In some embodiments, the functional nucleotide analogs contain non-classical sugar groups. In various embodiments, the non-classical sugar group can be a 5- or 6-carbon sugar (e.g., pentose, ribose, arabinose, xylose, glucose, galactose, or deoxy derivatives thereof) with one or more substitutions, such as halogen, hydroxyl, thiol, alkyl, alkoxy, alkenyloxy, alkynyloxy, cycloalkyl, aminoalkoxy, alkoxyalkoxy, hydroxyalkoxy, amino, azido, aryl, aminoalkyl, aminoalkenyl, aminoalkynyl, etc.

[0320] In general, RNA molecules contain a ribose moiety that is an oxygen-containing 5-membered ring. Exemplary non-limiting alternative nucleotides include replacement of oxygen in ribose (e.g., with S, Se, or an alkylene group, such as methylene or ethylene); addition of double bonds (e.g., replacement of ribose with a cyclopentenyl or cyclohexenyl group); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6-membered or 7-membered ring with additional carbon or heteroatoms, such as for anhydrohexitol, altritol, mannitol, cyclohexane, cyclohexenyl and N-morpholinyl (which also have a phosphoramidate backbone); polycyclic forms (e.g., tricyclic and "unlocked" forms, such as glycol nucleic acids (GNAs) (e.g., R-GNA or S-GNA, in which ribose is replaced by a glycol unit linked to a phosphodiester linkage), threose nucleic acids (TNA, in which ribose is replaced by an α-L-threofuranosyl-(3'→2')) and peptide nucleic acids (PNA in which 2-amino-ethyl-glycine linkages replace ribose and the phosphodiester backbone)).

[0321] In some embodiments, the sugar group contains one or more carbons having a stereochemical configuration opposite to the corresponding carbon in ribose. Thus, the nucleic acid molecule may include nucleotides containing, for example, arabinose or L-ribose as sugars. In some embodiments, the nucleic acid molecule includes at least one nucleoside in which the sugar is L-ribose, 2'-O-methyl ribose, 2'-fluororibose, arabinose, hexitol, LNA or PNA.

[0322] Modification of internucleoside linkages

[0323] In some embodiments, the disclosed payload nucleic acid molecules may contain one or more modified internucleoside linkages (eg, phosphate backbones). The backbone phosphate groups may be altered by replacing one or more oxygen atoms with different substituents.

[0324] In some embodiments, functional nucleotide analogs may include another internucleoside linkage replacement unchanged phosphate moiety as described herein. Examples of alternative phosphate groups include but are not limited to thiophosphate, selenophosphate, borane phosphate, borane phosphate, hydrogen phosphonate, phosphoramidate, diamino phosphoroester, alkyl or aryl phosphonate and phosphotriester. Two non-connected oxygens of dithiophosphate are replaced by sulfur. Phosphate linkers can also be changed by replacing oxygen with nitrogen (phosphoramidate of bridges), sulfur (thiophosphate of bridges) and carbon (methylene phosphonate of bridges).

[0325] Alternative nucleosides and nucleotides may include one or more non-bridging oxygens replaced by borane moieties (BH3), sulfur (thio), methyl, ethyl and / or methoxy groups. As a non-limiting example, two non-bridging oxygens at the same position (e.g., alpha (α), beta (β) or gamma (γ) position) may be replaced by sulfur (thio) and methoxy groups. One or more oxygen atoms at the position of a replacement phosphate moiety (e.g., α-phosphorothioate) may impart RNA and DNA stability (e.g., stability against exonucleases and endonucleases) via non-natural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and therefore have a longer half-life in a cellular environment.

[0326] Other internucleoside linkages that can be used in accordance with the present disclosure are described herein, including internucleoside linkages that do not contain a phosphorus atom.

[0327] Additional examples of nucleic acid molecules (e.g., mRNA), related compositions, formulations and / or methods that can be used in conjunction with the present disclosure further include WO2002 / 098443, WO2003 / 051401, WO2008 / 052770, WO2009127230, WO2006122828, WO2008 / 083949, WO2010088927, WO2010 / 037539, WO2004 / 004743, WO2005 / 01 6376、WO2006 / 024518、WO2007 / 095976、WO2008 / 014979、WO2008 / 077592、WO2009 / 030481、WO2009 / 095226 , WO2011069586, WO2011026641, WO2011 / 144358, WO2012019780, WO2012013326, WO2012089338, WO2012113 513. WO2012116811, WO2012116810, WO2013113502, WO2013113501, WO2013113736, WO2013143698, WO2013 143699, WO2013143700, WO2013 / 120626, WO2013120627, WO2013120628, WO2013120629, WO2013174409, WO2 The contents of each of the foregoing are incorporated herein in their entirety.

[0328] preparation

[0329] According to the present disclosure, the nanoparticle compositions described herein may include at least one lipid component and one or more additional components, such as therapeutic and / or prophylactic agents. The nanoparticle compositions may be designed for one or more specific applications or goals. The ingredients of the nanoparticle compositions may be selected based on the specific application or goal, and / or based on the efficacy, toxicity, cost, ease of use, availability or other characteristics of one or more ingredients. Similarly, the specific formulation of the nanoparticle composition may be selected for a specific application or goal based on, for example, the efficacy and toxicity of a specific combination of each ingredient.

[0330] The lipid component of the nanoparticle composition can include, for example, lipids according to one of formula (I) (and its subformulae) described herein, phospholipids (e.g., unsaturated lipids, such as DOPE or DSPC), PEG lipids, and structural lipids. Each component of the lipid component can be provided in a specific fraction.

[0331] In one embodiment, a nanoparticle composition is provided herein, comprising an ionizable lipid compound, a therapeutic agent, and one or more excipients provided herein. In one embodiment, the ionizable lipid compound comprises a compound according to one of formula (I) (and its subformula) as described herein, and one or more additional ionizable lipid compounds optionally selected. In one embodiment, the one or more excipients are selected from neutral lipids, steroids, and polymer-bound lipids. In one embodiment, the therapeutic agent is encapsulated in or associated with lipid nanoparticles.

[0332] In one embodiment, provided herein is a nanoparticle composition (lipid nanoparticle) comprising:

[0333] i) ionizable lipids;

[0334] ii) neutral lipids;

[0335] iii) steroids;

[0336] iv) polymer-bound lipids; and

[0337] v) Therapeutic agents.

[0338] As used herein, "molar percentage" refers to the molar percentage of one component relative to the total moles of all lipid components in the LNP (ie, the total moles of ionizable lipids, neutral lipids, steroids, and polymer-bound lipids).

[0339] In one embodiment, the lipid nanoparticle comprises 41 mol% to 49 mol%, 41 mol% to 48 mol%, 42 mol% to 48 mol%, 43 mol% to 48 mol%, 44 mol% to 48 mol%, 45 mol% to 48 mol%, 46 mol% to 48 mol% or 47.2 mol% to 47.8 mol% of ionizable lipids. In one embodiment, the lipid nanoparticle comprises about 47.0 mol%, 47.1 mol%, 47.2 mol%, 47.3 mol%, 47.4 mol%, 47.5 mol%, 47.6 mol%, 47.7 mol%, 47.8 mol%, 47.9 mol% or 48.0 mol% of ionizable lipids.

[0340] In one embodiment, the neutral lipid is present at a concentration in the range of 5 mol% to 15 mol%, 7 mol% to 13 mol%, or 9 mol% to 11 mol%. In one embodiment, the neutral lipid is present at a concentration of about 9.5 mol%, 10 mol%, or 10.5 mol%. In one embodiment, the molar ratio of ionizable lipid to neutral lipid is in the range of about 2:1 to about 8:1, preferably about 3:1 to about 5:1, more preferably about 47.5:10.

[0341] In one embodiment, the steroid is present at a concentration in the range of 39 mol % to 49 mol %, 40 mol % to 46 mol %, 40 mol % to 44 mol %, 40 mol % to 42 mol %, 42 mol % to 44 mol % or 44 mol % to 46 mol %. In one embodiment, the steroid is present at a concentration of 40 mol %, 41 mol %, 42 mol %, 43 mol %, 44 mol %, 45 mol % or 46 mol %. In one embodiment, the molar ratio of ionizable lipid to steroid is in the range of 5: 1 to about 1: 1, preferably about 2: 1 to about 1: 1, more preferably about 47.5: 40.7. In one embodiment, the steroid is cholesterol.

[0342] In one embodiment, the lipid nanoparticle comprises 1.0 mol% to 2.5 mol% of polymer-bound lipids. In one embodiment, the polymer-bound lipids are present at a concentration of about 1.5 mol%. In one embodiment, the molar ratio of ionizable lipids to polymer-bound lipids is in the range of about 100:1 to about 20:1, preferably about 50:1 to about 25:1, more preferably 47.5:1.8.

[0343] In one embodiment, the average diameter of the lipid nanoparticles is in the range of 50 nm to 100 nm or 60 nm to 85 nm.

[0344] In one embodiment, the composition comprises ionizable lipids, DSPC, cholesterol and PEG-lipids provided herein, and mRNA. In one embodiment, the molar ratio of ionizable lipids, DSPC, cholesterol and PEG-lipids provided herein is about 49:10:39.5:1.5 or 47.5:10:40.7:1.8.

[0345] In one embodiment, the ratio of therapeutic agent to lipid in the LNP (i.e., N / P, where N represents the number of moles of ionizable lipid and P represents the number of moles of phosphate present as part of the nucleic acid backbone) is in the range of 2:1 to 30:1, for example, in the range of 3:1 to 22:1. In one embodiment, N / P is in the range of 6:1 to 20:1 or 2:1 to 12:1. Exemplary N / P ranges include about 3:1, about 6:1, about 12:1, and about 22:1.

[0346] Nanoparticle compositions can be designed for one or more specific applications or targets. For example, nanoparticle compositions can be designed for delivering therapeutic and / or prophylactic agents, such as RNA, to specific cells, tissues, organs or systems or groups thereof in mammals. The physicochemical properties of nanoparticle compositions can be changed to increase selectivity for specific body targets. For example, the particle size can be adjusted based on the window size of different organs. The therapeutic and / or prophylactic agents contained in the nanoparticle compositions can also be selected based on one or more desired delivery targets. For example, therapeutic and / or prophylactic agents can be selected for specific indications, illnesses, diseases or conditions and / or for delivery to specific cells, tissues, organs or systems or groups thereof (e.g., local or specific delivery). In certain embodiments, nanoparticle compositions can include mRNA encoding a polypeptide of interest, which can be translated intracellularly to produce a polypeptide of interest. Such compositions can be designed to be specifically delivered to a specific organ. In certain embodiments, the composition can be designed to be specifically delivered to the liver of a mammal.

[0347] The amount of the therapeutic and / or prophylactic agent in the nanoparticle composition may depend on the size, composition, desired target and / or application, or other characteristics of the nanoparticle composition, as well as the characteristics of the therapeutic and / or prophylactic agent. For example, the amount of RNA that can be used in the nanoparticle composition may depend on the size, sequence and other characteristics of the RNA. The relative amounts of the therapeutic and / or prophylactic agent and other ingredients (e.g., lipids) in the nanoparticle composition may also vary. In some embodiments, the wt / wt ratio of the lipid component to the therapeutic and / or prophylactic agent in the nanoparticle composition may be from about 5:1 to about 60:1, for example, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1 and 60:1. For example, the wt / wt ratio of the lipid component to the therapeutic and / or prophylactic agent can be about 10: 1 to about 40: 1. In certain embodiments, the wt / wt ratio is about 20: 1. The amount of the therapeutic and / or prophylactic agent in the nanoparticle composition can be measured, for example, using absorption spectroscopy (e.g., UV-visible spectroscopy).

[0348] In some embodiments, the nanoparticle composition comprises one or more RNAs, and one or more RNAs, lipids, and amounts thereof may be selected to provide a specific N: P ratio. The N: P ratio of a composition refers to the molar ratio of the number of nitrogen atoms in one or more lipids to the number of phosphate groups in the RNA. In some embodiments, a lower N: P ratio is selected. One or more RNAs, lipids, and amounts thereof may be selected to provide an N: P ratio of about 2: 1 to about 30: 1, such as 2: 1, 3: 1, 4: 1, 5: 1, 6: 1, 7: 1, 8: 1, 9: 1, 10: 1, 12: 1, 14: 1, 16: 1, 18: 1, 20: 1, 22: 1, 24: 1, 26: 1, 28: 1, or 30: 1. In certain embodiments, the N: P ratio may be about 2: 1 to about 8: 1. In other embodiments, the N: P ratio is about 5: 1 to about 8: 1. For example, the N:P ratio may be about 5.0:1, about 5.5:1, about 5.67:1, about 6.0:1, about 6.5:1, or about 7.0: 1. For example, the N:P ratio may be about 5.67:1.

[0349] The physical properties of a nanoparticle composition can depend on its components. For example, a nanoparticle composition comprising cholesterol as a structural lipid can have different characteristics than a nanoparticle composition comprising a different structural lipid. Similarly, the characteristics of a nanoparticle composition can depend on the absolute or relative amounts of its components. For example, a nanoparticle composition comprising a higher mole fraction of phospholipids can have different characteristics than a nanoparticle composition comprising a lower mole fraction of phospholipids. Characteristics can also vary depending on the method and conditions of preparation of the nanoparticle composition.

[0350] Nanoparticle compositions can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of nanoparticle compositions. Zeta potential can be measured using dynamic light scattering or potentiometric methods (e.g., potentiometric titration). Dynamic light scattering can also be used to determine particle size. Instruments such as Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, Worcestershire, UK) can also be used to measure multiple features of nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.

[0351] In various embodiments, the average size of the nanoparticle composition can be between tens of nanometers and hundreds of nanometers. For example, the average size can be about 40nm to about 150nm, such as about 40nm, 45nm, 50nm, 55nm, 60nm, 65nm, 70nm, 75nm, 80nm, 85nm, 90nm, 95nm, 100nm, 105nm, 110nm, 115nm, 120nm, 125nm, 130nm, 135nm, 140nm, 145nm or 150nm. In some embodiments, the average size of the nanoparticle composition may be from about 50nm to about 100nm, from about 50nm to about 90nm, from about 50nm to about 80nm, from about 50nm to about 70nm, from about 50nm to about 60nm, from about 60nm to about 100nm, from about 60nm to about 90nm, from about 60nm to about 80nm, from about 60nm to about 70nm, from about 70nm to about 100nm, from about 70nm to about 90nm, from about 70nm to about 80nm, from about 80nm to about 100nm, from about 80nm to about 90nm, or from about 90nm to about 100nm. In certain embodiments, the average size of the nanoparticle composition may be from about 70nm to about 100nm. In some embodiments, the average size may be about 80nm. In other embodiments, the average size may be about 100nm.

[0352] The nanoparticle composition can be relatively homogeneous. The polydispersity index can be used to indicate the uniformity of the nanoparticle composition, such as the particle size distribution of the nanoparticle composition. A smaller polydispersity index (e.g., less than 0.3) generally indicates a narrower particle size distribution. The polydispersity index of the nanoparticle composition can be from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition can be from about 0.10 to about 0.20.

[0353] The zeta potential of a nanoparticle composition can be used to indicate the zeta potential of the composition. For example, the zeta potential can describe the surface charge of a nanoparticle composition. Nanoparticle compositions with relatively low positive or negative charges are generally desirable because higher charged materials can interact undesirably with cells, tissues, and other components in the body. In some embodiments, the zeta potential of the nanoparticle composition may be from about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0354] The encapsulation efficiency of therapeutic and / or prophylactic agents describes the amount of therapeutic and / or prophylactic agents encapsulated or otherwise associated with nanoparticle compositions after preparation relative to the initial amount provided. Encapsulation efficiency is desirably high (e.g., close to 100%). Encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and / or prophylactic agents in a solution containing nanoparticle compositions before and after the nanoparticle compositions are destroyed with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and / or prophylactic agents (e.g., RNA) in a solution. For nanoparticle compositions described herein, the encapsulation efficiency of therapeutic and / or prophylactic agents can be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency may be at least 90%.

[0355] The nanoparticle composition may optionally include one or more coatings. For example, the nanoparticle composition may be formulated into a capsule, film, or tablet having a coating. The capsule, film, or tablet containing the composition described herein may have any useful size, tensile strength, hardness, or density.

[0356] Pharmaceutical composition

[0357] According to the present disclosure, the nanoparticle composition can be formulated in whole or in part as a pharmaceutical composition. A pharmaceutical composition can include one or more nanoparticle compositions. For example, a pharmaceutical composition can include one or more nanoparticle compositions, and the one or more nanoparticle compositions include one or more different therapeutic agents and / or prophylactic agents. The pharmaceutical composition can further include one or more pharmaceutically acceptable excipients or auxiliary ingredients, such as those described herein. General guidelines for the formulation and manufacture of pharmaceutical compositions and agents can be found in, for example, Remington's The Science and Practice of Pharmacy, 21st Edition, A.R. Gennaro; Lippincott, Williams & Wilkins, Baltimore, Md., 2006. Conventional excipients and auxiliary ingredients can be used in any pharmaceutical composition, unless any conventional excipient or auxiliary ingredient is incompatible with one or more components of the nanoparticle composition. An excipient or auxiliary ingredient is incompatible with a component of the nanoparticle composition if the combination of the excipient or auxiliary ingredient with the component of the nanoparticle composition results in any undesirable biological effect or other harmful effect.

[0358] In some embodiments, the one or more excipients or auxiliary ingredients may constitute more than 50% of the total mass or volume of the pharmaceutical composition comprising the nanoparticle composition. For example, the one or more excipients or auxiliary ingredients may constitute 50%, 60%, 70%, 80%, 90% or higher percentages of the pharmaceutical convention. In some embodiments, the pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% pure. In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient is approved by the U.S. Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia and / or the International Pharmacopoeia.

[0359] The relative amounts of one or more nanoparticle compositions, one or more pharmaceutically acceptable excipients, and / or any additional ingredients in a pharmaceutical composition according to the present disclosure will vary depending on the identity, size, and / or condition of the subject being treated and further on the route of administration of the composition. For example, a pharmaceutical composition may include between 0.1% and 100% (wt / wt) of one or more nanoparticle compositions.

[0360] In some embodiments, nanoparticle compositions and / or pharmaceutical compositions of the disclosure are stored and / or transported refrigerated or frozen (e.g., stored at 4°C or lower, for example, between about -150°C and about 0°C or between about -80°C and about -20°C (e.g., about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C)). For example, a pharmaceutical composition comprising a compound of any of Formula (I) (and subformulae thereof) is a solution that is stored and / or transported refrigerated at, for example, about -20°C, 30°C, -40°C, -50°C, -60°C, -70°C, or -80°C. In certain embodiments, the disclosure is also directed to a method of increasing the stability of a nanoparticle composition and / or a pharmaceutical composition comprising a compound of any of Formula (I) (and subformulae thereof) by storing the nanoparticle composition and / or the pharmaceutical composition at 4°C or lower, for example, between about -150°C and about 0°C or between about -80°C and about -20°C, for example, at about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C. For example, the nanoparticle compositions and / or pharmaceutical compositions disclosed herein are stable for about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months at a temperature of, for example, 4°C or less (e.g., between about 4°C and -20°C). In one embodiment, the formulation is stable for at least 4 weeks at about 4°C. In certain embodiments, the pharmaceutical compositions of the present disclosure comprise a nanoparticle composition disclosed herein and a pharmaceutically acceptable carrier selected from one or more of the following: Tris, acetate (e.g., sodium acetate), citrate (e.g., sodium citrate), saline, PBS, and sucrose. In some embodiments, the pH of the pharmaceutical compositions of the present disclosure is between about 7 and 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or between 7.5 and 8, or between 7 and 7.8). For example, a pharmaceutical composition of the present disclosure comprises a nanoparticle composition disclosed herein, Tris, saline, and sucrose, and has a pH of about 7.5-8, which is suitable for storage and / or transportation at, for example, about -20°C.For example, the pharmaceutical composition of the present disclosure comprises the nanoparticle composition disclosed herein and PBS, and has a pH value of about 7-7.8, which is suitable for storage and / or transportation at, for example, about 4° C. or lower. In the context of the present disclosure, "stability", "stabilization" and "stable" refer to the nanoparticle composition and / or pharmaceutical composition disclosed herein being resistant to chemical or physical changes (e.g., degradation, particle size change, aggregation, encapsulation change, etc.) under given manufacturing, preparation, transportation, storage and / or use conditions, such as when stress, such as shear force, freeze / thaw stress, etc., is applied.

[0361] Nanoparticle compositions and / or pharmaceutical compositions comprising one or more nanoparticle compositions can be administered to any patient or subject, including patients or subjects who can benefit from the therapeutic effect provided by delivering therapeutic and / or prophylactic agents to one or more specific cells, tissues, organs or systems or groups thereof, such as the renal system. Although the description of nanoparticle compositions and pharmaceutical compositions comprising nanoparticle compositions provided herein is primarily directed to compositions suitable for administration to humans, it should be understood by those skilled in the art that such compositions are generally suitable for administration to any other mammal. Improvements to compositions suitable for administration to humans in order to make the compositions suitable for administration to various animals are well known, and veterinary pharmacologists with ordinary skills can design and / or perform such improvements only through ordinary experiments (if any). It is contemplated that subjects to whom the compositions are administered include, but are not limited to, humans, other primates, and other mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats.

[0362] Pharmaceutical compositions comprising one or more nanoparticle compositions can be prepared by any method known or later developed in the art of pharmacology. In general, such preparation methods include combining the active ingredient with an excipient and / or one or more other auxiliary ingredients, and then, if desired or necessary, dividing, shaping and / or packaging the product into the desired single or multiple dosage units.

[0363] Pharmaceutical compositions according to the present disclosure can be prepared, packaged and / or sold in bulk, as a single unit dose and / or as multiple single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition containing a predetermined amount of an active ingredient (e.g., a nanoparticle composition). The amount of the active ingredient is generally equal to the dosage of the active ingredient to be administered to the subject and / or a convenient portion of such a dosage, such as half or one-third of such a dosage.

[0364] Pharmaceutical compositions can be prepared into various forms suitable for various routes and methods of administration. For example, pharmaceutical compositions can be prepared into liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups and elixirs), injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders and granules), dosage forms for topical and / or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants and patches), suspensions, powders and other forms.

[0365] Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups and / or elixirs. In addition to the active ingredient, the liquid dosage form may also contain inert diluents commonly used in the art, such as water or other solvents, solubilizers and emulsifiers, such as ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol and sorbitan fatty acid esters, and mixtures thereof. In addition to inert diluents, oral compositions may also contain additional therapeutic and / or prophylactic agents, additional agents, such as wetting agents, emulsifiers and suspending agents, sweeteners, flavoring agents and / or flavoring agents. In certain embodiments for parenteral administration, the composition is mixed with a solubilizing agent, such as Cremophor™, alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers, and / or combinations thereof.

[0366] Injectable preparations, such as sterile injectable aqueous or oily suspensions, can be prepared according to known techniques using suitable dispersants, wetting agents and / or suspending agents. Sterile injectable preparations can be sterile injectable solutions, suspensions and / or emulsions in nontoxic parenteral acceptable diluents and / or solvents, such as solutions in 1,3-butanediol. Acceptable vehicles and solvents that can be used include water, Ringer's solution, USP and isotonic sodium chloride solution. Sterile fixed oils are generally used as solvents or suspension media. For this purpose, any mild fixed oil can be used, including synthetic monoglycerides or diglycerides. Fatty acids such as oleic acid can be used to prepare injections.

[0367] The injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter, and / or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

[0368] The present disclosure features methods of delivering therapeutic and / or prophylactic agents to mammalian cells or organs, producing polypeptides of interest in mammalian cells, and treating a disease or disorder in a mammal in need thereof, the methods comprising administering to the mammal a nanoparticle composition comprising the therapeutic and / or prophylactic agent and / or contacting mammalian cells with the nanoparticle composition.

[0369] Example

[0370] The examples in this section are provided by way of example only and not by way of limitation.

[0371] Example 1: Synthesis of Compound 1 Precursor

[0372]

[0373] 8-Bromooctanoic acid (696 mg, 3.08 mmol), (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-7a-methyl-1-[(2R)-6-methylhept-2-yl]octahydro-1H-inden-4-ylidene]ethylidene]-4-methylenecyclohexane-1-ol (1.00 g, 2.55 mmol) and dimethylaminopyridine (63.5 mg, 0.510 mmol) were dissolved in dichloromethane (15 mL), carbodiimide (740 mg, 3.82 mmol) was added, and the reaction was stirred at room temperature overnight. The reaction was monitored by thin layer chromatography. The reaction solution was concentrated, silica gel was added and separated by column chromatography (ethyl acetate / n-hexane=0-5%) to obtain (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-7a-methyl-1-[(2R)-6-methylhept-2-yl]octahydro-1H-inden-4-ylidene]ethylidene]-4-methylenedicyclohexyl 8-bromooctanoate (856 mg, 1.45 mmol, 57.1) as a colorless oily liquid.

[0374] Example 2: Synthesis of Compound 1

[0375]

[0376] To (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-7a-methyl-1-[(2R)-6-methylhept-2-yl]octahydro-1H-inden-4-ylidene]ethylidene]-4-methylenedicyclohexyl 8-bromooctanoate (200 mg, 339 μmol) were added ethanol (3 mL), 6-[(4-hydroxybutyl)amino]2-hexyldecanoate (145 mg, 339 μmol) and ethyldiisopropylamine (85.6 mg, 678 μmol), respectively, and the mixture was heated in an oil bath at 65 degrees and stirred overnight. The reaction was monitored by thin layer chromatography. The reaction solution was concentrated, silica gel was added, and column chromatography (methanol / dichloromethane = 0%-10%) was performed to obtain (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-7a-methyl-1-[(2R)-6-methylhept-2-yl]octahydro-1H-inden-4-ylidene]ethylidene]-4-methylenedicyclohexyl 8-(9-hexyl-2,2-hydroxy-10-oxo-18-aza-11-oxan-18-yl)octanoate (28.0 mg, 30.0 μmol, 8.82%) as a white solid ( Figure 1 ).

[0377] Example 3: Synthesis of Compound 2

[0378]

[0379] To (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-7a-methyl-1-[(2R)-6-methylhept-2-yl]octahydro-1H-inden-4-ylidene]ethylidene]-4-methylenedicyclohexyl 8-bromooctanoate (200 mg, 339 μmol) were added ethanol (3 mL), octadec-9-yl 8-[(2-hydroxyethyl)amino]octanoate (151 mg, 339 μmol) and ethyldiisopropylamine (85.6 mg, 678 μmol), respectively, and the mixture was heated in an oil bath at 65 degrees and stirred overnight. The reaction was monitored by thin layer chromatography. The reaction solution was concentrated, silica gel was added, and column chromatography (methanol / dichloromethane = 0%-5%) was performed to obtain (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-7-methyl-1-[(2R)-6-methylhept-2-yl]octahydro-1H-inden-4-ylidene]ethylidene]-4-methylenedicyclohexyl 8-(21-hydroxy-9-octyl-11-oxo-19-aza-10-benzo-19-yl)octanoate (8.00 mg, 8.42 μmol, 2.48%) as a colorless oily liquid ( Figure 2 ).

[0380] Example 4: Synthesis of the precursor of compound 3

[0381]

[0382] 8-Bromooctanoic acid (562 mg, 2.47 mmol), (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-1-[(2R, 3E, 5R)-5,6-dimethylhept-3-en-2-yl]-7a-methyloctahydro-1H-inden-4-ylidene]ethylidene]-4-methylenecyclohexane-1-ol (1.00 g, 2.47 mmol) and dimethylaminopyridine (61.6 mg, 0.494 mmol) were dissolved in dichloromethane (15 mL), carbodiimide (718 mg, 3.71 mmol) was added, and the reaction was stirred at room temperature overnight. The reaction was monitored by TLC, and the reaction solution was concentrated, and silica gel was added and separated by column chromatography (ethyl acetate / n-hexane = 0-5%) to obtain (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-1-[(2R, 3E, 5R)-5,6-dimethylhept-3-en-2-yl]-7a-methyloctahydro-1H-inden-4-ylidene]ethylidene]-4-methylenedicyclohexyl 8-bromooctanoate (940 mg, 1.56 mmol, 63.1%) as a colorless oily liquid.

[0383] Example 5: Synthesis of Compound 3

[0384]

[0385] To (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-1-[(2R, 3E, 5R)-5,6-dimethylhept-3-en-2-yl]-7a-methyloctahydro-1H-inden-4-ylidene]ethylidene]-4-methylenedicyclohexyl 8-bromooctanoate (200 mg, 332 μmol) were added ethanol (3 mL), octadec-9-yl 8-[(2-hydroxyethyl)amino]octanoate (148 mg, 332 μmol) and ethyldiisopropylamine (86.8 mg, 665 μmol), respectively, and the mixture was heated in an oil bath at 65 degrees with stirring overnight. The reaction was monitored by thin layer chromatography, the reaction solution was concentrated, silica gel was added, and column chromatography (methanol / dichloromethane = 0%-5%) was performed to obtain (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-1-[(2R, 3E, 5R)-5,6-dimethylhept-3-en-2-yl]-7a-methyloctahydro-1H-inden-4-ylidene]ethylidene]-4-methylenecyclohexyl 8-(21-hydroxy-9-octyl-11-oxo-19-aza-10-phenylnonadecayl)octanoate (24.0 mg, 24.9 μmol, 7.50%) as a colorless oily liquid ( Figure 3 ).

[0386] Example 6: Synthesis of Compound 4 Precursor

[0387]

[0388] 8-Bromooctanoic acid (497.54 mg, 2.23 mmol) 2,5,7,8-tetramethyl-2-(4,8,12-trimethyltridecyl)-3,4-dihydro-2H-chromen-6-ol (1.00 g, 2.23 mmol) and 4-dimethylaminopyridine (55.8 mg, 0.446 mmol) were dissolved in dichloromethane (15 mL), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (647 mg, 3.34 mmol) was added and stirred overnight at room temperature. The reaction was monitored by TLC, and the reaction solution was concentrated, and silica gel was added and separated by column chromatography (ethyl acetate / n-hexane = 0-5%) to obtain 2,5,7,8-tetramethyl-2-(4,8,12-trimethyltridecyl)-3,4-dihydro-2H-chromen-6-yl 8-bromooctanoate (1.31 g, 2.06 mmol, 92.4%) as a colorless oily liquid.

[0389] Example 7: Synthesis of Compound 4

[0390]

[0391] Ethanol (3 mL), octadec-9-yl 8-[(2-hydroxyethyl)amino]octanoate (140 mg, 315 μmol) and ethyldiisopropylamine (82.1 mg, 629 μmol) were added to 2,5,7,8-tetramethyl-2-(4,8,12-trimethyltridecyl)-3,4-dihydro-2H-chromen-6-yl 8-bromooctanoate (200 mg, 315 μmol), respectively, and the mixture was heated in an oil bath at 65 degrees with stirring overnight. The reaction was monitored by thin layer chromatography, the reaction solution was concentrated, silica gel was added, and column chromatography (methanol / dichloromethane = 0%-5%) was performed to obtain 2,5,7,8-tetramethyl-2-(4,8,12-trimethyltridecyl)-3,4-dihydro-2H-chromen-6-yl 8-(21-hydroxy-9-octyl-11-oxo-19-aza-10-benzoic acid-19-yl) octanoate (54.0 mg, 54.2 μmol, 17.2%) as a yellow oily liquid ( Figure 4 ).

[0392] Example 8: Synthesis of Compound 5

[0393]

[0394] To (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-1-[(2R, 3E, 5R)-5,6-dimethylhept-3-en-2-yl]-7a-methyloctahydro-1H-inden-4-ylidene]ethylidene]-4-methylenedicyclohexyl 8-bromooctanoate (200 mg, 332 μmol) were added ethanol (3 mL), 6-[(4-hydroxybutyl)amino]2-hexyldecanoate (142 mg, 332 μmol) and ethyldiisopropylamine (86.8 mg, 665 μmol), the mixture was heated at 65 degrees in an oil bath and stirred overnight. The reaction was monitored by thin layer chromatography, the reaction solution was concentrated, silica gel was added, and column chromatography (methanol / dichloromethane = 0-10%) was used to obtain (1S)-3-[(1Z)-2-[(1R, 3aS, 4E, 7aR)-1-[(2R, 3E, 5R)-5,6-dimethylhept-3-en-2-yl]-7a-methyloctahydro-1H-inden-4-ylidene]ethylidene]-4-methylenecyclohexyl 8-(9-hexyl 22-hydroxy-10-oxo-18-aza-11-oxadox-18-yl)octanoate (105 mg, 0.111 mmol, 33.3%) as a yellow oily liquid ( Figure 5 ).

[0395] Example 9: Synthesis of Compound 6

[0396]

[0397] Ethanol (3 mL), 6-[(4-hydroxybutyl)amino]2-hexyldecanoate (134 mg, 314 μmol) and ethyldiisopropylamine (82.1 mg, 629 μmol) were added to 2,5,7,8-tetramethyl-2-(4,8,12-trimethyltridecyl)-3,4-dihydro-2H-chromen-6-yl 8-bromooctanoate (200 mg, 314 μmol) respectively, and the mixture was heated at 65 degrees in an oil bath and stirred to react overnight. The reaction was monitored by TLC, and the reaction solution was concentrated, and silica gel was added and separated by column chromatography (methanol / dichloromethane = 0-5%) to obtain 2,5,7,8-tetramethyl-2-(4,8,12-trimethyltridecyl)-3,4-dihydro-2H-chromen-6-yl 8-(9-hexyl-22-hydroxy-10-oxo-18-aza-11-oxadocos-18-yl)octanoate (134 mg, 0.136 mmol, 43.4%) as a yellow oily liquid ( Figure 6 ).

[0398] Example 10: Synthesis of the precursor of compound 7

[0399]

[0400] (2E, 4E, 6E, 8E)-3,7-dimethyl-9-(2,6,6-trimethylcyclohex-1-enyl)non-2,4,6,8-tetraenoic acid (1.00 g, 3.26 mmol), 8-bromooctan-1-ol (683 mg, 3.26 mmol) and dimethylaminopyridine (81.3 mg, 0.652 mmol) were dissolved in dichloromethane (15 mL), carbodiimide (947 mg, 4.89 mmol) was added, and the reaction was stirred at room temperature overnight. The reaction was monitored by thin layer chromatography, the reaction solution was concentrated, silica gel was added, and column chromatography was performed (ethyl acetate / n-hexane = 0-5%) to obtain 8-bromooctyl (2E, 4E, 6E, 8E)-3,7-dimethyl-9-(2,6,6-trimethylcyclohex-1-enyl) non-2,4,6,8-tetraenoic acid (463 mg, 0.942 mmol, 28.9%) as a yellow oily liquid.

[0401] Example 11: Synthesis of Compound 7

[0402]

[0403] To 8-bromooctyl(2E,4E,6E,8E)-3,7-dimethyl-9-(2,6,6-trimethylcyclohex-1-enyl)non-2,4,6,8-tetraenoic acid (200 mg, 407 μmol) were added ethanol (3 mL), 6-[(4-hydroxybutyl)amino]2-hexyldecanoate (174 mg, 407 μmol) and ethyldiisopropylamine (106 mg, 814 μmol), respectively, and heated in an oil bath at 65 degrees with stirring overnight. The reaction was monitored by thin layer chromatography, the reaction solution was concentrated, silica gel was added, and column chromatography (methanol / dichloromethane = 0%-5%) was performed to obtain (1E, 3E, 5E, 7E)-19-(4-hydroxybutyl)-3,7-dimethyl-9-oxo-1-(2,6,6-trimethylcyclohex-1-enyl)-19-aza-10-oxa-pentacosane-1,3,5,7-tetraen-25-yl 2-hexyldecanoate (17.0 mg, 20.0 μmol, 4.98%) as a yellow oily liquid ( Figure 7 ).

[0404] Example 12: Synthesis of Compound 8

[0405]

[0406] Ethanol (3 mL), octadec-9-yl 8-[(2-hydroxyethyl)amino]octanoate (182 mg, 407 μmol) and ethyldiisopropylamine (106 mg, 814 μmol) were added to 8-bromooctyl (2E, 4E, 6E, 8E)-3,7-dimethyl-9-(2,6,6-trimethylcyclohex-1-enyl)non-2,4,6,8-tetraenoic acid (200 mg, 407 μmol), respectively, and the mixture was heated in an oil bath at 65 degrees with stirring overnight. The reaction was monitored by thin layer chromatography, the reaction solution was concentrated, silica gel was added, and column chromatography (methanol / dichloromethane = 0%-5%) was performed to obtain heptadecan-9-yl-8-[(1E, 3E, 5E, 7E)-21-hydroxy-3,7-dimethyl-9-oxo-1-(2,6,6-trimethylcyclohex-1-enyl)-19-aza-10-hydroxy-1,3,7,7-tetraen-19-yl]octanoate (32.0 mg, 37.5 μmol, 9.23%) as a yellow oily liquid ( Figure 8 ).

[0407] Example 13: Preparation of LNP

[0408] The formula ratio (mol %) of the synthesis of the novel carrier LNP is: ionizable lipid molecules / DMG-PEG2000 / DSPC / cholesterol (Chol) = 40-49 / 1.0-2.0 / 10.0-11.8 / 38.5-47.2 (mol %). The specific process of preparing the novel carrier LNP encapsulating luciferase mRNA (Luci-mRNA) is as follows:

[0409] 1. Prepare the working solutions of each lipid component

[0410] (1) Prepare the stock solutions of each lipid component: ionizable lipid molecule: 50 mg / mL, DSPC: 20 mg / mL, cholesterol (Chol): 20 mg / mL, DMG-PEG2000: 20 mg / mL.

[0411] (2) Based on the concentrations in (1) above, each lipid component was fully dissolved in anhydrous ethanol. Ionizable lipid molecules, DSPC, cholesterol (Chol), and DMG-PEG2000 were ultrasonically dissolved in an ultrasonic cleaner at 40°C for 20 minutes. The concentration of the mother solution can be reduced according to the solubility of the ionizable lipid molecules in ethanol.

[0412] (3) According to the formula ratio of synthesizing the new carrier LNP: its components are ionizable lipids, neutral phospholipids, steroidal lipids and polyethylene glycol lipid conjugates. Ionizable lipid molecules / DSPC / cholesterol (Chol) / DMG-PEG2000=47.5 / 10 / 40.7 / 1.8 (mol%) are added to the mother solution of each lipid component and mixed evenly, and the remaining volume is supplemented with anhydrous ethanol and fully mixed. As the working solution of each lipid component, the control is based on the formula of ALC-0315 / DSPC / cholesterol / ALC-0159 with a molar ratio of 47.5% / 10% / 40.7% / 1.8% for encapsulation of luciferase mRNA. (Table 1) Table 1 The formula of LNP preparation prepared with ionizable lipids is (molar ratio, mol%)

[0413]

[0414] 2. Dilute luciferase mRNA solution

[0415] The mRNA solution was diluted to 0.2 mg / mL with 50 mM citrate buffer pH 4.0.

[0416] 3. Preparation of LNPs by Microfluidics

[0417] LNP was prepared using Maianna microfluidic equipment and Maianna microfluidic chips. Clean the microfluidic chip channel with anhydrous ethanol and enzyme-free water and drain it. Use a syringe to draw 1mL of the working solution of each lipid component and load it into the left side of the device. Use a syringe to draw 3mL of mRNA solution and load it into the right side of the device. Microfluidic device software parameter settings: total volume is 4.000mL, total flow rate is 12mL / min, left and right flow rate ratio is 1:3, initial waste liquid volume is 0.500mL, and end waste liquid volume is 0.100mL. Repeat several times according to the set parameters, collect all the product LNP solution, and add DPBS solution to dilute it to reduce the proportion of ethanol in the solution.

[0418] 4. Purification of LNPs by Tangential Flow Filtration (TFF)

[0419] The Ribogreen KR2i TFF system and hollow fiber column were used for liquid exchange. The LNP solution was first concentrated to about 0.5 mg / mL, and then ultrafiltration was performed with DPBS. The volume of the liquid exchange was 8-10 DV to remove the ethanol component in the LNP solution, so that the LNP was dispersed in DPBS, and then the LNP solution was concentrated to about 0.67 mg / mL. The LNP solution was collected and a 1.2 M sucrose solution was added. The final sucrose concentration was 0.3 M. The LNP sample was stored at -80 °C. According to the instructions of the Ribogreen kit, the encapsulation efficiency of the product was tested and calculated; the particle size and polydispersity index (PDI) were detected using standard detection methods on the Zetasizer nano instrument of Malvern Company, and the encapsulation efficiency was higher than 96%, and the particle size range was 69-100 nm, and the PDI was between 0.01 and 0.08.

[0420] (Table 2)

[0421] Table 2 Physical and chemical test results of LNP

[0422]

[0423] Example 14: Animal experiments to test the performance of LNP delivery vectors

[0424] 1. Intramuscular injection of LNP in mice

[0425] Female Balb / c mice (6-8 weeks, purchased from Zhejiang Weitong Lihua Experimental Animal Technology Co., Ltd.) were housed under experimental conditions of 22±2°C and relative humidity of 45% to 75%. Using mRNA encoding luciferase as a reporter gene (luciferase mRNA), luciferase underwent oxidative decarboxylation reaction in the presence of ATP, magnesium ions, oxygen and substrate (D-Luciferin) to emit blue-green bioluminescence with a wavelength of about 560 nm. After 15 minutes of reaction, the bioluminescent signal in the mouse body was detected by an in vivo imaging device, and the in vivo transfection efficiency of the LNP preparation was evaluated by the luciferase fluorescence signal intensity. Taking luciferase mRNA as an example, six different LNP preparations were prepared by using LNP 1, LNP 2, LNP 3, LNP 4, LNP 5, and LNP 6. The samples prepared by luciferase mRNA packaged in Acuitas and saline were used as control samples. The mRNA was administered to the left leg muscle of mice at a dose of 5ug / mRNA. The mice were intraperitoneally injected with quantitative luciferin potassium salt (15mg / mL, 200μL) at 4h and 24h after administration. After 15min, the luciferase fluorescence signal in the body and muscle of the mice was detected by a small animal in vivo imaging device. The specific detection principle is as follows: Fig.11 shown.

[0426] (1) The mice were randomly divided into groups of 3 mice each. The weight difference of mice in each group did not exceed 20%. The mice were numbered;

[0427] (2) Preparation of test sample solution: Take out the preparation sample stored at -80°C, thaw it at room temperature, and shake it evenly. After the test sample solution is completely thawed, use a pipette to draw up the required volume, dilute the preparation sample to the required concentration with physiological saline according to the test sample form, mix well, and place on ice for later use.

[0428] (3) Use a 1.0 mL insulin syringe to draw up 100 uL of the test sample mixture, flick the syringe to expel the air in the syringe, cover the syringe with a protective cover and place it on ice for later use.

[0429] (4) Take the mouse out of the cage, lift it by its tail and place it on the stainless steel mesh cover of the IVC cage or other rough surface, and observe the condition of the mouse.

[0430] (5) After the mouse is in normal condition, one person pinches the skin on the back of the mouse and fixes the mouse on a rough surface.

[0431] (6) Another person holds the left hind limb of the mouse with his left hand and wipes the calf muscle with alcohol. After finding the best injection site, the syringe is placed at an angle to the left hind limb and the test sample mixture is injected. The injection is completed after no reflux is found.

[0432] (7) Pull out the syringe and throw it into the sharps box, observe the condition of the mouse, and after confirming that there is no abnormality in the mouse, put the mouse back into the cage and repeat the operation for the next mouse; after all injections are completed, put the cage back on the breeding rack;

[0433] (8) After the injection, spray the entire operating table with 75% alcohol to clean and disinfect it, and throw the garbage into the medical waste bag;

[0434] (9) 4 h and 24 h after drug administration on the same day, all mice were removed and potassium salt of luciferin was injected intraperitoneally. The mice were subjected to in vivo imaging experiments to observe the bioluminescent signal intensity in the left leg muscles of the mice, take pictures and save the experimental data.

[0435] 2. In vivo imaging of mice

[0436] Preparation of D-luciferin potassium salt: Take D-luciferin potassium salt out of the refrigerator, equilibrate to room temperature, add PBS to dissolve, prepare a 15 mg / mL D-luciferin potassium salt solution, filter with a 0.22 um filter membrane, transfer to a 15 mL centrifuge tube, and store with tin foil in the dark for later use.

[0437] (1) Use a 1.0 mL insulin syringe to draw 200 μL of 15 mg / mL D-luciferin potassium salt solution. After flicking the syringe to expel the air in the syringe, cover the syringe with a protective cover and place it on ice to avoid light for later use.

[0438] (2) Remove the cage, open the cage, grab the mouse by its tail, lift it and place it on the stainless steel mesh cover or other rough surface of the IVC cage;

[0439] (3) Grasp the mouse's back skin with one hand, fix the mouse, and then locate the mouse's abdominal cavity, keeping the mouse's head down and its abdomen facing up.

[0440] (4) Use your other hand to wipe the mouse's abdominal cavity with alcohol and inject D-luciferin potassium salt solution into the abdominal cavity at an angle with the syringe.

[0441] (5) After the injection, put the mouse back into the cage and wait for 10 minutes. At the same time, turn on the anesthesia machine and anesthetize the mouse. After 3 minutes of anesthesia, take the mouse out and place it in the dark box of the mouse living imager. Keep the mouse lying on its side with its left hind limb facing up to facilitate the collection of the luciferase fluorescence signal at the injection site.

[0442] (6) Adjust the instrument interface on the computer, set the parameter group information, take photos immediately after the D-luciferin potassium salt injection time reaches 15 minutes, and save the experimental data.

[0443] From the results in the table, we can see that the in vivo transfection effects of LNP 4 and LNP 5 are significantly higher than those of the Acuitas delivery system. (Table 3) Fig. 9 )

[0444] Table 3 Small animal fluorescence imaging results

[0445]

[0446] From the data in the table, we can see that after injection of LNPs of different formulations prepared by the new compound, the weight change rate of mice within two days (D1, D2) was comparable to that of the group injected with normal saline, indicating that this type of ionizable lipid has good biosafety. (Table 4) Fig.10 )

[0447] Table 4 Body weight of mice after injection of LNP preparations

[0448]

[0449] The above experimental results show that the mRNA-LNP prepared by the ionizable lipid compound of the new structure provided by the present invention has high mRNA transfection efficiency in vivo; high biosafety and low toxic side effects; the raw materials required for synthesis are easy to obtain, the reaction conditions are mild, the instrumentation requirements are low, the operation is simple, and it is suitable for large-scale production, achieving obvious beneficial technical effects.

Claims

1. Compounds of formula (I): or a pharmaceutically acceptable salt, tautomer, prodrug or stereoisomer thereof, wherein: G 1 and G 2 Each independently is a bond, C1-C 12 Alkylene or C2-C 12 alkenylene; L 1 is -OC(=O)R 1 、-C(=O)OR 1 、-OC(=O)OR 1 、-C(=O)R 1 、-OR 1 、 -S(O) x R 1 、-S-SR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 、-C(=O)NR b R c 、-NR a C(=O)NR b R c 、-OC(=O)NR b R c 、-NR a C(=O)OR 1 、-SC(=S)R 1 、-C(=S)SR 1 、-C(=S)R 1 、-CH(OH)R 1 、-P(=O)(OR b )(OR c )、-(C6-C 10 Arylene)-R 1 , -(6- to 10-membered heteroarylene)-R 1 or R 1 ; R 1 C6-C 24 Alkyl or C6-C 24 Alkenyl or C6-C 24 Alkynyl; R a and R b Each independently is H, C1-C 12 Alkyl, C2-C 12 Alkenyl or C2-C 12 Alkynyl; R c C1-C 32 Alkyl or C2-C 32 alkenyl; L 2 is -OC(=O)L 3 、-C(=O)OL 3 、-OC(=O)OL 3 、-C(=O)L 3 、-OL 3 、 -CH(OH)L 3 or L 3 ; L 3 For-R 2 =R 3 =R 4 -R 5 or -R 6 -R 7 or -R 8 -R 9 ; R 2 C 3-8 Cycloalkylene, preferably C6 cycloalkylene or R 2 for R d C 3-8 Cycloalkylene, preferably C6 cycloalkylene, R e and R f Each independently is H or C 1-12 Alkyl, R 3 C1-C 12 Alkylene or C2-C 12 Alkenylene, R 4 is a bicyclic group, preferably a C 5-8 Cycloalkyl C 5-8 Cycloalkyl, more preferably C6 cycloalkylene and C5 cycloalkylene, R 5 C2-C 24 Alkyl or C2-C 24 Alkenyl or C2-C 24 Alkynyl; R 6 is a bicyclic group, preferably a C6 aryl group and a C 5-8 Heterocycloalkyl, more preferably C6 arylene and C6 heterocycloalkyl, R 7 C6-C 24 Alkyl or C6-C 24 Alkenyl or C6-C 24 Alkynyl; R 8 C1-C 24 Alkylene or C2-C 24 Alkenylene, preferably C6-C 18 Alkylene or C6-C 18 Alkenylene, more preferably C 10 Alkylene or C 10 Alkenylene, R 9 C 5-8 Cycloalkenyl, preferably C6 cycloalkenyl; G 3 It is C1-C 12 Alkylene, preferably C2-C6 alkylene, more preferably C2-C4 alkylene; R 10 is hydroxyl group; x is 0, 1, or 2; and wherein each alkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, alkylene, alkenylene, arylene, heteroarylene, cycloalkylene, bicyclolene, aryl is independently optionally substituted.

2. The compound according to claim 1, wherein L 1 -OC(=O)R 1 OR -C(=O)OR 1 or -NR a C(=O)NR b R c OR-OC(=O)OR 1 or -C(=O)NR b R c or -NR a C(=O)R 1 .

3. The compound according to claim 1 or 2, wherein R 1 Straight chain C6-C 24 Alkyl or branched C6-C 24 Alkyl, preferably straight chain C 10 -C 20 Alkyl or branched C 10 -C 20 Alkyl, more preferably straight chain C 15 -C 17 Alkyl or branched C 15 -C 17 alkyl.

4. The compound according to claim 3, wherein: R a is H; and / or R b is H; and / or R c Straight chain C6-C 24 Alkyl or branched C6-C 24 Alkyl, preferably straight chain C 10 -C 20 Alkyl or branched C 10 -C 20 Alkyl, more preferably straight chain C 15 -C 17 Alkyl or branched C 15 -C 17 alkyl.

5. The compound according to claim 4, wherein L 1 for:

6. The compound according to claim 1 or 2, wherein G 1 Straight or branched C2-C 10 Alkylene, preferably a linear or branched C6-C7 alkylene, more preferably:

7. The compound according to claim 1 or 2, wherein G 2 Straight or branched C2-C 10 Alkylene, preferably a linear or branched C7-C8 alkylene, more preferably:

8. The compound according to claim 1 or 2, wherein L 2 -C(=O)OL 3 , L 3 For-R 2 =R 3 =R 4 -R 5 , and where: R 2 for R d is C6 cycloalkylene, R e and R f All are H; and / or R 3 is C2-C6 alkylene, preferably C2 alkylene; and / or R 4 is a bicyclic group, wherein the bicyclic group is a C6 cycloalkyl group and a C5 cycloalkyl group; and / or R 5 Straight or branched C6-C 16 Alkyl or linear or branched C6-C 16 The alkenyl group is preferably a linear or branched C8-C9 alkyl group or a linear or branched C8-C9 alkenyl group.

9. The compound according to claim 1 or 2, wherein L 2 -C(=O)OL 3 , L 3 For-R 2 =R 3 =R 4 -R 5 , and where: R 2 for R a’ , R b’ , R c’ , R d’ , R e’ Independently selected from H, C1-C6 alkyl, preferably and / or R 3 for and / or R 4 for R f’ , R g’ , R h’ , R i’ , R j’ , R k’ , R l’ , R m’ Independently selected from H, C1-C6 alkyl, preferably and / or R 5 for 10. The compound according to claim 9, wherein L 3 for: Preferably, L 3 for:

11. The compound according to claim 1 or 2, wherein L 2 -C(=O)OL 3 , L 3 For-R 6 -R 7 , and where: R 6 is a bicyclic group, wherein the bicyclic group is a C6 aryl and a C6 heterocycloalkyl; and / or R 7 Straight or branched C6-C 24 Alkyl, preferably a straight chain or branched C 12 -C 18 Alkyl, more preferably a straight chain or branched C 16 alkyl.

12. The compound according to claim 1 or 2, wherein L 2 -C(=O)OL 3 , L 3 For-R 6 -R 7 , and where: R 6 for R n’ , R o’ , R p’ , R q’ , R r’ , R s’ Independently selected from H, C1-C6 alkyl, preferably and / or R 7 for Preferably, L 3 for:

13. The compound according to claim 1 or 2, wherein L 2 =-OC(=O)L 3 , L 3 For-R 8 -R 9 , and where: R 8 Straight or branched C2-C 12 alkenylene; and / or R 9 It is a C6 cycloalkenyl group.

14. The compound according to claim 1 or 2, wherein L 2 =-OC(=O)L 3 , L 3 For-R 8 -R 9 , and where: R 8 for and / or R 9 for R t’ , R u’ , R v’ , R w’ , R x’ , R y’ Independently selected from H, C1-C6 alkyl, preferably Preferably, L 3 for:

15. The compound according to claim 1 or 2, wherein G 3 for:

16. The compound according to claim 1 or 2, wherein the compound is selected from:

17. A composition comprising the compound of any one of claims 1 to 16 and a therapeutic or preventive agent.

18. The composition of claim 17, further comprising one or more structured lipids.

19. The composition of claim 18, wherein the one or more structured lipids are selected from DSPC, steroids, or a combination thereof.

20. The composition of claim 19, wherein the molar ratio of the compound to the DSPC is in the range of about 2:1 to about 8:1, preferably about 3:1 to about 5:1, more preferably about 47.5:

10.

21. The composition of claim 19, wherein the steroid is cholesterol.

22. The composition of claim 21, wherein the molar ratio of the compound to the steroid is in the range of about 5:1 to about 1:1, preferably about 2:1 to about 1:1, more preferably about 47.5:40.

7.

23. The composition of claim 18, wherein the composition further comprises one or more polymer-bound lipids.

24. The composition according to claim 23, wherein the polymer-bound lipid is DMG-PEG2000 or DMPE-PEG2000, preferably DMG-PEG2000.

25. The composition of claim 24, wherein the molar ratio of the compound to the polymer-bound lipid is in the range of about 100:1 to about 20:1, preferably about 50:1 to about 25:1, more preferably about 47.5:1.

8.

26. The composition of claim 17, wherein the therapeutic agent or preventive agent comprises one or more selected from the group consisting of: small molecule drugs, nucleic acid molecules, proteins.

27. The composition of claim 26, wherein the nucleic acid molecule comprises at least one mRNA or siRNA or nclRNA encoding an antigen or a fragment or epitope thereof.

28. The composition of claim 27, wherein the mRNA is a monocistronic mRNA or a polycistronic mRNA.

29. The composition of claim 27, wherein the antigen is a pathogenic antigen or a tumor-associated antigen.

30. The composition of claim 27, wherein the mRNA comprises one or more functional nucleotide analogs.

31. The composition of claim 30, wherein the functional nucleotide analogue is selected from one or more of the following: pseudouridine, 1-methyl-pseudouridine and 5-methylcytosine.

32. The composition of any one of claims 17 to 31, wherein the composition is a nanoparticle.

33. A lipid nanoparticle comprising a compound as described in any one of claims 1 to 16 or a composition as described in any one of claims 17 to 31.

34. A pharmaceutical composition comprising a compound as described in any one of claims 1 to 16, a composition as described in any one of claims 17 to 31, or a lipid nanoparticle as described in claim 33, and a pharmaceutically acceptable excipient or diluent.

35. Use of the lipid nanoparticle according to claim 33 or the pharmaceutical composition according to claim 34 in the preparation of a medicament.

Images