ASO inhibitor of CREPT gene and its inhibition on glioma

Abstract

The present invention provides an antisense oligonucleotide (ASO), which is complementary to the CREPT gene sequence and can effectively inhibit the expression of CREPT, and the antisense oligonucleotide is selected from the antisense oligonucleotide having a nucleotide sequence as shown in any one of SEQ ID No. 1 to 5. The antisense oligonucleotide (ASO) can efficiently and specifically target CREPT, significantly reduce the expression level of CREPT in glioma cells, and thereby reduce the cloning ability of glioma cells, cause obvious cell apoptosis, and cause a significant decrease in the invasive ability of glioma cells. The present invention also provides extracellular vesicles and pharmaceutical compositions, which, when administered to patients, can significantly improve the survival rate of mouse glioma in situ models.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular, relates to an ASO inhibitor of the CREPT gene and its inhibition on glioma. Background Art

[0002] CREPT (Cell cycle-related and expression elevated protein in tumor) is a cancer-related gene discovered and cloned by the applicant's laboratory. Compared with adjacent cancer and normal tissues, it is highly expressed in a variety of tumor tissues including liver cancer, pancreatic cancer, glioma, prostate cancer and colorectal cancer, and is negatively correlated with patient prognosis (Lu et al., 2012). Many research groups have reported consistent phenomena in different tumors, that is, overexpression of CREPT promotes tumor growth, while inhibition or knockout of CREPT has the opposite effect (Li et al., 2021; Lu et al., 2012). Moreover, CREPT plays an important role in transcriptional regulation. It can not only interact with RNA polymerase II (RNAPII) to regulate the expression of target genes such as cyclin D1, but also participate in the regulation of multiple signaling pathways such as Wnt and STAT3, thereby promoting cell growth and tumorigenesis (Lu et al., 2012). Many signs indicate that CREPT is a promising new target for the treatment of tumors.

[0003] The published patent document WO02 / 44321A2 states in its specification that the nucleoside placed in the center of the siRNA opposite to the target RNA cleavage site is an important specificity determinant and that even a single nucleoside change reduces RNAi to undetectable levels (see the first paragraph on page 50 of the patent document specification).

[0004] However, there has been no report in the prior art on the inhibitory effect of inhibiting CREPT at the mRNA expression level on the production of CREPT-induced tumors. Summary of the invention

[0005] To address the deficiencies of the prior art, the present invention provides an antisense oligonucleotide (ASO), which is complementary to the CREPT gene sequence and can effectively inhibit the expression of CREPT; the antisense oligonucleotide is selected from an antisense oligonucleotide having a nucleotide sequence as shown in any one of SEQ ID No. 1 to 5.

[0006] Antisense oligonucleotides (ASOs) are a class of molecular drugs that inhibit the expression of a target gene by binding to the target gene DNA or mRNA in a sequence-specific manner, and regulate at the gene level. Antisense oligonucleotide drugs generally contain 12-28 single strands of nucleic acid with specific sequences that are complementary to the target nucleic acid bases. They can form an ASO-RNA composite duplex with the target RNA, and utilize the space-occupying effect to regulate the expression of the target gene. They can also play a role by removing the RNA chain of the ASO-RNA composite duplex through ribonuclease H (RNase H). The ASO that can be used in the present invention may contain at least one non-naturally occurring nucleoside.

[0007] In this article, "inhibiting the expression of CREPT" refers to that ASO reduces the expression of CREPT gene transcripts and / or CREPT proteins in cells or tissues. In certain embodiments, the term "inhibition" refers to complete inhibition of CREPT gene transcripts or CREPT proteins (100% inhibition or undetectable levels). In other aspects, the term "inhibition" refers to at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% inhibition of CREPT gene transcripts and / or CREPT protein expression in cells or tissues.

[0008] CREPT, also known as RPRD1B or C20ORF77, is a gene found in recent years and located on human chromosome 20. In humans, the CREPT gene contains 5 exons and encodes a protein composed of 312 amino acids. CREPT is expressed at high levels in many tumors, promoting cell proliferation and tumor formation. CREPT has a promoting effect on a variety of malignant tumors such as colorectal cancer, pancreatic cancer, and gastric cancer. It can participate in the regulation of multiple signaling pathways, such as Wnt, MAPK, STAT3, and NF-κB.

[0009] The antisense oligonucleotide of the present invention can be an antisense oligonucleotide having a homology of ≥75% with the nucleotide sequence shown in any one of SEQ ID No.1 to 5, and specifically can have a homology of 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0010] In molecular evolution research, homology generally refers to the degree of similarity between the nucleotide sequences of two nucleic acid molecules or between the amino acid sequences of two protein molecules.

[0011] As certain embodiments of the present invention, the antisense oligonucleotide further comprises one or more nucleoside analogs.

[0012] "Nucleoside analogs" are variants of natural nucleosides (such as DNA or RNA nucleosides) obtained by modification of sugar and / or base moieties. In principle, in the case of oligonucleotides, analogs may only be "silent" or "equivalent" to natural nucleosides, i.e., there is no functional effect on the way that oligonucleotides work to inhibit target gene expression. However, if such "equivalent" analogs are, for example, easier or cheaper to manufacture, or more stable to storage or manufacturing conditions, or represent labels or markers, they can still be useful. However, in some embodiments, nucleoside analogs will have a functional effect on the way that ASO works to inhibit expression: for example, by generating an increased binding affinity to the target and / or an increased resistance to intracellular nucleases and / or an increased ease of transport into cells. According to the natural structure of nucleotides, chemical modifications can be carried out at the phosphate backbone, ribose moiety or base to improve its stability and reduce the activation of the innate immune system.

[0013] In the present invention, the ASO may contain more than 1, more than 2, more than 3, more than 4, more than 5, more than 6, more than 7, more than 8, more than 9, more than 10, more than 11, more than 12, more than 13, more than 14, more than 15, more than 16, more than 17, more than 18 or more than 19 nucleoside analogs. In certain embodiments, the nucleoside analogs may be the same. In certain embodiments, the nucleoside analogs may be different.

[0014] The term "nucleobase" includes purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine and cytosine) moieties present in nucleosides and nucleotides that form hydrogen bonds in nucleic acid hybridization. In this article, the term nucleobase also encompasses modified nucleobases that may be different from naturally occurring nucleobases but are functional during nucleic acid hybridization. In some embodiments, the nucleobase moiety is modified by modifying or replacing the nucleobase.

[0015] In certain embodiments, the nucleobase moiety is modified by changing a purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methyl-cytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2-chloro-6-aminopurine.

[0016] As certain embodiments of the present invention, the antisense oligonucleotide further comprises one or more 5'-methyl-cytosine nucleobases.

[0017] The monomers of the ASO described in the present invention are coupled together by a linkage group. Suitably, each monomer is connected to a 3' adjacent monomer by a linkage group. In certain embodiments, the continuous nucleotide sequence comprises one or more modified internucleoside linkages. The term "linking group" or "internucleoside linkage" is intended to mean a group that can covalently couple two nucleosides together. Non-limiting examples include phosphate groups and thiophosphate groups. In certain embodiments, the internucleoside linkage is modified from its normal phosphodiester to one that is more resistant to nuclease attack, such as a thiophosphate that can be cleaved by RNase H and also allows antisense inhibition pathways to reduce the expression of target genes.

[0018] As certain embodiments of the present invention, the contiguous nucleotide sequence of the antisense oligonucleotide comprises one or more modified internucleoside linkages.

[0019] In certain embodiments, the nucleoside analog is modified at the 2' position, which has significant advantages because the conformational maintenance of the modification at this site enhances chemical stability. Modification at the 2' position has been shown to be very suitable for applications and can prevent 2'-OH-mediated chain breaks. In addition, since the 2' position is close to the adjacent phosphate, it can better prevent nuclease attack. For example, the incorporation of 2'-OMe and 2'-deoxy-2'-fluoro (2'-F) modifications greatly reduces the ability of nucleases to degrade siRNA.

[0020] As certain embodiments of the present invention, one or more of the nucleoside analogs include 2'-O-alkyl-RNA; 2'-O-methyl RNA (2'-OMe); 2'-alkoxy-RNA; 2'-O-methoxyethyl-RNA (2'-MOE); 2'-amino-DNA; 2'-fluoro-RNA; 2'-fluoro-DNA; arabinoic acid (ANA); 2'-fluoro-ANA; or a bicyclic nucleoside analog.

[0021] The ASOs of the present invention may comprise one or more nucleosides having a modified sugar moiety (i.e., a modification of the sugar moiety when compared to the ribose moiety found in DNA and RNA). Many nucleosides having modifications of the ribose moiety have been prepared, primarily for the purpose of improving certain properties of the oligonucleotide, such as affinity and / or nuclease resistance. In certain embodiments, the modified sugar moiety may be a change in the ribose ring structure. In certain embodiments, the sugar modification may also be a modification by changing the substituent on the ribose ring to a group other than hydrogen or by changing the 2'-OH group naturally present in RNA nucleosides.

[0022] As certain embodiments of the present invention, one or more of the nucleoside analogs are sugar-modified nucleosides.

[0023] As certain embodiments of the present invention, the sugar-modified nucleoside is an affinity-enhancing 2' sugar-modified nucleoside.

[0024] Locked Nucleic Acid Nucleosides (LNA), LNA nucleosides are modified nucleosides that contain a linker group (called a diradical or bridge) between C2' and C4' of the ribose ring of the nucleoside (i.e., a 2'-4' bridge), which restricts or locks the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNA). When LNA is incorporated into oligonucleotides of complementary RNA or DNA molecules, the locking of the ribose conformation is associated with enhanced hybridization affinity (duplex stabilization).

[0025] As certain embodiments of the present invention, one or more of the nucleoside analogs comprises LNA. LNA is a 2'-4' diradical bridged nucleoside.

[0026] As certain embodiments of the present invention, one or more of the nucleotide analogs are selected from the group consisting of constrained ethyl nucleosides (cEt), 2',4'-constrained 2'-O-methoxyethyl (cMOE), α-L-LNA, β-D-LNA, 2'-O,4'-C-ethylene-bridged nucleic acid (ENA), amino-LNA, oxy-LNA, thio-LNA and any combination thereof.

[0027] As certain embodiments of the invention, the one or more modified internucleoside linkages are phosphorothioate linkages.

[0028] The present invention also provides an extracellular vesicle comprising an antisense oligonucleotide (ASO), wherein the antisense oligonucleotide is the antisense oligonucleotide described.

[0029] The term "extracellular vesicle" (EV) refers to a cell-derived vesicle comprising a membrane encapsulating an internal space. Extracellular vesicles include all membrane-bound vesicles (e.g., exosomes, nanovesicles) with a diameter smaller than the diameter of the cell from which they are derived. In certain embodiments, the diameter of the extracellular vesicle is in the range of 20nm to 1000nm, and may contain various macromolecular payloads within the internal space (i.e., cavity), displayed on the outer surface of the extracellular vesicle and / or across the membrane.

[0030] As certain embodiments of the present invention, the extracellular vesicles are exosomes.

[0031] The term "exosome" refers to an extracellular vesicle with a diameter between 20-300nm (e.g., between 40-200nm). Exosomes include a membrane that encloses an internal space (i.e., a cavity), and in certain embodiments, can be produced from cells (e.g., production cells) by direct plasma membrane budding or by fusion of late endosomes with the plasma membrane. In certain aspects, exosomes include a scaffold portion. As described below, exosomes may be derived from production cells and separated from production cells based on their size, density, biochemical parameters, or a combination thereof. In certain embodiments, the extracellular vesicles disclosed herein (e.g., exosomes) are produced by cells expressing one or more transgenic products.

[0032] As certain embodiments of the present invention, the extracellular vesicle further comprises an exogenous targeting portion, which targets the extracellular vesicle to the brain. As certain embodiments of the present invention, the extracellular vesicle surface expresses the peptide segment RVG of the acetylcholine receptor. As certain embodiments of the present invention, the extracellular vesicle can cross the blood-brain barrier. For example, patent applications CN 113082042A, CN114259502A, CA3069123A1, which are incorporated herein by reference. As certain embodiments of the present invention, the extracellular vesicle is an exosome that expresses the peptide segment RVG of the acetylcholine receptor on the surface.

[0033] In certain embodiments, EV (e.g., exosomes) include a targeting moiety, such as an exogenous targeting moiety. In certain embodiments, the exogenous targeting moiety includes a peptide, an antibody or its antigen-binding fragment, a chemical compound, an RNA aptamer, or any combination thereof. In certain embodiments, the targeting moiety includes a microprotein, a designed ankyrin repeat protein (darpin), an anticalin, an adnectin, an aptamer, a peptide mimetic molecule, a natural ligand of a receptor, a camelid nanobody, or any combination thereof. In certain embodiments, the exogenous targeting moiety includes a full-length antibody, a single domain antibody, a heavy chain antibody only (VHH), a single chain antibody, a shark heavy chain antibody only (VNAR), scFv, Fv, Fab, Fab', F(ab')2, or any combination thereof. In certain embodiments, the antibody is a single chain antibody. In certain embodiments, the targeting moiety targets the exosome to the liver.

[0034] As certain embodiments of the present invention, the extracellular vesicle further comprises an anchoring moiety, which anchors the antisense oligonucleotide in the extracellular vesicle.

[0035] Anchoring moieties (AM) can be used to anchor the ASO to the extracellular vesicles of the present invention. In certain embodiments, the anchoring moiety (AM) can be one or more. The anchoring moiety can be inserted into the lipid bilayer of an extracellular vesicle (e.g., exosome), thereby allowing the exosome to load the ASO. In certain embodiments, the ASO is directly connected to the anchoring moiety or connected through a linker. In certain embodiments, the anchoring moiety increases the load of the ASO of the present invention in the extracellular vesicle.

[0036] The present invention also provides a pharmaceutical composition, which comprises: a. the antisense oligonucleotide or the extracellular vesicle; and b. a pharmaceutically acceptable diluent, carrier, or salt.

[0037] A pharmaceutical composition refers to a complex composed of two or more drugs or active molecules that achieves the purpose of treating a disease or improving health by acting together or synergistically. The pharmaceutical composition comprises EVs (e.g., exosomes) of the present disclosure having a desired purity and a pharmaceutically acceptable carrier or excipient. The pharmaceutically acceptable excipient or carrier may be determined in part by the specific composition administered and by the specific method used to administer the composition.

[0038] As certain embodiments of the present invention, the pharmaceutical composition further comprises a second therapeutic agent.

[0039] In certain embodiments, the second therapeutic agent is contained in the extracellular vesicle together with the ASO. In certain embodiments, the second therapeutic agent and the ASO are contained in different extracellular vesicles. In certain embodiments, the second therapeutic agent and the ASO are not contained in the extracellular vesicle at the same time. In certain embodiments, the second therapeutic agent and the ASO are administered simultaneously. In certain embodiments, the second therapeutic agent and the ASO are administered one after the other. In certain embodiments, the second therapeutic agent is administered before the ASO. In certain embodiments, the second therapeutic agent is administered after the ASO.

[0040] As certain embodiments of the present invention, the therapeutic agent is selected from agents for treating glioma.

[0041] As certain embodiments of the present invention, the pharmaceutical composition of the present invention is administered by a method selected from intravenous injection, intramuscular injection, subcutaneous injection, rectal perfusion (rectal administration), eye drops, nasal spray or oral spray (inhalation), and can also be administered topically (surface) or systemically (transdermally). The preferred administration method is intravenous injection or subcutaneous injection.

[0042] Examples of carriers or diluents include, but are not limited to, water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. The use of such media and compounds for pharmaceutically active substances is well known in the art. Unless any conventional media or compounds are incompatible with the extracellular vesicles described herein. The carrier or diluent can be selected according to the mode of administration or route of administration.

[0043] As certain embodiments of the present invention, the dosage of the pharmaceutical composition of the present invention is 0.0001 to 5000 mg, which can be selected from 0.0001, 0.0002, 0.0003, 0.0004, 0.0005, 0.0006, 0.0007, 0.0008, 0.0009, 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07 .07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 120 400, 4500, 4600, 4700, 4800, 4900, or 5000 mg.

[0044] As certain embodiments of the present invention, the carrier is selected from aqueous carriers, liposomes, polymers, polypeptides and nanoparticles.

[0045] In certain embodiments, the pharmaceutically acceptable carrier comprises one or more aqueous carriers, liposomes, high molecular weight polymers or polypeptides. In certain embodiments, the aqueous carrier can be, for example, RNase-free water or RNase-free buffer.

[0046] The present invention also provides a commercial kit, which includes the antisense oligonucleotide, the extracellular vesicle or the pharmaceutical composition, and instructions for use, wherein the instructions for use record the administration method and dosage.

[0047] As certain embodiments of the present invention, the commercial kit includes one or more containers filled with one or more ingredients of the pharmaceutical composition described herein (such as one or more exosomes provided herein).

[0048] The present invention also provides a diagnostic kit, which comprises the antisense oligonucleotide (ASO), the extracellular vesicle or the pharmaceutical composition, and instructions for use.

[0049] As certain embodiments of the present invention, the diagnostic kit comprises one or more containers filled with one or more ingredients of the pharmaceutical composition described herein (such as one or more exosomes provided herein).

[0050] As certain embodiments of the present invention, the diagnostic kit of the present invention may also include instructions for use, which record how to use the antisense oligonucleotide (ASO), the extracellular vesicles or the pharmaceutical composition to apply to the sample to be tested, so as to determine whether the subject from which the sample is derived suffers from cancer.

[0051] The present invention also provides a method for reducing or inhibiting the expression of the CREPT gene in cells in vitro, the method comprising: administering the antisense oligonucleotide (ASO), the extracellular vesicle or the pharmaceutical composition to cells expressing the CREPT gene, wherein the expression of the CREPT protein in the cells is reduced or inhibited after administration.

[0052] The present invention also provides a method for reducing the proliferation of glioma cell clones and reducing the invasive ability of glioma cells in vitro, the method comprising: administering the antisense oligonucleotide (ASO), the extracellular vesicles or the pharmaceutical composition to the cancer cells, wherein after administration, the cancer cells reduce the proliferation of clones, promote cancer cell apoptosis, and reduce invasive ability.

[0053] The present invention also provides a method for treating cancer, which comprises: administering the antisense oligonucleotide, the extracellular vesicle or the pharmaceutical composition of the present invention to a patient, or using the commercial drug kit to administer the drug to the patient according to the instructions.

[0054] The present invention also provides the use of the antisense oligonucleotide (ASO), the extracellular vesicle or the pharmaceutical composition, wherein the use is the use in preparing a drug for treating cancer.

[0055] As certain embodiments of the present invention, the cancer is selected from glioma.

[0056] Gliomas are tumors that originate from glial cells in the brain and are the most common primary intracranial tumors in adults. The World Health Organization (WHO) classification of central nervous system tumors divides gliomas into grades I to IV. The higher the grade, the higher the malignancy. Grades I and II gliomas are low-grade gliomas, and grades III and IV are high-grade gliomas. Low-grade gliomas mainly refer to diffuse astrocytomas, oligodendrogliomas, and oligoastrocytomas. High-grade gliomas mainly refer to anaplastic astrocytomas and anaplastic oligodendrogliomas, glioblastomas, and diffuse midline gliomas.

[0057] As certain embodiments of the present invention, the liver cancer includes diffuse astrocytoma, oligodendroglioma, oligoastrocytoma, anaplastic astrocytoma, anaplastic oligodendroglioma, glioblastoma, and diffuse midline glioma.

[0058] As certain embodiments of the present invention, the medicament is administered to a mammal. As certain embodiments of the present invention, the medicament is administered to a human or a mouse.

[0059] As used herein, "administering" means administering a composition comprising EVs (e.g., exosomes) disclosed herein to a subject by a pharmaceutically acceptable route. The route of administration can be an intravenous route, such as intravenous injection and intravenous infusion. Additional routes of administration include, for example, subcutaneous, intramuscular, oral, nasal, and pulmonary administration.

[0060] As described above, the ASO inhibitor of the CREPT gene of the present invention and its inhibition on glioma have the following effects:

[0061] Beneficial effects:

[0062] The oligonucleotides (ASO) screened by the present invention can efficiently and specifically target CREPT and significantly reduce the expression level of CREPT in glioma cells;

[0063] The oligonucleotide (ASO) of the present invention can reduce the clone formation ability of glioma cells, cause obvious cell apoptosis, and cause a significant decrease in the invasion ability of glioma cells;

[0064] The CREPT-targeted ASO of the present invention significantly improves the survival rate of the mouse glioma in situ model and significantly reduces the tumor load of the mouse glioma. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 Shows the expression of CREPT in different glioma cell lines and its effect on cell proliferation. Figure 1 A Western blot was used to detect the expression level of CREPT in different glioma cell lines. Figure 1 B shows the effect of siRNA of CREPT on the proliferation of glioma cells U87. Figure 1 C shows the effect of siRNA of CREPT on the proliferation ability of glioma cells SNB19;

[0066] Figure 2 The present invention is shown to screen oligonucleotides (ASOs) that efficiently and specifically target CREPT, wherein: Figure 2 A Protein blot was used to detect the effect of ASO targeting CREPT on the expression level of CREPT. Figure 2 B shows the effect of ASO targeting CREPT on the clone formation ability of glioma cells LN229. Figure 2 C shows the effect of ASO targeting CREPT on the apoptosis (right) and invasion ability (left) of glioma cells LN229;

[0067] Figure 3 The effect of an oligonucleotide (ASO) specifically targeting CREPT as a single point mutation is shown. Figure 3 A is the single point mutation ASO 14 of CREPT. Figure 3 B. Detect the effect of ASO single point mutation of CREPT on the clone formation ability of glioma cell LN229;

[0068] Figure 4 The results show the effect of oligonucleotide ASO targeting CREPT on orthotopic models of brain glioma in vivo, in which Figure 4 A Western blot was used to detect the effect of 2'-O-methoxyethyl (MOE) modified ASO on the expression level of CREPT; Figure 4 B shows the time chart of tumor cell injection and ASO treatment. Figure 4 B shows the effect of ASO targeting CREPT on orthotopic brain glioma tumor formation; Figure 4 C shows the effect of ASO targeting CREPT on the survival of mouse brain glioma. DETAILED DESCRIPTION

[0069] In order to make the technical means, creative features, objectives and effects of the present invention easy to understand, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0070] [Experimental Materials]

[0071] Glioma cell line LN229 (Wuhan Prosai Life Science Technology Co., Ltd., CL-0578)

[0072] U87MG cells (Wuhan Prosai Life Science Co., Ltd., CL-0238)

[0073] SNB19 (Shanghai Yaji Biotechnology Co., Ltd., YS1320)

[0074] Mice (Beijing Weitonglihua, Balb / c-null)

[0075] Isoflurane (R510-22-10, Rewodlife Technology Co., Ltd.)

[0076] Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific, 2455799)

[0077] Brain stereotaxic instrument (Rayward, R540)

[0078] Suture needle 5-0 (Ningbo Medical Suture Needle Co., Ltd., 230828)

[0079] microCT (Tsinghua University Instrument Sharing Platform, A18000014)

[0080] Small animal in vivo imaging system (Tsinghua University Instrument Sharing Platform, LuminaⅢ)

[0081] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0082] Example 1

[0083] The role of CREPT in treating brain glioma

[0084] In order to explore the biological function of CREPT in glioma, we first detected the expression level of CREPT in different glioma cell lines. Based on the expression level of CREPT in normal mesenchymal stem cells, we found that the expression level of CREPT in most glioma cells was higher than that in normal tissues, especially in LNN229 cells and U87MG cells. It is worth noting that the expression level of CREPT in SNB19 cells was lower ( Figure 1 A). Next, the applicant tested the effect of CREPT on cell proliferation and found that knocking down CREPT significantly reduced the proliferation rate of U87MG cells ( Figure 1 B), but had little effect on the proliferation of the CREPT low-expressing cell line SNB19 ( Figure 1 C), which fully demonstrates that CREPT plays an important role in glioma proliferation.

[0085] Screening of ASO sequences that can inhibit the proliferation of brain glioma

[0086] In order to screen oligonucleotides (ASOs) that efficiently and specifically target CREPT, 141 ASO sequences that can specifically target CREPT from the full-length sequence of 5'UTR to 3'UTR were designed based on the CREPT transcript in NCBI. These sequences were tested to see if they could reduce CREPT expression at the protein level. Western blotting experiments showed that up to 47 ASOs significantly reduced the expression level of CREPT in glioma cells ( Figure 2 A), cloning experiments showed that ASO targeting CREPT can reduce the cloning ability of glioma cells ( Figure 2 B). It was also observed that ASO targeting CREPT caused obvious cell apoptosis compared with the control group ( Figure 2 B, upper figure). At the same time, targeting CREPT expression through ASO also led to a significant decrease in the invasive ability of glioma cells ( Figure 2 C, lower figure). Through preliminary experiments, systematic screening identified oligonucleotides that can specifically target CREPT.

[0087] Example 2

[0088] In order to screen oligonucleotides (ASOs) that efficiently and specifically target CREPT, 72 ASO sequences that can specifically target the CREPT RNA sequence from the full-length sequence of 5'UTR to 3'UTR were designed based on the CREPT transcript in NCBI. Among them, the nucleotide sequences of ASO14, ASO43, ASO46, ASO71, and ASO72 are shown in SEQ ID No. 1 to 5 in Table 1, respectively, and ASO-Ctrl is a random sequence as a control group.

[0089] First, we tested whether these ASOs could reduce CREPT expression at the protein level: when the density of LN229 glioma cells was about 40% during the growth period, different ASO sequences were transfected into LN229 glioma cells using Lipofectamine 2000 transfection reagent. The working concentration of the ASO sequence was 50 nM and the cells were treated for three days. After three days, bright field photography was performed to observe cell growth and death, and then protein lysate was extracted for protein immunoblotting experiments.

[0090] The results showed that up to 25 ASOs significantly reduced the expression level of CREPT in glioma cells ( Figure 2 A), and the ASO-treated cells were subjected to cell cloning experiments. The results showed that ASO targeting CREPT could significantly reduce the cloning ability of glioma cells ( Figure 2 B). It was also observed that ASO targeting CREPT caused obvious cell apoptosis compared with the control group ( Figure 2 B) and the statistics of the decline of cells after apoptosis ( Figure 2 C, right).

[0091] In order to verify the specificity of the screened CREPT ASO, the applicant randomly selected ASO 14# and 43# for single-point mutation ( Figure 3 A), and the ASO-treated cells were subjected to cell cloning experiments. The results showed that the ASO NC group significantly reduced the cloning of glioma cells. When ASO 14# and ASO 43# were mutated at a single point, the mutated ASO lost its inhibitory effect on the cloning of glioma cells ( Figure 3 B). It can be seen that the base T at position 5 of ASO 14 and the base A at position 10 of ASO 43 are critical for the inhibition of glioma cell colony formation.

[0092] Table 1 ASO sequences and numbers

[0093] ASO number sequence Sequence number ASO14 CAGCTGCTGTATGAACTCGC SEQ ID No.1 ASO43 GACAGAACGACAGGCAGTGT SEQ ID No.2 ASO46 CAGTGACAGAACGACAGGCA SEQ ID No.3 ASO71 GGGCGGAAGAAGGGATAGAA SEQ ID No.4 ASO72 GTTCGAGTTTAGCCACCGTA SEQ ID No.5 ASO-Ctrl GGGGAAACCCCTTTCACT SEQ ID No.6

[0094] Example 3

[0095] Effect of CREPT ASO on orthotopic brain glioma model in mice

[0096] Five of them were modified with 2'-O-methoxyethyl (MOE) and thiophosphate (PS) bonds to further regulate the stability of ASO in vivo. It was found that ASO-CREPT#72 had a significant inhibitory effect on CREPT expression ( Figure 3A), by establishing an orthotopic glioma model, after administration on the seventh day of tumor formation, the applicant found that ASO-72# significantly inhibited the growth of glioma and increased the survival rate of mice ( Figure 4 BC). These results fully demonstrate that CREPT is an important target for the treatment of glioma.

[0097] At the same time, the effect of CREPT's ASO inhibitor on glioma cell proliferation was also verified by the glioma in situ model. The experiment was as follows: the animals were taken out of the barrier of the first-stage mouse room and placed in a special anesthesia instrument for anesthesia. The anesthetic was isoflurane, and the dose was maintained at a concentration of 1-1.5%. The anesthetized mice were fixed in the brain stereotaxic instrument. First, the upper incisors of the mice were inserted into the crossbar, and the ear bars were inserted into the mouse ear canals. After ensuring that the scale positions of the left and right ear bars were the same, the knobs were adjusted to lock the ear bars. Next, ophthalmic scissors were used to cut the skin of the rat's head longitudinally for about 3 cm, and the periosteum connective tissue was peeled off and cut off along the surface of the skull with tweezers. The blood was dipped with sterile cotton balls, and the surface of the skull was cleaned to expose the front and back brains. Then the punching points were marked at the punching positions, and the holes were slowly punched with a hand drill. The punching was stopped when there was a sense of failure. Then, a microsyringe was used to slowly inject glioma cells and their ASO inhibitor-ASO72#. After the injection, the syringe was kept for one minute to ensure that the cells were completely injected. The incision was then closed with medical adhesive. After the operation, the animal was placed on a warming pad and its breathing was observed. After the animal woke up, it was placed in a designated room and raised normally.

[0098] The results showed that targeting CREPT expression through ASO also led to a significant decrease in the invasive ability of glioma cells ( Figure 4 B) Through in vivo imaging experiments, the applicant systematically screened and identified oligonucleotides that can specifically target CREPT. The inhibitory effect of ASO greatly reduced the tumor volume and even no tumor signal was detected.

[0099] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment as above, it is not used to limit the present invention. Any technician familiar with this profession can make some changes or modifications to equivalent embodiments of equivalent changes by using the methods and technical contents disclosed above without departing from the scope of the technical solution of the present invention. However, any simple modification, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. An antisense oligonucleotide (ASO), characterized in that The antisense oligonucleotide is complementary to the CREPT gene sequence and can effectively inhibit the expression of CREPT; the antisense oligonucleotide is selected from the antisense oligonucleotide having a nucleotide sequence as shown in any one of SEQ ID No. 1 to 5.

2. The antisense oligonucleotide according to claim 1, characterized in that The antisense oligonucleotide further comprises one or more nucleoside analogs; Or, the antisense oligonucleotide further comprises one or more 5'-methyl-cytosine nucleobases; Alternatively, the contiguous nucleotide sequence of the antisense oligonucleotide comprises one or more modified internucleoside linkages.

3. The antisense oligonucleotide according to claim 1, characterized in that One or more of the nucleoside analogs include 2'-O-alkyl-RNA; 2'-O-methyl RNA (2'-OMe); 2'-alkoxy-RNA; 2'-O-methoxyethyl-RNA (2'-MOE); 2'-amino-DNA; 2'-fluoro-RNA; 2'-fluoro-DNA; arabinoic acid (ANA); 2'-fluoro-ANA; or a bicyclic nucleoside analog; Preferably, one or more of the nucleoside analogs is a sugar-modified nucleoside; More preferably, the sugar-modified nucleoside is an affinity-enhancing 2' sugar-modified nucleoside; or, one or more of the nucleoside analogs comprises LNA; More preferably, one or more of the nucleotide analogs are selected from the group consisting of constrained ethyl nucleosides (cEt), 2',4'-constrained 2'-O-methoxyethyl (cMOE), α-L-LNA, β-D-LNA, 2'-O,4'-C-ethylene-bridged nucleic acid (ENA), amino-LNA, oxy-LNA, thio-LNA and any combination thereof; Alternatively, the one or more modified internucleoside linkages are phosphorothioate linkages.

4. An extracellular vesicle comprising an antisense oligonucleotide (ASO), characterized in that The antisense oligonucleotide is the antisense oligonucleotide according to any one of claims 1 to 3; Preferably, the extracellular vesicles are exosomes; Preferably, the extracellular vesicle further comprises an exogenous targeting moiety, which targets the extracellular vesicle to the liver; Preferably, the extracellular vesicle further comprises an anchoring portion, which anchors the antisense oligonucleotide in the extracellular vesicle; Preferably, the surface of the extracellular vesicle expresses the peptide segment RVG of the acetylcholine receptor; Preferably, the extracellular vesicles are exosomes expressing the peptide segment RVG of acetylcholine receptor on the surface.

5. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises: a. The antisense oligonucleotide according to any one of claims 1 to 3, or the extracellular vesicle according to claim 4; and b. a pharmaceutically acceptable diluent, carrier, or salt; Preferably, the pharmaceutical composition further comprises a second therapeutic agent; Preferably, the second therapeutic agent is selected from agents for treating glioma; Preferably, the carrier is selected from aqueous carriers, liposomes, polymers, polypeptides and nanoparticles.

6. A commercial kit, characterized in that The medicine kit comprises the antisense oligonucleotide according to any one of claims 1 to 3, the extracellular vesicle according to claim 4 or the pharmaceutical composition according to claim 5, and instructions for use.

7. A diagnostic kit, characterized in that The diagnostic kit comprises the antisense oligonucleotide (ASO) according to any one of claims 1 to 3, the extracellular vesicle according to claim 4 or the pharmaceutical composition according to claim 5, and instructions for use.

8. A method for reducing or inhibiting CREPT gene expression in cells in vitro, characterized in that: The method comprises: administering the antisense oligonucleotide (ASO) according to any one of claims 1 to 3, the extracellular vesicle according to claim 4, or the pharmaceutical composition according to claim 5 to cells expressing the CREPT gene, wherein the expression of the CREPT protein in the cells is reduced or inhibited after administration.

9. A method for reducing the proliferation of glioma cell clones and reducing the invasive ability of glioma cells in vitro, characterized in that: The method comprises: administering the antisense oligonucleotide (ASO) according to any one of claims 1 to 3, the extracellular vesicle according to claim 4, or the pharmaceutical composition according to claim 5 to the cancer cells, wherein after administration, the cancer cells reduce clone proliferation, promote cancer cell apoptosis, and reduce invasive ability.

10. Use of the antisense oligonucleotide (ASO) according to any one of claims 1 to 3, the extracellular vesicle according to claim 4, or the pharmaceutical composition according to claim 5, characterized in that: The application is application in the preparation of drugs for treating cancer; Preferably, the cancer is selected from glioma; Preferably, the glioma liver cancer includes diffuse astrocytoma, oligodendroglioma, oligoastrocytoma, anaplastic astrocytoma, anaplastic oligodendroglioma, glioblastoma, and diffuse midline glioma; Preferably, the medicament is administered to a mammal; Preferably, the medicament is administered to humans and mice.

Images