UTR element and application thereof

Abstract

The invention discloses an UTR (Untranslated Region) element and application thereof. The UTR element is selected from a 3 'UTR sequence as shown in SEQ ID NO.7 or 8. The UTR element can prolong the expression and stability of mRNA (Messenger Ribonucleic Acid) and remarkably improve the immune effect of a vaccine.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a UTR element and application thereof. Background Art

[0002] UTR (untranslated region) is the region of the mRNA molecule that does not encode proteins, and is divided into 5'UTR and 3'UTR. The 5'UTR is located at the 5' end of the mRNA and contains promoter elements, which helps the binding of ribosomes to mRNA and the initiation of translation, while the 3'UTR is located at the 3' end and contains regulatory elements that affect the stability, transport and degradation of mRNA. In the field of mRNA, UTR has an important impact on the stability and translation efficiency of mRNA.

[0003] However, there are some disadvantages of UTR in the prior art. First, the translation efficiency is unstable, and certain UTR sequences may lead to low translation efficiency and affect the protein expression level. Secondly, the problem of mRNA stability, certain sequences of 3'UTR may be detrimental to the stability of mRNA, leading to rapid degradation. In addition, UTR sequences may be immunogenic. All of the above factors may affect the therapeutic effect or safety of mRNA drugs. In addition, the use of UTR to achieve cell-specific expression, solve the difficulties in mRNA sequence optimization, mRNA production and purification challenges, and off-target effects are also problems faced by existing UTR technology.

[0004] To overcome these shortcomings, the present invention develops new UTRs to improve the efficiency and safety of mRNA therapy. Summary of the invention

[0005] In order to overcome the above shortcomings, the present invention provides a UTR element that can prolong the expression and stability of mRNA and significantly improve the immune effect of the vaccine.

[0006] In one aspect, the present invention provides a UTR element, wherein the UTR element comprises a 3'UTR selected from the following group:

[0007] 1) a 3'UTR having a nucleotide sequence as shown in SEQ ID NO: 7 or 8;

[0008] 2) having a 3'UTR with a homology of ≥80% to the nucleotide sequence shown in SEQ ID NO: 7 or 8; or,

[0009] 3) A 3'UTR having 1-20 nucleotides added to the 5' end and / or 3' end of the nucleotide sequence as shown in SEQ ID NO: 7 or 8, and / or having 1-20 nucleotides reduced.

[0010] The sequence identity of UTR (Untranslated Region) refers to the similarity or consistency in sequence of UTR regions of different species or different genes.

[0011] In some embodiments, the UTR element comprises a 3'UTR selected from a sequence having a homology ≥81% (preferably ≥85%, more preferably ≥90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) to the sequence shown in SEQ ID NO:7 or 8.

[0012] In some embodiments, the UTR element comprises a 3'UTR selected from the 5' end and / or the 3' end having the nucleotide sequence as shown in SEQ ID NO: 7 or 8 with 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 or 1 nucleotides added to the 5' end and / or the 3' end.

[0013] In some embodiments, the UTR element comprises a 3'UTR selected from a nucleotide sequence as shown in SEQ ID NO: 7 or 8 with 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 or 1 nucleotides less at the 5' end and / or 3' end.

[0014] In some embodiments, the UTR element comprises a nucleotide sequence selected from the group consisting of a nucleotide sequence as shown in SEQ ID NO: 7 or 8 with 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 or 1 nucleotides added to the 5' end; and a 3'UTR with 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 or 1 nucleotides reduced at the 3' end.

[0015] In some embodiments, the UTR element comprises a nucleotide sequence selected from the group consisting of a nucleotide sequence as shown in SEQ ID NO: 7 or 8 with 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 or 1 nucleotides less at the 5' end; and a 3'UTR with 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 or 1 nucleotides more at the 3' end.

[0016] In some embodiments, the UTR element further comprises a 5'UTR, the nucleotide sequence of the 5'UTR being selected from the group consisting of:

[0017] 1) the nucleotide sequence shown in any one of SEQ ID NOs: 1-6;

[0018] 2) a nucleotide sequence having a homology of ≥ 80% with the sequence shown in any one of SEQ ID NOs: 1-6; or,

[0019] 3) A nucleotide sequence having 1 to 20 nucleotides added to and / or 1 to 20 nucleotides removed from the 5' end and / or 3' end of the nucleotide sequence as shown in any one of SEQ ID NOs: 1-6.

[0020] In some embodiments, the nucleotide sequence of the 5'UTR is selected from a nucleotide sequence having a homology ≥81% (preferably ≥85%, more preferably ≥90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) to the sequence shown in any one of SEQ ID NOs: 1-6.

[0021] In some embodiments, the nucleotide sequence of the 5'UTR is selected from a nucleotide sequence having 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 or 1 nucleotides added to the 5' end and / or 3' end of the nucleotide sequence shown in any one of SEQ ID NOs: 1-6.

[0022] In some embodiments, the nucleotide sequence of the 5'UTR is selected from a nucleotide sequence having 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 or 1 nucleotides less at the 5' end and / or 3' end of the nucleotide sequence shown in any one of SEQ ID NOs: 1-6.

[0023] In some embodiments, the nucleotide sequence of the 5'UTR is selected from a nucleotide sequence having 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 or 1 nucleotides added to the 5' end of the nucleotide sequence as shown in any one of SEQ ID NOs: 1-6; and a nucleotide sequence having 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 or 1 nucleotides reduced at the 3' end.

[0024] In some embodiments, the nucleotide sequence of the 5'UTR is selected from a nucleotide sequence as shown in any one of SEQ ID NOs: 1-6, wherein the 5' end is reduced by 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 or 1 nucleotides; and the 3' end is increased by 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 or 1 nucleotides.

[0025] Another aspect of the present invention provides a biological element, wherein the biological element comprises the UTR element provided by the present invention; the biological element is any one of the following:

[0026] a) mRNA transcription template construct;

[0027] b) a carrier; and,

[0028] c) reporter gene system; and,

[0029] d) Nucleic acid bioproduction plasmid template.

[0030] The ribonucleic acid (RNA) molecule used according to the present invention relates to a polymer molecule assembled into a chain of nucleotides called G, A, U and C. Each nucleotide in RNA contains ribose, and carbon is numbered 1' to 5'. Nitrogenous bases are connected to the 1' position, usually, adenine (A), cytosine (C), guanine (G) or uracil (U). In polymer RNA molecules, a phosphate group is connected to the 3' position of a ribose and the 5' position of the next ribose. Therefore, the nucleotides in the polymer RNA molecule are covalently linked to each other, wherein the phosphate group from a nucleotide is combined with the 3' carbon on the subsequent nucleotide to form a phosphodiester bond. Therefore, the RNA chain has a 5' end and a 3' end, which are named for the carbon on the ribose ring. By convention, upstream and downstream relate to the 5' to 3' direction in which RNA transcription occurs. mRNA is a large family of RNA molecules, which transmits genetic information from DNA to ribosomes, where they specify the amino acid sequence of the protein product of gene expression. After transcription of the primary transcript mRNA (called pre-mRNA) by RNA polymerase, the processed mature mRNA is translated into a polymer of amino acids: proteins, as outlined in the central dogma of molecular biology. As in DNA, the mRNA genetic information is in a sequence of nucleotides, which are arranged into codons, each consisting of three bases. Each codon encodes a specific amino acid, except for the stop codon that terminates protein synthesis.

[0031] An mRNA transcription template construct containing a 3'UTR (downstream untranslated region) is a synthetic mRNA molecule designed in molecular biology to express a specific protein. This construct contains a sequence for encoding the target protein and some additional elements, including the 3'UTR.

[0032] An mRNA transcription template construct is a synthetic DNA template used to generate mRNA via a transcription process in vitro. This construct typically includes the following:

[0033] Promoter: A DNA sequence that initiates the transcription of mRNA. In mammalian cells, commonly used promoters include the human cytomegalovirus promoter (HCMV) or the rabbit β-globin promoter.

[0034] 3'UTR: An untranslated region located downstream of the coding sequence that may contain sequences that regulate mRNA stability and degradation. As used in the present invention, a 3'UTR may contain regulatory regions within the 3' untranslated region that are known to affect polyadenylation and stability of mRNA. Many 3'UTRs also contain AU-rich elements (AREs).

[0035] Coding sequence (ORF) or coding region, the coding sequence of the target protein, which will be transcribed into mRNA and translated into protein in the cell.

[0036] The polyA tail (polyadenylation signal) is a sequence used to add a string of adenylic acids (poly(A) tail) to the 3' end of the mRNA, which helps in the stability and translation of the mRNA.

[0037] In mRNA molecules, the 5'UTR is a non-coding region located upstream of the coding sequence (i.e., open reading frame, ORF). This region has an important influence on the stability and translation efficiency of mRNA. In eukaryotes, the 5'UTR usually contains some regulatory elements, such as a cap structure (5'cap), which helps the initiation of translation of mRNA.

[0038] 5'UTR: Located between the promoter and the coding sequence, it can affect the stability and translation efficiency of mRNA. 5'UTR can be extracted from natural genes or artificially designed. As used in the present invention, 5'UTR (5' untranslated region) (also called leader sequence or leader RNA) is the region of mRNA directly upstream of the start codon. 5'UTR starts at the transcription start site and ends one nucleotide (nt) before the start codon (usually AUG) of the coding region. In prokaryotes, the length of 5'UTR is often 3-10 nucleotides long, while in eukaryotes it is often longer, generally from 100 to several thousand nucleotides long, but sometimes shorter UTRs also appear in eukaryotes.

[0039] In some embodiments, the 5'UTR has a nucleotide sequence as shown in SEQ ID NO:9.

[0040] In some embodiments, the mRNA transcription template construct further comprises one or more of a promoter element, a coding region, and a polyA tail element.

[0041] In some embodiments, the order of elements in the mRNA transcription template construct from the 5' end to the 3' end is: promoter element, 5'UTR, coding region, 3'UTR and PolyA tail.

[0042] The vector of the present invention may be, for example, a plasmid, a cosmid, a virus, a phage or another vector conventionally used in genetic engineering, and may contain additional genes such as a marker gene which allows selection of the vector in a suitable host cell and under suitable conditions.

[0043] In addition, the vector of the present invention can also be an expression vector. The nucleic acid molecules and vectors of the present invention can be designed to be introduced directly or introduced into cells via liposomes, viral vectors (e.g., adenovirus, retrovirus), electroporation, ballistics (e.g., gene gun) or other delivery systems. In addition, the baculovirus system can be used as a eukaryotic expression system for the nucleic acid molecules of the present invention.

[0044] In some embodiments, the vector is an expression vector or a cloning vector; the vector is a virus or a plasmid.

[0045] In some embodiments, the vector is pUC-Kan-TMA.

[0046] In some embodiments, the nucleic acid bioprep plasmid template comprises one or more of a promoter, a coding region, and a terminator.

[0047] In addition to the sequence of the nucleic acid molecule encoding the mRNA molecule of the present invention, the vector of the present invention can also include expression control elements, allowing the correct expression of the coding region in a suitable host. Such control elements are well known to those skilled in the art, and can include promoters, splicing boxes, translation initiation codons, translation and insertion sites for introducing inserts into the vector. Preferably, the nucleic acid molecule of the present invention is operably connected to the expression control sequence that allows expression in eukaryotic or prokaryotic cells. Therefore, the present invention relates to a vector comprising the nucleic acid molecule of the present invention, wherein when transfecting eukaryotic and / or prokaryotic (host) cells with a vector, the nucleic acid molecule is operably connected to a control sequence that is recognized by the host cell.

[0048] In some embodiments, the polyA has a nucleotide sequence as shown in SEQ ID NO:16.

[0049] The control elements ensuring expression in eukaryotic and prokaryotic (host) cells are well known to the person skilled in the art. As mentioned above, they usually comprise regulatory sequences ensuring the initiation of transcription and optionally a polyadenylation signal ensuring the termination of transcription and stabilization of the transcript.

[0050] However, according to the present invention, it is not important that the vector itself contains the sequence of the poly(A) tail. As mentioned above, if the mRNA molecule of the present invention is produced by an in vitro transcription method further described herein below, the above poly(A) tail is part of the construct of the present invention (and not necessarily initially located on the cloning vector) and is located at the 3' end of the RNA, adjacent to the UTR at the 3' end of the RNA construct. If the RNA molecule of the present invention is produced by an in vitro transcription method, the plasmid containing the RNA molecule of the present invention is linearized prior to in vitro transcription downstream of the poly(A) tail to ensure that the RNA molecule transcribed in vitro contains the poly(A) tail.

[0051] The reporter gene system containing the 3' untranslated region (3'UTR) is an experimental tool that combines the 3'UTR sequence with a reporter gene (such as fluorescent protein or β-galactosidase) and clones it into an expression vector to study how the 3'UTR affects the stability and translation efficiency of mRNA, thereby revealing the gene expression regulation mechanism, promoter activity, translation efficiency and the role of intracellular signaling pathways.

[0052] In some embodiments, the reporter gene system further comprises one or more of a promoter, an expression vector, a reporter gene, and a regulatory element.

[0053] Regulatory elements may include transcriptional and translational enhancers, and / or naturally associated or heterologous promoter regions. Such regulatory elements may also include enhancers or silencers, which are key regulatory elements for gene expression, wherein enhancers such as immunoglobulin enhancers, enhancers in HIV LTR, muscle-specific enhancers, glucocorticoid receptor response elements (GREs) and thyroid hormone receptor response elements (TREs) can enhance gene expression, while silencers such as HIV silencers, lactose operon silencers, thyroid hormone receptor silencers, vitamin D receptor silencers and Mad / Max silencer elements can inhibit gene expression.

[0054] The promoter comprises CMV-HSV thymidine kinase promoter, SV40, RSV promoter (Rous sarcoma virus), human elongation factor 1α promoter, glucocorticoid-induced MMTV promoter (mouse mammary tumor virus), metallothionein- or tetracycline-inducible promoter or enhancer, such as CMV enhancer or SV40-enhancer. The promoter is known in the art and is described in Charron, J. Biol. Chem. 270 (1995), 25739-25745. For expression in prokaryotic cells, many promoters have been described, including, for example, tac-lac promoter or trp promoter.

[0055] In this context, expression vectors are known in the art, such as the Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pRc / CMV, pcDNA1, pcDNA3 (In-vitrogene), pSPORT1 (GIBCO BRL), pX (Pagano, Science 255 (1992), 1144-1147), yeast two-hybrid vectors such as pEG202 and dpJG4-5 (Gyuris, Cell 75 (1995), 791-803) or prokaryotic expression vectors such as λgt11 or pGEX (Amersham-Pharmacia).

[0056] In some embodiments, the promoter is, for example, a T7 promoter, an SV40 promoter, a CMV promoter, or a GRE promoter.

[0057] In some embodiments, the reporter gene is, for example, green fluorescent protein, luciferase, β-galactosidase, alkaline phosphatase, or anthocyaninase.

[0058] In some embodiments, the regulatory element is, for example, an enhancer or a silencer.

[0059] Another aspect of the present invention provides a transformant, which comprises the UTR element provided by the present invention or the host cell of the biological element provided by the present invention.

[0060] The present invention relates to a host transfected or transformed with a vector of the present invention or a non-human host carrying a vector of the present invention, i.e., a host cell or a host, which is usually genetically modified with a nucleic acid molecule according to the present invention or a vector comprising such a nucleic acid molecule. The term "genetic modification" refers to a host cell or a host comprising a nucleic acid molecule or a vector according to the present invention in addition to its natural genome, which is introduced into a cell or a host or one of its predecessors / parents. The nucleic acid molecule or the vector can be an independent molecule outside the genome, preferably present in a genetically modified host cell or a host as a molecule capable of replication, or it can be stably integrated into the genome of the host cell or the host. Transformation of host cells with a vector according to the present invention can be carried out by standard methods, such as Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA; Methods in Yeast Genetics, A Laboratory Course Manual, Cold Spring Harbor Laboratory Press, described in 1990. The host cells are cultivated in a nutrient medium that meets the requirements of the specific host cells used, in particular with regard to pH, temperature, salt concentration, aeration, antibiotics, vitamins, trace elements, etc.

[0061] Host cells of the present invention can be any prokaryotic or eukaryotic cells. Suitable prokaryotic cells are those commonly used for cloning, such as Escherichia coli or Bacillus subtilis. In addition, eukaryotic cells include, for example, fungi or animal cells. The example of suitable fungal cells is yeast cells, preferably those of the genus Saccharomyces, most preferably those yeast cells of Saccharomyces cerevisiae. Suitable animal cells are, for example, insect cells, vertebrate cells, preferably mammalian cells, such as, for example, HEK293, NSO, CHO, COS-7, MDCK, U2-OSHela, NIH3T3, MOLT-4, Jurkat, PC-12, PC-3, IMR, NT2N, Sk-n-sh, CaSki, C33A. Other suitable cell lines known in the art can be obtained from cell line collections, such as Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ) or American Type Culture Collection (ATCC). According to the present invention, it is further envisioned that primary cells / cell cultures can act as host cells. The cells are particularly derived from insects (such as insects of the species Drosophila or Blattella) or mammals (such as humans, pigs, mice or rats). The host cells may also comprise cells from and / or derived from cell lines such as neuroblastoma cell lines. The primary cells mentioned above are well known in the art and particularly include primary astrocytes, (mixed) spinal cultures or hippocampal cultures.

[0062] In some embodiments, the host cell is a prokaryotic cell or a eukaryotic cell.

[0063] In some embodiments, the host cell is selected from a yeast cell or a mammalian cell; the mammalian cell is, for example, a HEK293 cell.

[0064] Another aspect of the present invention provides a method for optimizing mRNA, the method comprising the steps of:

[0065] (i) culturing the transformant provided by the present invention to obtain a culture containing a vector of an mRNA transcription template construct;

[0066] (ii) isolating and / or recovering the vector in (i) from the culture, and linearizing it with enzymes to form an mRNA transcription template;

[0067] (iii) transcribing the mRNA transcription template described in step (ii) to obtain optimized mRNA.

[0068] In some embodiments, the method further comprises the step of purifying and / or modifying the optimized mRNA obtained in step (iii).

[0069] The present invention also relates to a method for producing the RNA molecules of the present invention by culturing a host cell comprising an expression vector encoding the individual modules of the present invention or the entire RNA molecule of the present invention in a culture medium and recovering the RNA molecule from the host cell or the culture medium. The present invention also relates to a method for producing the RNA molecules of the present invention, comprising culturing the host cell of the present invention and optionally recovering the RNA molecules from the culture. Methods for recovering and / or subsequently purifying the RNA molecules of the present invention are known to those skilled in the art.

[0070] Another aspect of the present invention provides optimized mRNA, which is prepared by the method provided by the present invention.

[0071] As used herein, 3'UTR (3' untranslated region) refers to the portion of the messenger RNA (mRNA) that immediately follows the translation stop codon. The mRNA molecule is transcribed from the DNA sequence and then translated into protein. Several regions of the mRNA molecule are not translated into protein, including the 5' cap, 5'UTR, 3'UTR, and PolyA tail.

[0072] In some embodiments, the optimized mRNA further comprises one or more of a 5'UTR and a polyA tail element.

[0073] In some embodiments, the mRNA comprises mRNA encoding a RABV-G protein.

[0074] In some embodiments, the amino acid sequence of the RABV-G protein is shown in SEQ ID NO:21.

[0075] In some embodiments, the sequence of the mRNA encoding the RABV-G protein is shown as SEQ ID NO:28.

[0076] mRNA can be chemically modified in a variety of ways, including 5' cap structure, nucleotide modifications (such as N1-methylpseudouridine, 5-methylcytidine, 2'-O-methylated nucleotides, pseudouridine, locked nucleotides), 3' end poly A tail modification, unnatural bases, backbone modifications, and conjugation with lipid nanoparticles to improve its stability and translation efficiency, reduce immunogenicity, and facilitate intracellular delivery.

[0077] The present invention provides an mRNA vaccine against RABV-G, wherein the mRNA vaccine comprises the mRNA of the present invention.

[0078] Another aspect of the present invention provides use of the UTR element, the biological element or the transformant provided by the present invention in optimizing mRNA.

[0079] Another aspect of the present invention provides a drug-loaded lipid nanoparticle, wherein the lipid nanoparticle comprises the optimized mRNA provided by the present invention.

[0080] In some embodiments, the lipid nanoparticles further comprise one or more of cationic lipids, ionizable lipids, helper lipids, cholesterol and its derivatives, lipid polymer complexes, and PEG lipids and their derivatives.

[0081] In some embodiments, PEG lipid, also known as PEG-lipid or polyethylene glycol-lipid, is a complex molecule used in drug delivery and biomedical research, which consists of two parts: polyethylene glycol (PEG) and lipid.

[0082] In some embodiments, the lipid nanoparticles are used to encapsulate and protect mRNA.

[0083] In some embodiments, the helper lipid is a phospholipid derivative.

[0084] In some embodiments, the lipid nanoparticles comprise 30 mol% to 90 mol% of cationic / ionizable lipids; 0 mol% to 20 mol% of phospholipids; 30 mol% to 50 mol% of cholesterol and its derivatives; and 0 mol% to 5 mol% of PEG lipids.

[0085] In some embodiments, the cationic lipid comprises one or more of hydroiodic acid, 1,2-dilinoleyl-3-dimethylammonium, 1,2-dilinoleyl-3-[(N,N-dimethylamino)ethylamino]propan-1-ol, N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium, 1,2-dioleoyl-sn-glycero-3-trimethylammonium, N,N-dioleoyl-1,3-propanediammonium, N-[1-(2,3-dioleoyloxy)propyl]-N,N-dimethylglycine, N-[1-(2,3-dioleoyloxy)propyl]-N,N-dimethylethylene glycol, dodecylamine, octadecylamine, octadecylphosphoric acid, polyethylene glycol-200-dodecyl ether, polyethylene glycol-200-octadecyl ether, and 2-[(2-aminoethyl)amino]ethanol.

[0086] In some embodiments, the phospholipids include 1,2-distearoyl-sn-glycero-3-phosphocholine, 1,2-dilinoleoyl-sn-glycero-3-phosphocholine, 1,2-dimyristoyl-sn-glycero-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphocholine, 1,2-dipalmitoyl-sn-glycero-3-phosphocholine, 1,2-distearoyl-sn-glycero -3-phosphocholine, 1,2-di-undecanoyl-sn-glycero-phosphocholine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine, 1,2-di-0-octadecenyl-sn-glycero-3-phosphocholine, 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine, 1-hexadecyl-sn-glycero-3-phosphocholine, 1,2-dilinolenoyl The invention can be selected from the group consisting of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine, and one or more of sphingomyelin.

[0087] In some embodiments, the cholesterol and its derivatives include one or more of cholesterol, steroids, sitosterol, ergosterol, campesterol, stigmasterol and brassicasterol.

[0088] In some embodiments, the PEG lipid comprises one or more of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol; the PEG-modified diacylglycerol is, for example, PEG-DMG-2000.

[0089] In some embodiments, the lipid nanoparticles comprise lipids, DSPC, cholesterol, and PEG-DMG.

[0090] In some embodiments, the lipid nanoparticles comprise 47 mol% ALC-0315 lipids, 10 mol% DSPC, 41.5 mol% cholesterol, and 1.5 mol% PEG-DMG.

[0091] In some embodiments, the lipid nanoparticle is mRNA-LNP.

[0092] In some embodiments, the mRNA-LNP is prepared by the following steps:

[0093] 1) 47 mol% ALC-0315 lipid was mixed with 10 mol% DSPC, 41.5 mol% cholesterol and 1.5 mol% PEG-DMG and dissolved in an ethanol solution;

[0094] 2) Dissolve the mRNA in a pH 4.0 citrate or acetate buffer as the aqueous phase. When mixing in the microfluidic device, the ratio of the aqueous phase to the alcohol phase is controlled to be 3:1;

[0095] 3) After preparation by rapid mixing, the ethanol content in the mRNA-LNP is reduced and dispersed into the target buffer by ultrafiltration tube (100 kDa) or tangential flow filtration (TFF) equipment.

[0096] In some embodiments, the molar ratio of ionizable lipid molecules to bases in the mRNA solution is defined as the N / P ratio. In some embodiments, the N / P ratio is 6:1.

[0097] In some embodiments, the mRNA used is an mRNA encoding RABV-G in which each uridine is replaced with N1-methylpseudouridine.

[0098] On the other hand, the present invention provides a pharmaceutical composition, which comprises one or more of the UTR element, the biological element, the transformant, the optimized mRNA or the lipid nanoparticle provided by the present invention, and an optional excipient or pharmaceutically acceptable carrier.

[0099] Another aspect of the present invention provides a kit, which comprises one or more of the UTR element, the biological element, the transformant, the optimized mRNA, the lipid nanoparticle and the pharmaceutical composition provided by the present invention.

[0100] In some embodiments, the kit further comprises one or more of a lipid, a polymer delivery system, an inorganic nanoparticle, an exosome, a viral vector, and a polypeptide.

[0101] The addition of additional lipids to lipid nanoparticles can enhance their stability, encapsulation efficiency, regulate particle size, increase affinity with target cells, control drug release, improve in vivo distribution, reduce toxicity, and increase functionality, thereby improving the efficiency and safety of drug delivery and gene therapy.

[0102] The lipid is one or more of cationic lipids, ionizable lipids, auxiliary lipids, cholesterol and its derivatives, lipid polymer complexes and PEG lipids and their derivatives.

[0103] Another aspect of the present invention provides use of the UTR element, the biological element, the transformant, the optimized mRNA or the lipid nanoparticle provided by the present invention in the preparation of mRNA drugs.

[0104] Another aspect of the present invention provides the use of the superior mRNA, drug-loaded lipid nanoparticles or pharmaceutical compositions as defined above in the treatment and / or prevention of diseases, and is particularly useful in mRNA-based therapy.

[0105] "Treatment" is used herein to generally mean obtaining a desired pharmacological and / or physiological effect. Therefore, the treatment of the present invention may relate to the treatment of the (acute) state of a certain disease, but may also relate to a prophylactic treatment in terms of the complete or partial prevention of a disease or its symptoms. Preferably, "treatment" is understood to be therapeutic in terms of partial or complete cure of a disease and / or adverse effects and / or symptoms attributable to the disease. In this regard, "acute" means that the treated or vaccinated person exhibits symptoms of the disease. In other words, the treated or vaccinated person to be treated actually needs treatment, and in the context of the present invention, the term "acute treatment" refers to measures taken to actually treat the disease after the onset of the disease or the outbreak of the disease. Treatment may also be prophylactic or preventive treatment, i.e. measures taken to prevent the disease, for example to prevent the onset of infection and / or disease.

[0106] The pharmaceutical composition of the present invention can be administered by various administration forms known to those skilled in the art. Administration can be systemic, topical, oral, by aerosol, including but not limited to tablets, needle injection, use of inhalers, creams, foams, gels, lotions and ointments.

[0107] As mentioned above, the present invention relates to a pharmaceutical composition comprising an effective amount of the mRNA molecule (or nucleic acid molecule, vector or host cell) according to the present invention described above and at least one pharmaceutically acceptable excipient or carrier.

[0108] Excipients or carriers are inactive substances formulated with active ingredients (i.e., according to the constructs of the present invention described above) for the purpose of enlarging the formulation containing the effective active ingredient. Excipients are often referred to as "fillers," "stuffers," or "diluents." When producing dosage forms, enlargement allows convenient and accurate distribution of drugs. They can also be used for various therapeutic enhancement purposes, such as promoting drug absorption or solubility, or other pharmacokinetic considerations. Excipients are also useful in the manufacturing process, and in addition to contributing to in vitro stability such as preventing denaturation within the expected shelf life, they also help to handle the active substances involved by promoting powder fluidity or non-stickiness. The selection of appropriate excipients also depends on the route of administration and dosage form, as well as the active ingredient and other factors.

[0109] Therefore, consistent with the above, the pharmaceutical composition comprising an effective amount of the nucleic acid of the present invention can be in solid, liquid or gaseous form, and can be in particular in the form of (a) powder (or multiple), (a) tablet (or multiple), (a) solution (or multiple) or (a) aerosol (or multiple). Preferably, the pharmaceutical composition optionally comprises a pharmaceutically acceptable carrier and / or diluent.

[0110] Examples of pharmaceutical carriers, excipients and / or diluents are well known in the art and include phosphate buffered saline, water, emulsions such as oil / water emulsions, various types of wetting agents, sterile solutions, etc. Compositions comprising such carriers can be prepared by well-known conventional methods. These pharmaceutical compositions can be administered to the treated or vaccinates in suitable doses, i.e., in an "effective amount" that can be easily determined by methods known in the art by those skilled in the art. The dosage regimen will be determined by the attending physician and clinical factors. As is well known in the medical field, the dosage of any one patient depends on many factors, including the size, body surface area, age, specific compound to be administered, sex, time and route of administration, general health, and other drugs administered simultaneously with the patient or treated or vaccinate.

[0111] According to the present invention, the term "pharmaceutical composition" relates to a composition intended for administration to a patient, preferably a human patient.

[0112] The pharmaceutical composition of the present invention can be used for mRNA-based treatment. As described above, the mRNA molecule of the present invention comprising a "coding region encoding a polypeptide" can be used for mRNA-based treatment, wherein the "coding region encoding a polypeptide" encodes a therapeutically or pharmaceutically active polypeptide or protein with a therapeutic or preventive effect.

[0113] mRNA-based therapies according to the present invention can be targeted at two major categories of applications. 1. Prevention of infectious diseases: for prevention including but not limited to rabies pre- and post-exposure infection, dengue virus infection, tuberculosis infection, influenza virus infection, herpes simplex virus infection, herpes zoster virus infection, HIV infection, malaria, hepatitis B virus infection, hepatitis C virus infection, measles virus infection, etc.; 2. Treatment of diseases: including but not limited to cancer, cardiovascular disease, viral infection, immune dysfunction, autoimmune disease, neurological disorder, inherited metabolic disease or genetic disease or any disease in which the protein or protein fragment produced in the cell can have a beneficial effect on the patient. The treatment of tumor cancer includes any malignant tumor, precancerous lesion, and benign tumor occurring in any organ or any cell of the human body, such as: head and neck cancer, breast cancer, kidney cancer, bladder cancer, lung cancer, prostate cancer, bone cancer, brain cancer, cervical cancer, rectal cancer, colon cancer, colorectal cancer, appendix cancer, eye cancer, stomach cancer, leukemia, lymphoma, liver cancer, skin cancer, ovarian cancer, penile cancer, pancreatic cancer, testicular cancer, thyroid cancer, vaginal cancer, vulvar cancer, endometrial cancer, cardia cancer, and sarcoma, etc.

[0114] Examples of cardiovascular disease include, but are not limited to, atherosclerosis, coronary heart disease, cor pulmonale, and cardiomyopathy.

[0115] Examples of immune dysfunction and autoimmune diseases include, but are not limited to, rheumatic diseases, multiple sclerosis, and asthma.

[0116] Examples of viral infections include, but are not limited to, infection with human immunodeficiency virus, herpes simplex virus, human papillomavirus, and hepatitis B and C viruses.

[0117] Examples of neurological disorders include, but are not limited to, Parkinson's disease, multiple sclerosis, and dementia.

[0118] Examples of inherited metabolic diseases include, but are not limited to, Gaucher disease and phenylketonuria.

[0119] The present invention also relates to methods for mRNA-based treatment. Therefore, the present invention relates to methods for treating diseases such as cancer, cardiovascular disease, viral infection, immune dysfunction, autoimmune disease, neurological disorder, inherited metabolic disease or genetic disease based on RNA treatment.

[0120] In the present invention, in a preferred embodiment, the subject or vaccinee is a mammal, such as dog, cat, pig, cow, sheep, horse, rodent such as rat, mouse and guinea pig, or primate such as gorilla, chimpanzee and human. In a most preferred embodiment, the subject or vaccinee is human.

[0121] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0122] The reagents and raw materials used in the present invention are commercially available.

[0123] The positive and progressive effects of the present invention are: the use of the UTR element of the present invention can effectively regulate the expression of mRNA, and compared with the control UTR combination, the mRNA is more stable and the expression is more persistent, and the target mRNA can be regulated to produce sufficient immunogenicity and humoral protection. BRIEF DESCRIPTION OF THE DRAWINGS

[0124] Figure 1 Western Blotting was used to detect the expression of the target protein RABV-G in cell lysate. The three designed 5'UTRs and one 3'UTR were paired with the BioNTech 3'UTR and 5'UTR to form a skeleton, and the RABV-G gene sequence was inserted into the skeleton as the ORF sequence. After IVT, mRNA was obtained and transfected into A549 cells. After 24 hours, Western Blotting was used to detect the expression of the target protein RABV-G in cell lysate. β-actin was used as an internal reference. Untransfected A549 cells were used as a control.

[0125] Figure 2 The total protein content in each sample was determined using the BCA protein assay kit and the expression level of the target protein was calculated.

[0126] Figure 3 Western Blotting was used to detect the expression of the target protein RABV-G in cell lysate. The designed four 5'-UTRs were paired with one 3'UTR to form a skeleton, and the RABV-G gene sequence was inserted into the skeleton as the ORF sequence. After IVT, mRNA was obtained and transfected into A549 cells. After 24hr, 48hr and 72hr, Western Blotting was used to detect the expression of the target protein RABV-G in cell lysate. β-actin was used as an internal reference. Untransfected A549 cells were used as a control.

[0127] Figure 4 The total protein content in each sample was determined by BCA protein detection kit, and the gray value of the target protein was detected by Western Blotting to calculate the expression level of the target protein at 24, 48 and 72 hours.

[0128] Figure 5ELISA was used to detect the level of RABV-G specific binding antibodies on D5, D7 and D28, and the level of CVS-11 neutralizing antibodies in D7 serum was detected by pseudovirus neutralization titration. Different 5'UTRs and 3'UTRs were combined and paired, and the target gene RABV-G sequence was inserted after the skeleton was constructed. After obtaining mRNA by IVT, LNP preparation was encapsulated. BALB / c female mice (4 / group) were intramuscularly injected (5μg / mRNA per mouse) on days 0, 7 and 28. Serum was obtained on D5, D7 and D28, and the level of RABV-G specific binding antibodies on D5, D7 and D28 was detected by ELISA, and the level of CVS-11 neutralizing antibodies in D7 serum was detected by pseudovirus neutralization titration (EC50). (1.52X: refers to the antibody titer of the sample is 1.52 times the baseline value; *p<0.05; ns: not significant) DETAILED DESCRIPTION

[0129] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0130] Experimental Materials:

[0131] Different UTR sequences:

[0132] 5'UTR:

[0133] >seq_batch16#86

[0134] GAUCAUAAAACUCUCGACGACCCGAAUAUCCGGAGUCUCGGAAGACAAACUCAAGCCACC(SEQ IDNO:1)

[0135] GATCATAAAACTCTCGACGACCCGAATATCCGGAGTCTCGGAAGACAAACTCAAGCCACC(SEQ IDNO:2)

[0136] >seq_batch17#12

[0137] GAACUACAAAGCCAGCAUACCCAACGCCAUUUGAGGUUGUUAGCAGAAAGAGAGGCCACC(SEQ IDNO:3)

[0138] GAACTACAAAGCCAGCATACCCAACGCCATTTGAGGTTGTTAGCAGAAAGAGAGGCCACC(SEQ IDNO:4)

[0139] >seq_batch43#6

[0140] GAACUAAAAAGCAAGCGCAACAGCACAUACGUUCGUUCGCUAGCAAAACUCACCGCCACC(SEQ IDNO:5)

[0141] GAACTAAAAAGCAAGCGCAACAGCACATACGTTCGTTCGCTAGCAAAACTCACCGCCACC(SEQ IDNO:6)

[0142] new_3'UTR:

[0143] CUGCCACUAGGCAGCUAGCCCACCUCCCCAGCCACCCUCCUCCACAGGUCCAGGUGCCGCUCCCUCCCCCACCACACAUCAGUGUCUCCUCCCUCCUGCUUUGCUGCCUUCCCUUUGCACCAGCCCGAGUCUAGGUCUGGGCCAAGCACACUGUGGCCACAGCUCUGGAGUGGGAGGGUUGGUUGCCCCUCACCUCAGAGCUCCCCCAAAGGCCAGUAAUGGAUCCCCGGCCUCAGUCCCUACUCUGCUUUGGGAUAGUGUGAGCUUCAUUUUGUACACGUGUGACUUCGUCCAGUUACA(SEQ ID NO:7)

[0144] CTGCCACTAGGCAGCTAGCCCACCTCCCCAGCCACCCTCCTCCACAGGTCCAGGTGCCGCTCCCTCCCCCACCACACATCAGTGTCTCCTCCCTCCTGCTTTGCTGCCTTCCCTTTGCACCAGCCCGAGTCTAGGTCTGGGCCAAGCACACTGTGGCCACAGCTCTGGAGTGGGAGGGTTGGTTGCCCCTCACCTCAGAGCTCCCCCAAAGGCCAGTAATGGATCCCCGGCCTCAGTCCCTACTCTGCTTTGGGATAGTGTGAGCTTCATTTTGTACACGTGTGACTTCGTCCAGTTACA(SEQ ID NO:8)

[0145] mRNA of the target gene (W1-5)

[0146] RABV-G

[0147]

[0148] Different cell culture reagents and consumables are shown in Table 1:

[0149] Table 1

[0150]

[0151] Experimental Animals:

[0152] BALB / c mice: Zhuhai Baishitong Biotechnology Co., Ltd., 7-8 weeks old. Immunoassay reagents are shown in Table 2:

[0153] Table 2

[0154]

[0155]

[0156] Delivery System

[0157] 47mol% ALC-0315 lipids were mixed with 10mol% DSPC, 41.5mol% cholesterol and 1.5mol% PEG-DMG and dissolved in an ethanol solution. ALC-0315, DSPC, cholesterol, and PEG-DMG-2000 were all purchased from Xiamen Sinobond Biotechnology Co., Ltd. mRNA was dissolved in a pH 4.0 citrate or acetate buffer as an aqueous phase. The mRNA used was an mRNA encoding RABV-G, in which each uridine was replaced with N1-methyl pseudouridine. The molar ratio of the ionizable lipid molecules to the bases in the mRNA solution is defined as the N / P ratio. In this embodiment, the N / P ratio is 6:1. When the microfluidic device is mixed, the ratio of the aqueous phase to the alcohol phase is controlled to be 3:1. After the preparation is completed by rapid mixing, the ethanol content in the mRNA-LNP is reduced and dispersed into the target buffer by an ultrafiltration tube (100kDa) or a tangential flow filtration (TFF) device. The LNPs were sterile filtered using a 0.22 μM filter and stored at 4° C. for further use.

[0158] Vector: The vector pUC-Kan-TMA was provided by Suzhou Jinweizhi Biotechnology Co., Ltd. T7 promoter sequence, 5'UTR sequence, cloning site sequence (including BbsI site) and 3'UTR sequence were added to the original vector to obtain a plasmid backbone with paired 5'UTR and 3'UTR sequences; suitable primers were designed to homologously recombine the target antigen gene amplification product with the above plasmid backbone after enzyme digestion, transformed into competent cells, plate cultured, and single clone colonies were picked for sequencing to obtain the correctly sequenced clones lp-UTR-W1-5-1 (16#86+new_3'UTR), lp-UTR-W1-5-2 (17#12+new_3'UTR), lp-UTR-W1-5-5 (43#6+new_3'UTR), batch16#86-1-W1-5 (16#86+BNT 3'), batch17#12-1-W1-5 (17#12+BNT 3'), batch43#6-1-W1-5(43#6+BNT 3'), bnt-5UTR-lp3UTR-1-W1-5(BNT 5'+new_3'UTR).

[0159] Example 1 Construction of UTR and mRNA complex

[0160] 1.1 Design and synthesize different UTR sequences and clone them into expression vectors

[0161] 1.1.1 5'UTR sequence and 3'UTR sequence

[0162] 1.1.1.1 Design the following 5'UTR sequence:

[0163] batch16#86 (SEQ ID NOs: 1 and 2), batch17#12 (SEQ ID NOs: 3 and 4), batch43#6 (SEQ ID NOs: 5 and 6) and new_3'UTR sequence (SEQ ID NOs: 7 and 8).

[0164] 1.1.1.2 BioNTech 5'UTR and BioNTech 3'UTR sequences:

[0165] BioNTech 5'UTR (BNT 5'UTR)

[0166] GGGCGAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCAC C(SEQ ID NO:9)

[0167] BioNTech 3'UTR sequence (BNT 3'UTR)

[0168] CUCGAGCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCA GCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCGAGACCUGGUCCAGAGUCGCUAGCCGCGUCGCU(SE Q ID NO:10)

[0169] 1.1.1.3 Control UTR sequence

[0170] Control 5'UTR sequence

[0171] GGCUAGCAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC(SEQ ID NO:11)

[0172] Control 3'UTR sequence

[0173] GCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGCACGUCUCUUAACUAACUAAGGAUCCCGUCUCUUAACUAACUAAACUAGU (SEQ ID NO: 12)

[0174] 1.1.2 Construction of plasmid backbone containing the above 5'UTR and 3'UTR sequence design pairing

[0175] 1.1.2.1 The three designed 5'UTR sequences (with T7 promoter sequence TAATACGACTCACTATAAG (SEQ ID NO: 13) in front and cloning site sequence ATGATGTCTTCTTGAAGACGATAATAG (SEQ ID NO: 14) with two BbsI sites in the back) and one designed 3'UTR sequence (with XhoI sequence TAATAGCTCGAG (SEQ ID NO: 15) in front and polyA in the back) were sent to Suzhou Genewiz Biotechnology Co., Ltd. for synthesis. The three designed 5'UTR sequences (with T7 promoter sequence in front) were paired with the designed 3'UTR sequence (with polyA in the back) and subcloned and assembled into Genewiz's vector pUC-Kan-TMA.

[0176] The polyA sequence is as follows:

[0177] AAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 16)

[0178] The sequence of the pUC-Kan-TMA vector is as follows:

[0179] TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACT

[0180] GTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGT

[0181] CAGCGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATT

[0182] GTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAA

[0183] ATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGAT

[0184] CGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGG

[0185] CGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGC

[0186] CAGTGAATTGACGCGTATTGGGATATCCCAATGGCGCGCCGAGCTTGGCTCGAGCAT

[0187] GGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACG

[0188] AGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACAT

[0189] TAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGC

[0190] ATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTGTTCC

[0191] GCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATC

[0192] AGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAA

[0193] AGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGT

[0194] TGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCT

[0195] CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCT

[0196] GGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCC

[0197] GCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTC

[0198] AGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCA

[0199] GCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACA

[0200] CGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATG

[0201] TAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA

[0202] ACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGT

[0203] AGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAA

[0204] GCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTA

[0205] CGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGA

[0206] TTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAA

[0207] TCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTAGAAAAACTCATCGAGCATCA

[0208] AATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCG

[0209] TTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCT

[0210] GGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTC

[0211] GTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTG

[0212] AGAATGGCAAAAGTTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTAC

[0213] GCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCT

[0214] GAGCGAAACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGA

[0215] ATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAG

[0216] GATATTCTTCTAATACCTGGAATGCTGTTTTCCCAGGGATCGCAGTGGTGAGTAACC

[0217] ATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCG

[0218] TCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCC

[0219] ATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGC

[0220] ACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATG

[0221] TTGGAATTTAATCGCGGCCTAGAGCAAGACGTTTCCCGTTGAATATGGCTCATACTC

[0222] TTCCTTTTTCAATATTATTGAAGCATTTTATCAGGGTTATTGTCTCATGAGCGGATACAT

[0223] ATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAA

[0224] AGTGCCACCTGACGTCTAAGAAACATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTTGTC (SEQ ID NO: 17)

[0225] 1.1.2.2The component information of pUC-Kan-TMA vector is as follows:

[0226] Table 3

[0227]

[0228]

[0229] 1.1.3 Construction of plasmid backbones containing the BioNTech 5'UTR and the above-designed 3'UTR sequence design and the above-designed 5'UTR sequence design and the BioNTech 3'UTR

[0230] 1.1.3.1 A BioNTech 5'UTR sequence (with T7 promoter sequence TAATACGACTCACTATAAG (SEQ ID NO: 13) in front and cloning site sequence ATGATGTCTTCTTGAAGACGATAATAG (SEQ ID NO: 14) with two BbsI sites in the back) and a BioNTech 3'UTR sequence (with XhoI sequence TAATAGCTCGAG (SEQ ID NO: 15) in front and polyA in the back) were sent to Suzhou Genewiz Biotechnology Co., Ltd. for synthesis. The three designed 5'UTR sequences (with T7 promoter sequence in front) were combined with one BioNTech 3'UTR sequence (with polyA in the back), and one BioN Tech 5'UTR sequence and one designed 3'UTR sequence were subcloned and assembled into Genewiz's vector pUC-Kan-TMA.

[0231] The polyA sequence and pUC-Kan-TMA vector are the same as 1.1.2.1.

[0232] The component information of pUC-Kan-TMA vector is the same as 1.1.2.2.

[0233] 1.2 Combine the target gene mRNA with different UTR sequences through molecular cloning technology to construct different UTR-mRNA complexes.

[0234]

[0235] *(SEQ ID NO:21)

[0236] The CDS sequence of W1-5 was sent to GenScript Biotech for synthesis.

[0237] 1.2.2 Primer design:

[0238] Table 4

[0239]

[0240] The above primers were sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis.

[0241] 1.2.3 Gene amplification and product purification

[0242] The synthetic W1-5 was used as template using Phusion gene amplification enzyme from NEB according to the amplification procedure (pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 65°C for 30 s, extension at 72°C for 60 s, 34 cycles; final extension at 72°C for 10 min; storage temperature at 10°C, ∞). W1-5-Fs-c1 / lp-3'UTR-W1-5-R-sc, W1-5-Fs-c2 / lp-3'UTR-W1-5-R-sc, W1-5-Fs-c5 / lp-3'UTR-W1-5-R -sc and W1-5-Fs-c1 / b-3'UTR-W1-5-R-sc, W1-5-Fs-c2 / b-3'UTR-W1-5-R-sc, W1-5-Fs-c5 / b-3'UTR-W1-5-R-sc, b-5'UTR-W1-5-F-sc / lp-3'UTR-W1-5-R-sc were used to amplify the target fragments (the sizes were 1632bp, 1626bp, 1628bp, 1640bp, 1634bp, 1636bp, and 1619bp, respectively) on a gene amplification instrument. The gene amplified fragments were purified by gel cutting and stored at -20°C for later use after the concentration was measured.

[0243] 1.2.4 Vector linearization and purification

[0244] The three vectors constructed in step 1.1.2 and the four vectors constructed in step 1.1.3 were linearized by NEB's Bbs I-HF restriction enzyme digestion and then directly purified.

[0245] 1.2.5 Homologous recombination ligation of gene amplification products and restriction digestion vector

[0246] The gene amplification and purification product obtained in step 1.2.3 and the linearized purified vector obtained in step 1.2.4 were homologously recombined using Novozyme 2×ClonExpress Mix, and the recombinant product was stored at -20°C for future use.

[0247] 1.2.6 Transformation of recombinant products

[0248] Using the competent cells Trans1-Blue, the recombinant product obtained in step 1.2.5 was transformed into competent cells according to the following steps: (1) Take 50 μL of competent cells melted in an ice bath, add the recombinant product, mix gently, and place in an ice bath for 30 minutes; (2) Heat shock in a 42°C water bath for 90 seconds, then quickly transfer the tube to an ice bath for 5 minutes; (3) Add 500 μL of sterile SOC medium (without antibiotics) to each centrifuge tube, mix well, and incubate at 37°C, 200 rpm for 1 hour to recover. (4) Spread the cells evenly on LB agar medium containing the corresponding antibiotics, turn the plate upside down, and culture at 37°C overnight.

[0249] 1.2.7 Sequencing of single clone colonies on transformation plates

[0250] Pick 12 single clones from the plate containing the single clone colonies obtained in step 1.2.6, place them in a 1.5 mL EP tube containing 500 μL LLB (Kanamycin resistance), and culture them at 37°C and 230 rpm for 6-8 hours. Take 200 μL of bacterial solution from each EP tube and send it to Suzhou Genewise Biotechnology Co., Ltd. for sequencing.

[0251] 1.3 Verify the correctness of the constructed UTR-mRNA complex

[0252] Bioinformatics software was used to splice, edit and align the sequencing data of GeneWeichi to obtain the correctly sequenced clones lp-UTR-W1-5-1 (16#86+new_3'UTR), lp-UTR-W1-5-2 (17#12+new_3'UTR), lp-UTR-W1-5-5 (43#6+new_3'UTR) and batch16#86-1-W1-5 (16#86+BNT 3'), batch17#12-1-W1-5 (17#12+BNT 3'), batch43#6-1-W1-5 (43#6+BNT 3'), and bnt-5UTR-lp3UTR-1-W1-5 (BNT 5'+new_3'UTR).

[0253] Example 2 Cell level expression verification

[0254] 2.1 Transfect the constructed UTR-mRNA complex containing different UTR element combinations and target genes into the cell line

[0255] A549 cells were seeded in 12-well plates (10 5 / well), cultured overnight in a carbon dioxide incubator, and transfected with mRNA containing the UTR element combination using Lipofectamine TM MessengerMAX TM Transfection reagent was used to transfect each well (1 μg / well). The untransfected wells were used as blank controls. The cells in the wells were washed twice with pre-cooled PBS (1 mL / well) at 24 hr, 48 hr, and 72 hr. The culture plates were placed on ice and washed with Pierce TM The cells were lysed with RIPA lysis buffer containing protease inhibitors (100 μL / well) for 30 min, the cell lysate was collected, centrifuged at 13,000 rpm at 4°C for 10 min, and the supernatant was collected.

[0256] 2.2 The in vitro expression levels of UTR-mRNA complexes containing different UTR element combinations and target genes were detected by Western Blot.

[0257] The cell lysate (15 μL) of each sample was mixed with an equal volume of Novex TM Mix Tris-glycine SDS sample buffer (2×), add to 8% PAGE-SDS electrophoresis gel sample well, place in Tris-glycine-SDS electrophoresis solution, use 80V (30min) and then 120V (60min) voltage to run the sample, take out the electrophoresis gel, overlap with the PVDF membrane sandwich method and place it in the transfer tank, constant current 300mA, 90min, transfer in ice water bath. Take out the PVDF membrane, immerse in 5% skim milk powder-TBST solution, block for 1hr, immerse in 1:1000 diluted anti-RABV-G antibody, overnight at 4℃, wash the membrane 3 times with TBS T, immerse in 1:2000 diluted HRP-conjugated anti-mouse IgG antibody, room temperature for 1hr, wash the membrane 3 times with TBST, use SuperSignal West Atto ultrasensitive substrate for color development, and take photos with Tanon5200 fluorescence. At the same time, the same method was used to detect the expression of the internal reference β-actin gene. The results are as follows Figure 1 and Figure 3 When comparing and analyzing the expression level of the target gene, ImageJ was used to measure and count the grayscale value of the target gene band. At the same time, the total amount of sample protein was detected using the Bio-Tech BCA protein concentration assay kit. The final expression level of the target gene in each transfected sample was calculated as: grayscale value of the target gene band / total amount of sample protein, and this value was input into Graphpad for plotting and analysis. The results are shown in Figure 2 and Figure 4 shown. Figure 1 and Figure 2 The results showed that the combination of 5'UTR 16#86, 17#12, 43#6 and BNT 3'UTR, as well as the combination of 3'UTR new_3UTR and BNT 5'UTR, could regulate RABV-G ORF to achieve a higher in vitro expression level, which exceeded the combination of control 3'UTR and control 5'UTR, indicating that 5'UTR 16#86, 17#12, 43#6 and 3'UTR new_3UTR could independently achieve the purpose of regulating mRNA translation. Figure 3 and Figure 4The results showed that the combination of 5'UTR 16#86, 17#12, 43#6 and 3'UTR new_3UTR could regulate RABV-G ORF to achieve higher in vitro expression and more persistent expression, which could last up to 72 hours after transfection. The in vitro expression at 72 hours exceeded that of the control UTR combination, indicating that the combination of 5'UTR 16#86, 17#12, 43#6 and 3'UTRnew_3UTR could effectively regulate the expression of mRNA, and compared with the control UTR combination, it made the mRNA more stable and the expression more persistent.

[0258] Example 3 Animal level expression verification

[0259] 3.1 Selection of mice as an animal model

[0260] Since RABV-G antigen has good immunogenicity in BALB / c mice, female BALB / c mice, 7-8 weeks old, were used for mRNA immunogenicity evaluation and comparison.

[0261] 3.2 The RABV-G mRNA conjugates containing different UTRs with better expression effects (setting up a control group) were encapsulated with cationic liposomes (LNP preparations) and immunized animals by intramuscular injection on days 0, 7, and 28, with an injection dose of 5 μg mRNA per mouse.

[0262] 3.3 At different time points after immunization (5th day, 7th day, 28th day, 56th day), peripheral blood was collected from animals using the retro-orbital vascular plexus blood sampling method into procoagulant tubes, allowed to stand at room temperature for 15 minutes, centrifuged at 5000Xg at 4°C for 15 minutes, and the upper serum was collected.

[0263] 3.4 Detection of specific antibodies and neutralizing antibody levels in serum by ELISA and pseudovirus neutralizing antibody assay

[0264] The recombinant protein RABV-G glycoprotein (0.5 μg / mL) was used as an antigen to coat the ELISA plate, incubated overnight at 4°C, washed 4 times, and blocked with blocking solution at 37°C for 1 hour. The serum solution after gradient dilution (3 times) was added to the wells, and each serum sample was duplicated and incubated at 37°C for 1 hour. The plate was washed 4 times, and HRP-anti-mouse IgG antibody diluted 1:2000 was added. After incubation at 37°C for 1 hour, the plate was washed 4 times, and TMB reagent was used for color development for 15 minutes. The OD was read in a BioTek ELISA reader. 630 After the reaction was terminated with ELISA stop solution, the OD was read in a BioTek microplate reader. 450Value. Graphpad was used to analyze the data and obtain the antibody endpoint titer. In the neutralizing antibody test, the mouse serum was inactivated in a 37°C water bath for 30 minutes, and then the serum was diluted 50 times with culture medium (DMEM), and then diluted 3 times in a gradient, for a total of 8 dilutions, using HIV pseudovirus expressing the rabies CVS-11 strain RABV-G protein (according to Nie, J., Wu, X., Ma, J. et al. Development of in vitro and in vivo rabies virus neutralization assays based on a high-titer pseudovirus system. Sci Rep7, 42769 (2017). https: / / doi.org / 10.1038 / srep42769) (TCID50 / sample) was mixed with diluted serum and incubated in a 37°C cell culture incubator for 1 hour. No serum and no virus were used as experimental controls. The incubated serum virus mixture and the control were added to 293T cells that had just been digested with trypsin, and they were inoculated into a 96-well plate (40,000 cells / well). Each sample was repeated in 3 wells and incubated in a 37°C cell culture incubator for 48 hours. Part of the culture medium was discarded, and the remaining 100 μl was added to each well. 100 μl of Bright-Glo luciferase reagent was added, incubated at room temperature for 2 minutes, and 150 μl of the lysate was transferred to a black-bottom 96-well plate, and the fluorescence intensity was detected using an enzyme reader. Graphpad nonlinear regression was used to fit the curve of each sample, and the titer corresponding to 50% neutralization was calculated, which was defined as EC50. The results are shown in Figure 5As shown. The results show that the combination pairing of 5'UTR 16#86, 17#12, 43#6 and 3'UTR new_3UTR can effectively regulate the expression of RABV-G mRNA, thereby ensuring that it produces sufficient immunogenicity. Specifically, on the 5th, 7th and 28th days after the first immunization, the RABV-G mRNA regulated by the combination pairing of 5'UTR 16#86, 17#12, 43#6 and 3'UTR new_3UTR can effectively activate the production of binding antibody IgG in serum, which is similar to or higher than the binding antibody IgG level in the serum produced by the same target mRNA regulated by the control UTR, and the humoral immunity IgG level can last for at least 28 days after the first immunization. Therefore, the combination pairing of 5'UTR 16#86, 17#12, 43#6 and 3'UTR new_3UTR can regulate the target mRNA to produce sufficient immunogenicity. At the same time, the serum neutralizing antibody level was detected using pseudovirus, and the results were similar to the binding antibody IgG level, which was similar to or higher than the neutralizing antibody IgG level in the serum produced by the same target mRNA regulated by the control UTR. In summary, it can be shown that the combination of 5'UTR 16#86, 17#12, 43#6 and 3'UTR new_3UTR can regulate the target mRNA to produce sufficient immunogenicity and humoral protection.

Claims

1. A UTR element, characterized in that The UTR element comprises a 3'UTR selected from the group consisting of: 1) a 3'UTR having a nucleotide sequence as shown in SEQ ID NO: 7 or 8; 2) having a 3'UTR with a homology of ≥80% to the nucleotide sequence shown in SEQ ID NO: 7 or 8; or, 3) A 3'UTR having 1-20 nucleotides added to the 5' end and / or 3' end of the nucleotide sequence as shown in SEQ ID NO: 7 or 8, and / or having 1-20 nucleotides reduced.

2. The UTR element according to claim 1, characterized in that The UTR element further comprises a 5'UTR, the nucleotide sequence of which is selected from the following group: 1) the nucleotide sequence shown in any one of SEQ ID NOs: 1-6; 2) a nucleotide sequence having a homology of ≥ 80% with the sequence shown in any one of SEQ ID NOs: 1-6; or, 3) A nucleotide sequence having 1 to 20 nucleotides added to and / or 1 to 20 nucleotides removed from the 5' end and / or 3' end of the nucleotide sequence as shown in any one of SEQ ID NOs: 1-6.

3. A biological element, characterized in that: The biological element comprises the UTR element according to claim 1 or 2, and the biological element is any one of the following: a) mRNA transcription template construct; b) carrier; c) reporter gene system; and, d) nucleic acid biological preparation plasmid template; Preferably, the mRNA transcription template construct further comprises one or more of a promoter element, a coding region and a polyA tail element; Or, the vector is an expression vector or a cloning vector; and / or, the vector is a virus or a plasmid; Or, the nucleic acid bioplasmid template comprises one or more of a promoter, a coding region and a terminator; Alternatively, the reporter gene system further comprises one or more of an expression vector, a reporter gene and a regulatory element; the promoter is, for example, an SV40 promoter, a CMV promoter or a GRE promoter; and / or the reporter gene is, for example, green fluorescent protein, luciferase, β-galactosidase, alkaline phosphatase or anthocyaninase; and / or the regulatory element is, for example, an enhancer or a silencer.

4. A transformant, characterized in that The transformant is a host cell comprising the UTR element according to claim 1 or 2 or the biological element according to claim 3; Preferably, the host cell is a prokaryotic cell or a eukaryotic cell; More preferably, the host cell is selected from yeast cells or mammalian cells; the mammalian cells are, for example, HEK293 cells.

5. A method for optimizing mRNA, characterized in that: The method comprises the steps of: (i) culturing the transformant according to claim 4 to obtain a culture containing a vector of an mRNA transcription template construct; (ii) isolating and / or recovering the vector in (i) from the culture, and linearizing it with enzymes to form an mRNA transcription template; (iii) transcribing the mRNA transcription template described in step (ii) to obtain optimized mRNA; Preferably, the method further comprises the step of purifying and / or modifying the optimized mRNA obtained in step (iii).

6. An optimized mRNA, characterized in that The optimized mRNA is prepared by the method according to claim 5; Preferably, the optimized mRNA further comprises one or more of a ribosome entry site sequence, a 5'-UTR and a polyA tail element.

7. A drug-loaded lipid nanoparticle, characterized in that: The lipid nanoparticles contain the optimized mRNA as claimed in claim 6; Preferably, the lipid nanoparticles further comprise one or more of cationic lipids, ionizable lipids, auxiliary lipids, cholesterol and its derivatives, lipid polymer complexes and PEG lipids and their derivatives.

8. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises one or more of the UTR element according to claim 1 or 2, the biological element according to claim 3, the transformant according to claim 4, the optimized mRNA according to claim 6, and the lipid nanoparticle according to claim 7, and optional excipients and pharmaceutically acceptable carriers.

9. A kit, characterized in that: The kit comprises one or more of the UTR element according to claim 1 or 2, the biological element according to claim 3, the transformant according to claim 4, the optimized mRNA according to claim 6, the lipid nanoparticle according to claim 7, and the pharmaceutical composition according to claim 8; Preferably, the kit further comprises one or more of lipids, polymer delivery systems, inorganic nanoparticles, exosomes, viral vectors and polypeptides.

10. Use of the UTR element according to claim 1 or 2, the biological element according to claim 3, the transformant according to claim 4, the optimized mRNA according to claim 6 or the lipid nanoparticle according to claim 7 in the preparation of mRNA drugs.

Images