A racemosus mucor and its application

Abstract

The application discloses a mucor racemosus and application thereof, a strain number of the mucor racemosus is JSAFC 1762, and the mucor racemosus is preserved in the China General Microbiological Culture Collection Center on December 9, 2024, and the preservation number is CGMCC No.41702. A mucor racemosus is obtained by separating and purifying soil around Liquidambar formosana Hance. The strain can be used as a biocontrol strain to inhibit inonotus labyrinthus, and the inhibition rate reaches 58.01% in plate confrontation culture; meanwhile, the strain can promote the development of Liquidambar formosana Hance and regulate plant growth, and has great significance for the development of a biocontrol agent for preventing and treating wood rot in the future.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology and relates to a species of Mucor racemose and its applications. Background Technology

[0002] The Chinese sweetgum (Liquidambar formosana) has a straight trunk, a majestic appearance, and vibrant red autumn foliage, making it suitable for individual planting, clump planting, and group planting. Due to its attractive appearance and red leaves, it is a popular street tree with high ornamental value. The resin is used medicinally for detoxification, pain relief, hemostasis, and tissue regeneration. The roots, leaves, and fruits are also used in traditional medicine for their effects of dispelling wind and dampness, and promoting blood circulation. The wood is relatively hard and can be used to make furniture and crates for valuable goods. Wood rot is a common disease affecting the growth of Chinese sweetgum, primarily damaging the xylem, causing it to decay and affecting normal growth, leaf development, and wood quality. The wood rot caused by *Trametes gibbosa* mainly affects the branches, trunk, and heartwood, causing the heartwood to rot in concentric rings. Infected trees have white, loose, soft, and brittle wood that is easily broken, often leading to weakened tree vigor, yellowing leaves, or premature leaf drop.

[0003] Currently, chemical pesticides are a commonly used method for controlling plant diseases. However, long-term use can lead to drug resistance in many pathogens, reducing their effectiveness. Frequent and high-concentration use can pollute the environment, and excessive residues can threaten human health. Many beneficial microorganisms exist in the environment surrounding plants. These microorganisms not only do not cause plant diseases, but some can even induce resistance, improving the plant's survival ability under biotic or abiotic stress conditions. Furthermore, these microorganisms originate from the natural environment and do not pollute it. Using these microorganisms to control plant diseases helps maintain ecological balance. Summary of the Invention

[0004] Purpose of the invention: The purpose of this invention is to provide a *Mucor racemosus* and its application in inhibiting the growth of *Fotomyces labyrinthi* and promoting the growth of *Liquidambar formosana*.

[0005] Technical solution: The present invention provides a strain of Mucor racemosus, the strain number of which is JSAFC 1762, and was deposited at the China General Microbiological Culture Collection Center on December 9, 2024, with the accession number CGMCC No.41702.

[0006] Furthermore, the nucleotide sequence of the ITS gene of the *Mucor racemosa* is shown in SEQ ID NO.1.

[0007] The present invention also provides a biocontrol agent, wherein the active ingredient of the biocontrol agent is the aforementioned *Mucor racemosus*.

[0008] This invention also provides the application of the above-mentioned *Mucor racemosus* and biocontrol agents in inhibiting the growth of *Fotomyces labyrinthus*.

[0009] This invention also provides the application of the above-mentioned *Mucor racemosus* and biocontrol agent in promoting the growth of Liquidambar formosana.

[0010] Furthermore, the application specifically involves drenching the roots of Liquidambar formosana with a spore suspension of Mucor racemosus JSAFC 1762 to promote the plant height and increase the number of maple leaves.

[0011] Further, the preparation method of the spore suspension is as follows: (1) Take the biocontrol fungus Mucor racemose JSAFC 1762, under aseptic conditions, pick up the hyphae with an inoculation needle, inoculate them into sterilized PDA medium, and culture for 5-7 days; (2) Under aseptic conditions, scrape off the hyphae, rinse the hyphae with sterile water and filter with gauze; (3) Under aseptic conditions, adjust the spore concentration with sterile water.

[0012] Furthermore, the culture conditions described in step (1) are 25°C, 65% humidity, and dark culture.

[0013] Furthermore, the concentration of the spore suspension is 10. 5 / ml.

[0014] Furthermore, the spore suspension is applied at a rate of 5 mL / time / 2 days for 30 days.

[0015] Beneficial Effects: Compared with the prior art, the present invention has the following significant advantages: This application obtained a strain of *Mucorracemosus* by isolating and purifying soil surrounding *Ligustrum lucidum*. This strain can be used as a biocontrol strain and has inhibitory activity against *Fotomyces labyrinthi*, with an inhibition rate of 58.01% in plate confrontation culture; at the same time, this strain can promote the development of *Ligustrum lucidum* and regulate plant growth, which is of great significance for the future development of biocontrol agents for controlling wood rot. Attached Figure Description

[0016] Figure 1 Phylogenetic tree of *Mucor racemosus* JSAFC 1762.

[0017] Figure 2 Mucorracemosus JSAFC 1762 was cultured in confrontation with Mucorracemosus.

[0018] Figure 3 The effect of Mucorracemosus JSAFC 1762 on the growth of Liquidambar formosana. Detailed Implementation

[0019] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0020] In this invention, the term "biocontrol bacteria" refers to beneficial microorganisms that can prevent and control plant diseases, mainly including bacteria, fungi, and actinomycetes.

[0021] Example 1: Isolation and identification of Mucorracemosus JSAFC 1762

[0022] 1. Separation of Mucorracemosus JSAFC 1762

[0023] Soil with good growth conditions of Liquidambar formosana in Nanning City, Guangxi Province was used to isolate JSAFC 1762. The colony characteristics are as follows: when cultured on PDA plate medium, the colony grows rapidly, is sparse and flocculent, and its surface color is light yellow.

[0024] 2. Molecular biological identification of *Mucor racemosus* JSAFC 1762

[0025] (1) Genomic DNA of strain JSAFC 1762 was extracted using a kit from TIANGEN.

[0026] (2) Amplification of the ITS gene from genomic DNA. DNA amplification was performed using a 30 μL reaction volume, containing 15 μL of 2×EasyTaq PCR SuperMix (+dye), 1 μL (10 μM) each of primer pairs ITS1 (SEQ ID NO.2: 5'-CTTGGTCATTTAGAGGAAGTAA-3') & ITS4 (SEQ ID NO.3: 5'-TCCTCCGCTTATTGATATGC-3'), 2 μL of template DNA, and 11 μL of ddH2O. The PCR amplification program conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 54℃ annealing for 45 s, 72℃ extension for 60 s, for a total of 35 cycles; and a final extension at 72℃ for 10 min.

[0027] (3) After the amplified PCR products were subjected to 1% agarose gel electrophoresis and observed under ultraviolet light, the PCR products with the target band were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were as follows: The ITS gene sequence of strain JSAFC 1762 was SEQ ID NO.1 (TCTATTTACTGTGAACTGTATTATTATTTGACATTTGAGGGATGTTCCAATGTTATA). AGGATAGACATTGGAAATGTTAACCGAGTCATAATCAGGTTTAGGCCTGGTATCCTATTATTATTTACCAAATGAATTCAGAATTAATATTGTAACATAGACCTAAAAAATCTATAAAACAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCG AGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACGCCTGTTTCAGTATCAAAACAAACCCTCTATCCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAATCCCTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGTAATTGAC).

[0028] (4) Compare the SEQ ID NO.1 sequence with the NCBI database website and construct a phylogenetic tree. See [link to relevant documentation]. Figure 1 The comparison results are shown in Table 1. Based on the results in Table 1, the biocontrol bacterium JSAFC 1762 of the present invention can be identified as Mucorracemosus, named Mucorracemosus JSAFC 1762, and the strain was deposited on December 9, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41702, classified as Mucorracemosus JSAFC 1762, and the deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen No. 1 Courtyard, Chaoyang District, Beijing.

[0029] Table 1. Sequence alignment results of SEQ ID NO.1

[0030]

[0031] Example 2: Inhibitory effect of Mucorracemosus JSAFC 1762 on F. labyrinthus

[0032] (1) On a clean bench, a 4 mm diameter mycelium of Mucor racemosus JSAFC 1020 was inoculated onto one side of a PDA medium plate. The other side was left uninoculated as a control group, and the other side was symmetrically inoculated with a 4 mm diameter mycelium of Mucor racemosus JSAFC 1762 as an experimental group.

[0033] (2) The experimental group and the control group in step (1) were cultured upside down in a constant temperature incubator at 25°C. The culture conditions were 8 hours of light followed by 16 hours of dark culture, for a total of 7 days.

[0034] (3) The colony radius of Mucor racemosus was measured by the plate confrontation method, and the inhibitory effect of Mucor racemosus JSAFC 1762 on Mucor racemosus was observed.

[0035] The results are as follows Figure 2 As shown, the colony radius of Mucorracemosus in the blank control group was 2.12 cm; in the experimental group, the average radius of the Mucorracemosus pathogen was only 0.89 cm, as determined by the plate confrontation method, with an inhibition rate of 58.01%, indicating that Mucorracemosus JSAFC 1762 has a significant inhibitory effect on Mucorracemosus.

[0036] Example 3: Effects of Mucor racemosus JSAFC 1762 on the growth of Liquidambar formosana

[0037] (1) Take a 5mm diameter mycelial block of strain Mucor racemosus JSAFC 1762 and inoculate it into a 9cm diameter petri dish (containing 15ml PDA medium). Incubate at 25℃ and 65% humidity in the dark for 7 days.

[0038] (2) Under aseptic conditions, scrape off the mycelium, rinse the mycelium with sterile water and filter it with gauze, and then adjust the spore concentration to 10. 5 / ml.

[0039] (3) Select pots with a diameter of 12 cm and transplant one healthy Liquidambar formosana seedling (variety: Sha Hong) with uniform growth into each pot. The experiment was set up with two groups (control group and treatment group), and each treatment was set up with 10 replicates. The experimental group was watered with 5 mL of Mucor racemosus JSAFC 1762 spore suspension in each pot; the control group was watered with 5 mL of sterile water in each pot.

[0040] (4) Water each group of maple seedlings every 2 days. After 30 days, count the height of the maple seedlings and observe the growth and development of the roots.

[0041] The results are as follows Figure 3 As shown in Table 2.

[0042] Table 2. Statistical results of Liquidambar formosana plant height

[0043]

[0044] The plant height in the table is expressed as mean ± standard error.

[0045] from Figure 3 As shown in Table 2, the plant height and maple leaf growth of the experimental group were significantly better than those of the control group, indicating that Mucorracemosus JSAFC 1762 has a promoting effect on the growth of Liquidambar formosana.

Claims

1. A racemose mold ( Mucor racemosus ), characterized in that, The racemose mold ( Mucor racemosus The strain number is JSAFC 1762, which was deposited at the China General Microbiological Culture Collection Center on December 9, 2024, with accession number CGMCC No. 41702.

2. A biocontrol agent, characterized in that, The active ingredient of the biocontrol agent is *Mucor racemosa* as described in claim 1. Mucor racemosus ).

3. The *Mucor racemosa* as described in claim 1 ( Mucor racemosus The application of the biocontrol agent according to claim 2 in inhibiting the growth of *Fotomyces labyrinthi*.

4. The *Mucor racemosa* as described in claim 1 ( Mucor racemosus The application of the biocontrol agent described in claim 2 in promoting the growth of Liquidambar formosana.

5. The application according to claim 4, characterized in that, The specific application involves using *Mucor racemosa* (… Mucor racemosus The spore suspension of JSAFC 1762 was used for root irrigation of Liquidambar formosana to promote plant height growth and increase the number of maple leaves.

6. The application according to claim 5, characterized in that, The preparation method of the spore suspension is as follows: (1) Take the biocontrol fungus Mucor racemose JSAFC 1762, pick up the hyphae with an inoculation needle under sterile conditions, inoculate them into sterilized PDA medium, and culture for 5-7 days; (2) Under sterile conditions, scrape off the hyphae, rinse the hyphae with sterile water and filter with gauze; (3) Under sterile conditions, adjust the spore concentration with sterile water.

7. The application according to claim 6, characterized in that, The culture conditions described in step (1) are 25℃, 65% humidity, and dark culture.

8. The application according to claim 5, characterized in that, The concentration of the spore suspension is 10. 5 / ml.

9. The application according to claim 5, characterized in that, The spore suspension was applied at a rate of 5 mL per application every 2 days for 30 days.

Images