Screening method and application of streptococcus suis serine protein kinase inhibitor

Abstract

The invention belongs to the technical field of drug target screening, and particularly relates to screening and application of a streptococcus suis serine protein kinase inhibitor. Based on a chemiluminescence technology, a possible HPrK inhibitor is screened out by determining luminescence values of different drugs added into a reaction system, and the reaction system comprises streptococcus suis SC19 serine protein kinase (HPrK), streptococcus suis SC19 phosphorylated carrier protein (HPr), ATP, a kinase reaction buffer solution and # imgabs0 # Reagent. The inhibitor CDK9-IN-2 is obtained by screening a kinase inhibitor drug library, the inhibition rate of the inhibitor CDK9-IN-2 on streptococcus suis serine protein kinase (HPrK) reaches 99%, and the inhibitor CDK9-IN-2 also has an obvious inhibition effect on staphylococcus aureus, mycoplasma hyorhinis and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of drug target screening, and in particular relates to a high-throughput screening method for Streptococcus suis serine protein kinase (HPrK) inhibitors based on chemiluminescence and an application thereof. Background Art

[0002] There are many strategies for the treatment of bacteria, such as vaccines, egg yolk antibodies, and microecological preparations, among which antibiotics are the first choice for prevention and treatment. However, the accumulation and spread of antibiotic resistance in recent years has posed severe challenges to the effectiveness and safety of antibiotic prevention and treatment. The development of new drugs is of great significance, among which the discovery of new drug targets and the screening of inhibitors are important approaches.

[0003] According to previous laboratory research, more than 60 potential antimicrobial drug targets in Streptococcus suis have been identified, mainly including ribosomal proteins, DNA replication proteins, protein secretion systems, carbohydrate uptake and metabolic enzymes and regulatory proteins; among them, bacterial enzymes such as kinases and phosphatases play an important role in the various functions of bacterial cells. At the same time, 71 kinase inhibitors have been approved by the FDA, which shows that kinases are effective drug targets.

[0004] Serine protein kinase HPrK is an important component of bacterial metabolic regulation. Its main function is to phosphorylate HPr to inhibit the utilization of secondary carbon sources and ensure sufficient energy supply for bacteria ( Rev. B,Stülke J.Carboncatabolite repression in bacteria: many ways to make the most out ofnutrients Microbiol.2008Aug.6(8):613-24.HprKXcc is a.HprKXcc is a.Microbiol.2008Aug6(8):613-24.Hpr KXcc is a Environ Microbiol.2019Dec21(12):4504-4520)(Mertins S,Joseph B,Goetz M,Ecke R,Seidel G,Sprehe M,Hillen W,Goebel). W,Müller-AltrockS.Interference of components of the phosphoenolpyruvate phosphotransferase system with the central virulence gene regulator PrfA of Listeriamonocytogenes.J Bacteriol.2007Jan189(2):473-90).Early studies have shown that when the HPrK gene is deleted or mutated, bacteria will have obvious growth defects (Huynh PL, Jankovic I, Schnell NF, Brückner R. Characterization of an HPr kinase mutant of Staphylococcus xylosus. J Bacteriol. 2000 Apr; 182 (7): 1895-902) (Hanson KG, Steinhauer K, Reizer J, Hillen W, Stülke J. HPr kinase / phosphatase of Bacillus subtilis: expression of the gene and effects of mutations on enzyme activity, growth and carbon catabolite repression. Microbiology (Reading). 2002 Jun; 148 (Pt6): 1805-1811). This shows that if an effective inhibitor is found to reduce the activity of HPrK, the growth of bacteria will be inhibited.

[0005] Existing HPrK screening technologies include using bioinformatics computer simulation technology to simulate and dock the molecular model of HPrK protein with the structure of drug compounds, thereby screening for structurally compatible drug inhibitors (Sandeep Kumar, Rajendra Bhadane, Shruti Shandilya, Outi MHSalo-Ahen, Suman Kapila. Identification of HPr kinase / phosphorylase inhibitors: novel antimicrobials against resistant Enterococcus faecalis. Journal of Computer-Aided Molecular Design (2022) 36: 507–520)(Li S, Zhou Y, Yan Y, Qin Y, Weng Q, Sun L. Structure-Based Virtual Screening, ADMET Properties Prediction and Molecular Dynamics Studies Reveal Potential Inhibitors of Mycoplasma pneumoniae HPrK / P. Life (Basel). 2024 May 22; 14(6): 657). However, the disadvantage is that the inhibition efficiency of the compounds obtained by computer simulation in actual experiments cannot achieve the expected effect. At the same time, there are certain differences between simulation technology and actual operation, and the results obtained are also different. In addition, simulation technology requires certain operational learning and takes a certain amount of time.

[0006] Early reports also used compound radioactive in vitro tests to screen inhibitors (Helena Ramstro¨m, Maryline Bourotte, Claude Philippe, Martine Schmitt, Jacques Haiech and Jean-Jacques Bourguignon. Heterocyclic Bis-Cations as Starting Hits for Design of Inhibitors of the Bifunctional Enzyme Histidine-Containing Protein Kinase / Phosphatase from Bacillus subtilis. Journal of Medicinal Chemistry, 2004, Vol. 47, No. 9). However, the experimental operation is complicated and the time is long ago and it is not the latest technology. At the same time, the compound library used for screening has also been updated. In addition to the above method, no other screening technology has been reported so far. Summary of the invention

[0007] The object of the present invention is to provide a simple and efficient high-throughput screening method for targeting Streptococcus suis serine protein kinase (HPrK) inhibitors without complicated operations.

[0008] The present invention also includes the application of the above high throughput screening method, and utilizes the above method to screen out compounds that have an inhibitory effect on Streptococcus suis serine protein kinase (HPrK) and the growth of Streptococcus suis.

[0009] The present invention adopts the following technical scheme: serine protein kinase HPrK as a protein kinase can catalyze the dephosphorylation of ATP into ADP, which is a process of consuming ATP. HPrK inhibitor can inhibit kinase activity and slow down ATP consumption. The entire reaction process can be observed by detecting the change in the amount of ATP to observe the progress of the reaction.

[0010]

[0011] ATP fluorescence detection is a rapid detection technology developed based on the principle of firefly luminescence. Under aerobic conditions, luciferase can catalyze the oxidation reaction between luciferin and ATP to form oxyluciferin and emit fluorescence. The intensity of the emitted fluorescence is directly proportional to the ATP content, so the change in the amount of ATP can be presented through the change in fluorescence intensity.

[0012] 1133 small molecule compounds in the commercial kinase inhibitor library were added to the reaction system respectively, and the drugs with inhibitory effects on HPrK were screened out by detecting the residual luminescence value of the reaction (i.e., the residual ATP content), and their antibacterial spectrum, MIC, and MBC were further analyzed and determined.

[0013] The specific screening method and technical scheme are as follows:

[0014] (1) Add 10 μL of a mixture containing 150 mM NaCl, 10 mM MgCl2, 50 mM (pH 8.0) Tris-HCl, 100 μM HPr, 2 μM HPrK, 80 μM ATP, and 0.5 mM drug dissolved in dimethyl sulfoxide (DMSO) to a black U-bottom 384-well plate, and set up 10 replicates of each positive control and negative control;

[0015] (2) The 384-well plate was incubated at 37°C for 1 h, then cooled at room temperature for 5 min, and 10 μL Reagent, after 10 min of reaction, the luminescence value RLU was measured using an ELISA reader;

[0016] (3) The inhibition rate of the inhibitor enzyme activity was calculated using the following formula: Inhibitor enzyme activity inhibition rate = (chemiluminescence value of the inhibitor to be tested - average chemiluminescence value of the positive group) / (average chemiluminescence value of the negative group - average chemiluminescence value of the positive group);

[0017] (4) According to the above steps, the kinase inhibitor library HY-L001 of MedChem Express was screened to obtain the inhibitor CDK9-IN-2 with an inhibition rate of 99% on HPrK enzyme activity.

[0018] Compared with the prior art, the beneficial effect of the present invention is that the inhibition rate of the targeted Streptococcus suis serine protein kinase inhibitor proposed by the present invention to 2μM HPrK is 99%, which can significantly inhibit the growth of Streptococcus suis. In view of the fact that Gram-positive bacteria such as Staphylococcus aureus, Erysipelothrix rhizogenes, and Mycoplasma suis and Mycoplasma hyopneumoniae all express HPrK kinase protein, the CDK9-IN-2 screened by the present invention can effectively act as a broad-spectrum antibacterial inhibitor to inhibit the growth of these bacteria, and the antibacterial experiment in the wax moth in vivo also proves that CDK9-IN-2 can effectively inhibit the growth of Streptococcus suis in the wax moth and improve the survival rate of the wax moth. The present invention provides strong support for the development of new drugs. In addition, the chemiluminescence screening technology used in the present invention is not only simple and efficient, but also can achieve rapid high-throughput rescreening of new drug libraries in a very short time. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a schematic diagram of the plasmid construction of the present invention.

[0020] Figure 2 To optimize the relevant parameters in the HPrK enzyme activity reaction system. Figure 2 In the figure, Figure A is the linear relationship between ATP concentration and RLU; Figure B is the determination of the optimal ATP concentration; Figure C is the determination of the optimal HPr protein concentration; Figure D is the determination of the optimal HPrK protein concentration; and Figure E is the determination of the optimal reaction time.

[0021] Figure 3 Z-factor determination for high throughput screening methods.

[0022] Figure 4 Figure A in the figure is the inhibition rate of each drug in the drug library; Figure 4 Figure B is the molecular structure formula of the inhibitor CDK9-IN-2 obtained by the method of the present invention.

[0023] Figure 5 The antibacterial activity of the inhibitor CDK9-IN-2 against different bacteria.

[0024] Figure 6 The antibacterial activity of the inhibitor CDK9-IN-2 in G. mellonella. Specific implementation methods

[0026] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principle of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

[0027] Example 1

[0028] Screening steps for the Streptococcus suis serine protein kinase (HPrK) inhibitor CDK9-IN-2.

[0029] 1. Construction of HPrK and HPr recombinant expression plasmids and protein purification:

[0030] The prokaryotic expression vector pET28a was treated with BamHI and SalⅠ, and then purified and recovered by 1% agarose gel electrophoresis. Then, primers were designed using oligo7 software. The genome of Streptococcus suis SC19 (NZ_CP020863) was used as a template. The primers (5'→3') were:

[0031] pET28a-HPr-F:CAAATGGGTCGCGGATCCATGGCTTCAAAAGACTTCC;

[0032] pET28a-HPr-R: GCCGCAAGCTTGTCGACTTATGCCAATCCTTCTTTTT;

[0033] pET28a-HPrK-F:AAATGGGTCGCGGATCCATGACCGTTTATGTGAAAG;

[0034] pET28a-HPrK-R:CGCAAGCTTGTCGACTTAAGCCTCTTCTCTATT.

[0035] Amplify the intracellular domain fragments of HPrK and HPr, and connect the restriction endonuclease vector and PCR fragments with homologous recombinase ( Figure 1 ), transformed into DH5α competent E. coli, cultured overnight at 37°C for several hours, identified positive clones by colony PCR, and sent to relevant commercial sequencing companies for sequencing after extracting plasmids from the bacteria.

[0036] The recombinant plasmid with correct sequencing was transformed into BL21 competent E. coli, and the transformed bacteria were inoculated into LB liquid medium and grown under shaking conditions of 37°C and 160 rpm. 600 When the pH value is between 0.8 and 1.0, 1 mM IPTG is added and the mixture is induced in a shaker at 18°C ​​and 160 rpm for 12 to 14 hours. The supernatant is then removed by centrifuge and the bacteria are resuspended in phosphate buffered saline (PBS) solution. The bacteria are crushed with a high-pressure crusher and the lysed bacterial solution is centrifuged. The supernatant is filtered with a 0.45 μm filter and fully reacted with a nickel column. The nickel column is then eluted with an imidazole-containing buffer using a protein purifier. The collected components are sampled according to the absorption peak at 280 nm and subjected to an SDS-PAGE test to evaluate the purity of the protein. The protein is concentrated using an ultrafiltration tube.

[0037] 2. Establishment of screening method:

[0038] 2.1 Establishment of the standard curve between ATP and luminescence unit RLU

[0039] A 50 μL reaction system contained 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 150 mM NaCl and different concentrations of ATP (three replicates were set for each ATP concentration). The ATP concentrations were 0, 20, 40, 60, 80, 100, 120, 140, 160, 180, and 200 μM. The mixed system was placed in a 37°C incubator. After 30 min, it was cooled to room temperature and commercially available Add 50 μL of Reagent to a 96-well plate for chemiluminescence. After 10 minutes of reaction, measure the luminescence value in an ELISA instrument, and perform linear regression analysis between the luminescence unit RLU and different concentrations of ATP to obtain the correlation coefficient;

[0040] like Figure 2 As shown in Figure A, when the ATP concentration is in the range of 0-200 μM, the luminescence unit RLU is positively correlated with the ATP concentration.

[0041] 2.2 Determination of the optimal ATP concentration

[0042] The 50 μL reaction system contained 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 150 mM NaCl, 10 μM HPr, 1 μM HPrK and different concentrations of ATP (three replicates for each ATP concentration), and the ATP concentrations were 0, 20, 40, 60, 80, 100, 120, 140, 160, 180, and 200 μM. The mixed system was placed in a 37°C incubator for 30 minutes, cooled to room temperature, and a commercial kinase activity detection reagent was added. Add 50 μL of Reagent to a 96-well plate for chemiluminescence and react for 10 minutes. Add a certain amount of HPrK and HPr to the experimental group, and add HPr and an equal amount of distilled water to the control group. Measure the luminescence value in an ELISA instrument to obtain the relationship between the relative luminescence unit difference ΔRLU between the experimental group and the control group and the ATP concentration.

[0043] like Figure 2 As shown in Figure B, the relative luminescence unit ΔRLU value is the largest when the ATP concentration is 80 μM. That is, the optimal ATP concentration is 80 μM.

[0044] 2.3 Determination of the optimal substrate HPr protein concentration

[0045] A 50 μL reaction system contained 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 150 mM NaCl, 1 μM HPrK, 80 μM ATP, and different concentrations of HPr (three replicates were set for each HPr concentration). The HPr concentrations were 0, 10, 20, 40, 60, 80, 100, 120, 140, 160, 180, and 200 μM, respectively. The mixed system was placed in a 37°C incubator. After 30 min, it was cooled to room temperature and commercially available Reagent 50μL was added to a 96-well plate for chemiluminescence and reacted for 10 minutes. The experimental group was added with the above system, and the control group was not added with HPrK, but with an equal amount of distilled water. The luminescence value was measured in an ELISA instrument to obtain the relationship between the relative luminescence unit difference ΔRLU between the experimental group and the control group and the HPr concentration.

[0046] like Figure 2 As shown in Figure C, when the ATP concentration is determined to be 80 μM as the optimal concentration, the relative luminescence unit ΔRLU value is the largest when the HPr concentration is 100 μM. That is, the optimal HPr concentration is 100 μM.

[0047] 2.4 Determination of the optimal kinase HPrK protein concentration

[0048] The 50 μL reaction system contained 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 150 mM NaCl, 80 μM ATP and 100 μM HPr and different concentrations of HPrK (three replicates were set for each HPrK concentration). The HPrK concentrations were 0, 0.5, 1, 2, 4, 6, 8, 10, and 12 μM. The mixed system was placed in a 37°C incubator for 30 min, cooled to room temperature, and then commercially available Reagent 50μL was added to a 96-well plate for chemiluminescence and reacted for 10 minutes. The experimental group was added with the above system, and the control group was not added with HPrK, but with an equal amount of distilled water. The luminescence value was measured in an ELISA instrument to obtain the relationship between the relative luminescence unit difference ΔRLU between the experimental group and the control group and the HPrK concentration.

[0049] like Figure 2 As shown in Figure D, when the optimal concentration of ATP is 80 μM, the optimal concentration of HPr is 100 μM, and the concentration of HPrK is 2 μM, the relative luminescence unit ΔRLU value is the largest, that is, the optimal HPrK concentration is 2 μM.

[0050] 2.5 Determination of the optimal response time

[0051] A 50 μL reaction system contained 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 150 mM NaCl, 80 μM ATP, 100 μM HPr, and 2 μM HPrK. The mixed system was placed in a 37°C incubator for different reaction times (three replicates were set for each time), with a time gradient of 0 h, 0.1 h, 0.25 h, 0.5 h, 0.75 h, 1 h, 1.5 h, and 2 h. After cooling to room temperature, commercial Reagent 50μL was added to a 96-well plate for chemiluminescence and reacted for 10 minutes. Different reaction time groups were set up and the different time groups were compared with each other. Each group was divided into an experimental group and a control group: the optimal concentration of ATP, HPr and HPrK was added to the reaction system of the experimental group, and only the optimal concentration of ATP, HPr and an equal amount of distilled water were added to the control group. The luminescence value was measured in an ELISA instrument to obtain the relationship between the relative luminescence unit difference ΔRLU between the experimental group and the control group and the reaction time.

[0052] like Figure 2 As shown in Figure E, when the optimal concentration of ATP is 80 μM, the optimal concentration of HPr is 100 μM, and the optimal concentration of HPrK is 2 μM, the relative luminescence unit ΔRLU value is the largest after 1 hour of reaction. That is, the optimal reaction time is 1 hour.

[0053] The above experiments show that in the HPrK enzyme activity reaction system, the optimal ATP concentration is 80 μM, the optimal HPr protein concentration is 100 μM, the optimal HPrK protein concentration is 2 μM, and the optimal reaction time is 1 h.

[0054] 2.6 Calculation of Z-factor

[0055] A control group and an experimental group were set up in a 10 μL reaction system: 80 μM ATP, 100 μM HPr and 2 μM HPrK were added to the experimental group, and 80 μM ATP, 100 μM HPr and an equal volume of distilled water were added to the control group. 100 repeated experiments were set up for each group. After reacting at 37°C for 1 hour, the luminescence value of each replicate was measured, and then the Z-factor was calculated.

[0056] Z factor = 1-[(3×SD N +3×SD P ) / (AVG N -AVG P )].

[0057] Among them, AVG P Represents the average of 100 luminescence values ​​of the test group, AVG N represents the average of 100 luminescence values ​​of the control group;

[0058] SD P The standard deviation of the 100 luminescence values ​​of the experimental group, SD N The standard deviation among 100 replicates of the control group is shown.

[0059] The value of Z-factor ranges from -1 to 1. The closer the Z-factor is to 1, the better the repeatability of the experiment and the more obvious the effect. The closer the Z-factor is to -1, the worse the repeatability of the experiment and the less obvious the effect. A Z-factor of 0 means that the repeatability of the experiment is average.

[0060] like Figure 3 As shown, the Z value is 0.82, which indicates that the experiment in this embodiment has good repeatability and obvious effect.

[0061] 2.7 Comprehensive Analysis

[0062] Based on the determination of the above optimal conditions, the present invention finally determined that the reaction system for determining the HPrK enzyme activity was a mixed system of 80 μM ATP concentration, 100 μM HPr, and 2 μM HPrK, and the reaction time was 1 hour. The measured Z-factor was 0.82, and the present invention met the high-throughput screening method standard (0.5 <Z-factor<1)。

[0063] 2.8 Screening of target inhibitors

[0064] (1) The experimental group was a mixture of 10 μL of enzyme activity reaction solution containing a final concentration of 150 mM NaCl, 10 mM MgCl2, 50 mM (pH 8.0) Tris-HCl, 100 μM HPr, 2 μM HPrK, 80 μM ATP, and 0.5 mM inhibitor dissolved in dimethyl sulfoxide (DMSO) in a black U-bottom 384-well plate. A positive control with kinase added and a negative control without kinase added were set up. Each experiment was repeated 10 times.

[0065] (2) The 384-well plate was incubated at 37°C for 1 h, then cooled at room temperature for 5 min, and 10 μL Reagent kinase activity detection reagent, after 10 minutes of reaction, the luminescence value RLU was measured using an enzyme reader.

[0066] (3) The inhibition rate of the inhibitor enzyme activity was calculated using the following formula:

[0067] Inhibitor enzyme activity inhibition rate = (chemiluminescence value of the inhibitor to be tested - average chemiluminescence value of the positive group) / (average chemiluminescence value of the negative group - average chemiluminescence value of the positive group).

[0068] (4) According to the above steps, the kinase inhibitor library HY-L001 (such as Figure 4 The 1133 inhibitors shown in A in Figure 1 were screened to obtain the inhibitor CDK9-IN-2 with an inhibition rate of 99% on HPrK enzyme activity. Figure 4 As shown in Figures A and B in the figure, the compound is named N2-(trans-4-aminocyclohexyl)5-chloro-N6-(3-fluorobenzyl)-[2,4-bipyridine]-2,6-diamine.

[0069] The purpose of the above steps is to establish a suitable enzyme activity reaction system so that the enzymatic reaction reaches a stable state, so that the inhibitory efficiency of the kinase HPrK inhibitor on the kinase can be verified. The content of kinase HPrK in bacteria is not high. If the kinase HPrK set in the above enzyme activity reaction system is too high, it is possible that the inhibitor that can originally inhibit bacteria will be ineffective due to the excessive HPrK in vitro and will be excluded.

[0070] Therefore, the enzyme activity reaction system used for inhibitor screening in the above steps is an experiment set up based on the activity of a kinase (HPrK) in bacteria, taking the kinase as a drug target, screening inhibitors through the target, and then conducting antibacterial or bactericidal experiments on live bacteria. Based on the above enzyme activity reaction system, the best inhibitor CDK9-IN-2 with an inhibition rate of 99% was screened for the kinase HPrK at 2 μM.

[0071] The class of compounds that respond to kinases to be screened in this step has been disclosed in patents CN102482218B and CN101568529A. The above patents both propose that the compounds have the function of regulating or inhibiting protein kinases.

[0072] 2.9 Determination of antibacterial activity of inhibitors

[0073] The inhibitor CDK9-IN-2 screened in the above experiment was tested for the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of different bacteria. Experimental group: In a 96-well plate, 100 μL of culture medium containing different concentrations of inhibitor drugs was mixed with 1×10 6 CFU / mL of different bacteria were incubated at 37°C for 18-20 hours, and the concentration of inhibitors was set to 1, 2, 4, 8, 16, 32, 64, and 128 μg / mL. Positive control group: In a 96-well plate, 100 μL of 1×10 6 Different bacteria with different CFU / mL were mixed with 100μL culture medium. Drug negative control group: In a 96-well plate, 100μL of drugs with different concentrations were mixed with 100μL culture medium. Blank control group: In a 96-well plate, only 200μL culture medium was added.

[0074] 50 μL of the drug and bacteria mixture that may reach the minimum inhibitory concentration (MIC) in the 96-well plate was taken out and added to the solid agar medium. After incubation for 24 hours, the growth of bacteria on the solid medium was observed for the first time. When there is no bacterial growth at a certain concentration, it means that the drug concentration may have reached or exceeded the minimum bactericidal concentration (MBC). In order to accurately determine the MBC, it is necessary to repeat this operation at multiple concentrations close to the MIC and find the lowest sterile growth concentration. During this test, for Mycoplasma hyorhinis, the concentration of the bacterial suspension used in the test was 1×10 4 CCU.

[0075] like Figure 5 Shown are the results of determining the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the inhibitor CDK9-IN-2 against different bacteria.

[0076] 2.10 Determination of the antimicrobial activity of inhibitors in G. mellonella

[0077] The method of infecting the larvae of G. mellonella with Streptococcus suis is as follows: 1×10 6 The CFU of Streptococcus suis in the logarithmic growth phase was inoculated on the second to last abdominal foot of the left side of the larvae (10 in each group), and then the second to last abdominal foot of the right side (10 in each group) was injected with 0, 8, and 16 mg / kg·bw of CDK9-IN-2. The control group was injected with normal saline and was not infected with Streptococcus suis (Mock). The survival rate of the larvae was recorded every 6 hours and observed continuously for 78 hours. Figure 6 As shown, Figure A shows the survival curves of four groups of G. wax moth, and Figure B shows the survival status of G. wax moth after 24 hours.

Claims

1. A Streptococcus suis serine protein kinase HPrK inhibitor CDK9-IN-2, characterized in that: The structural formula is as follows: The molecular formula is C 23 H 25 ClFN5; molecular weight is 425.

93.

2. Use of the inhibitor CDK9-IN-2 according to claim 1 in antibacterial treatment.

3. Use of the inhibitor CDK9-IN-2 according to claim 1 in antibacterial treatment, characterized in that: The antibacterial property is to inhibit the growth of Gram-positive bacteria.

4. The use according to claim 3, characterized in that: The Gram-positive bacteria include Streptococcus suis.

5. An antibacterial drug, characterized in that: Comprising the inhibitor CDK9-IN-2 according to claim 1.

6. The use according to claim 2, characterized in that: The inhibitor CDK9-IN-2 was obtained by the following screening method: (1) The experimental group was a mixture of different inhibitors dissolved in dimethyl sulfoxide added to the enzyme activity reaction solution, and the enzyme activity reaction solution included kinase. A positive control with kinase added and a negative control without kinase added were set up at the same time. Each experiment was repeated 10 times. (2) The culture plate was incubated at 37°C for 1 hour, then taken out and cooled at room temperature for 5 minutes, 10 μL of kinase activity detection reagent was added, and after reacting for 10 minutes, the luminescence value RLU was measured using an ELISA reader; (3) Calculate the inhibition rate of the inhibitor enzyme activity: Inhibitor enzyme activity inhibition rate = (chemiluminescence value of the inhibitor to be tested – average chemiluminescence value of the positive group) / (average chemiluminescence value of the negative group – average chemiluminescence value of the positive group); Select the kinase inhibitor with the highest inhibition rate under the conditions of the enzyme activity reaction solution.

7. The use according to claim 6, characterized in that: The enzyme activity reaction solution of step (1) is added to a black U-bottom 384-well plate, and 10 μL of the enzyme activity reaction solution is added to each well plate, comprising a mixed system consisting of 150 mM NaCl, 10 mM MgCl2, 50 mM Tris-HCl at pH 8.0, 100 μM HPr, 2 μM HPrK and 80 μM ATP, and 0.5 mM of different inhibitors.

Images