Use of compound c4 in the preparation of a medicament for treating gastric cancer

Abstract

The present application relates to the application of compound C4 in the preparation of a drug for treating gastric cancer. The present application first proposes the possibility of new indications of compound C4 in the treatment of gastric cancer. Through further conversion research, the treatment level of gastric cancer epigenetic targeted drugs can be improved, and the prognosis of patients can be improved.

Description

Technical Field

[0001] This invention belongs to the field of cancer treatment, and specifically relates to the application of compound C4 in the preparation of drugs for treating gastric cancer. Background Technology

[0002] Gastric cancer (GC) is one of the most common malignant tumors of the digestive tract and a leading cause of cancer death. Traditional treatments for GC include surgery and chemotherapy. With advancements in DNA sequencing technology, multi-omics integration, and precision oncology, molecular targeted therapy, immunotherapy, and epigenetic therapy have shown immense therapeutic potential. Epigenetics is crucial for the various modifications made to histones and nucleic acids, which synergistically regulate chromatin structure and gene expression. Dysregulation of epigenetic modulators drives abnormal transcriptional processes, leading to cancer development and progression. Therefore, targeting epigenetic regulators has become a focus of cancer treatment research. In-depth exploration of epigenetic therapeutic targets and their clinical translation are of great significance for improving the prognosis of GC patients. Summary of the Invention

[0003] The technical problem to be solved by this invention is to provide the application of compound C4 in the preparation of drugs for treating gastric cancer. It proposes for the first time the possibility of a new indication for the treatment of gastric cancer using compound C4. Through further translational research, it will help improve the treatment level of epigenetic targeted drugs for gastric cancer and improve patient prognosis.

[0004] This invention proposes the application of compound C4 in the preparation of drugs for treating gastric cancer, wherein the structural formula of compound C4 is:

[0005] From Chemdiv, ID 3253-2867.

[0006] Preferably, compound C4 inhibits cell proliferation by effectively targeting KLF4-SIN3A binding.

[0007] Preferably, the drug further comprises a pharmaceutically acceptable carrier and / or excipients.

[0008] More preferably, the pharmaceutically acceptable carrier and / or excipient includes at least one of diluents, binders, surfactants, humectants, adsorbents, lubricants, fillers, and disintegrants.

[0009] Preferably, the dosage form of the drug includes at least one of tablets, pills, powders, solutions, suspensions, emulsions, and granules.

[0010] Preferably, the effective therapeutic dose concentration of the drug is 5 mg / kg.

[0011] Preferably, the method of administration of the drug includes intravenous injection.

[0012] Beneficial effects

[0013] This invention first confirms that SIN3A is associated with high malignancy and poor prognosis in gastric cancer patients and can promote the proliferation and growth of gastric cancer cells. Secondly, through a series of molecular and cell biological studies, it demonstrates that SIN3A promotes cell proliferation and thus promotes gastric cancer growth by forming the SIN3A / HDAC1 / KLF4 complex, inhibiting KLF4 acetylation, and reducing the inhibition of cell cycle-related gene transcription by KLF4. Subsequently, this invention deduced the KLF4-SIN3A binding site PAH3 through molecular experiments and used computer algorithms to simulate the local spatial structure of PAH3. Based on the occupancy fraction at the PAH3 site, C4 with ID 3253-2867 was screened from the Chemdiv database. This compound had an IC50 of less than 10 μM in gastric cancer cell lines within 24 hours. Cell experiments confirmed that the efficacy of C4 was positively correlated with SIN3A expression, and IP experiments confirmed that C4 could inhibit SIN3A-KLF4 binding at effective concentrations. In terms of safety, this study used rats to conduct pharmacokinetic tests on C4, which confirmed that C4 was rapidly cleared from the body and had a short residence time, with a half-life of 0.62 hours. Acute toxicity tests were conducted in mice, and the results showed that the effective therapeutic dose concentration of C4, 5 mg / kg, was far below the median lethal dose concentration. Further pharmacodynamic evaluation of C4 was conducted in patient-derived organoids (PDOs) and patient-derived xenografts (PDXs), and compared with traditional HDAC inhibitors Voronostat and Panobinostat. The results showed that gastric cancer PDOs became more sensitive to C4 with increasing SIN3A expression levels. C4 reduced the proportion of KI67-positive cells in PDXs, and its anti-tumor effect was comparable to that of traditional HDAC inhibitors. Based on this, this invention proposes a novel indication for C4 treatment of gastric cancer for the first time. Further translational research will help improve the therapeutic level of epigenetic targeted drugs for gastric cancer and improve patient prognosis. Attached Figure Description

[0014] Figure 1This study displays the levels of SIN3A and their associated survival prognosis in patients. A shows the expression levels of SIN3A in gastric cancer tumor tissues and non-tumor tissues as detected by Western blotting; B shows representative IHC staining images of SIN3A in gastric cancer tumor tissues and non-tumor tissues, scale bar 100 μm (200X) and 40 μm (400X); C shows the percentage of IHC staining intensity; D shows the overall survival rate of gastric cancer patients with different SIN3A expression levels in tumor tissues; E shows the overall survival rate of gastric cancer patients with different SIN3A expression levels in the GSE54129 database; and F shows the overall survival rate of gastric cancer patients with different SIN3A expression levels in the TCGA database. **p<0.01, ****p<0.0001.

[0015] Figure 2 This study demonstrates that SIN3A promotes the growth of gastric cancer cells in vitro and in vivo. A shows cell proliferation as measured by CCK-8 assay; B shows cell proliferation as measured by colony formation assay; C shows GSEA analysis of cell cycle based on different SIN3A expression groups using the TCGA database; D shows cell cycle detection by flow cytometry; EG shows images and quantification (tumor volume at specified time and tumor weight at the endpoint) of subcutaneous tumors formed by HGC27 / NC, HGC27 / shSIN3A, MKN45 / vector, and MKN45 / oeSIN3A transplanted into nude mice. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Figure 3The results show that the SIN3A / HDAC1 complex inhibits the regulation of downstream cell cycle-related genes by KLF4 through binding to the TSS region; A shows the KLF4 binding peak distribution in the AGS / NC and AGS / shSIN3A groups; B shows the KLF4 binding peak distribution heatmap in the AGS / NC and AGS / shSIN3A groups; C shows the distribution of the KLF4 binding peak in the TSS region in the AGS / NC and AGS / shSIN3A groups; D shows the KLF4 binding peak distribution heatmap in the TSS region in the AGS / NC and AGS / shSIN3A groups; E shows the KEGG analysis of the KLF4 binding peak in the GS / NC group; F shows the KEGG analysis of the KLF4 binding peak in the AGS / shSIN3A group; G shows the differential KLF4 binding peaks in the AGS / NC and AGS / shSIN3A groups located in chromatin distribution; H shows the differential KLF4 binding peaks in the AGS / NC and AGS / shSIN3A groups. KEGG enrichment of peaks; IJ indicates qPCR detection of KLF4 downstream binding gene expression in AGS / NC, AGS / shSIN3A, HGC27 / NC, and HGC27 / shSIN3A groups; KL indicates ChIP-qPCR detection of KLF4 downstream binding gene expression in AGS / NC and AGS / shSIN3A cells; M indicates dual-luciferase reporter gene assay showing that transfection of P300, HDAC1, or SIN3A into the cells indicated did not change the transcription level of the downstream gene HDAC1; N indicates dual-luciferase reporter gene assay showing that transfection of KLF4 / KLF4-MUT1, P300, SIN3A, and HDAC1 increased the transcription level of HDAC1, while KLF4-MUT2 did not change the transcription level of HDAC1, and in HDAC1-mut cells, none of the three KLF4 plasmids changed the transcription of HDAC1. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001

[0016] Figure 4 The results show the identification and characterization of drugs targeting SIN3A-KLF4 and the validation of their pharmacokinetics. A represents plasmid mapping; B represents the FLAG (flag) of the above samples detected by Western blotting; C represents the IP experiment (i-FLAG) of the above samples; D represents the inhibition rate of the above cell lines after treatment with compound C4 (6 μM) for 24 h; E represents the IC50 of compound C4 in the above cell lines; F represents computer-aided competitive binding of compound C4 to the SIN3A-KLF4 binding site; G represents the effects of the above drugs in the above cell lines detected by Western blot and IB; H represents the IP experiment showing that compound C4 blocks the interaction between SIN3A and KLF4. *p<0.05, **p<0.01, ***p<0.001.

[0017] Figure 5 The study demonstrates the antitumor effects of compound C4 as confirmed by in vitro and in vivo experiments. A shows the expression levels of SIN3A and KI67 in PDO detected by IF (scale bar 20 μm); B shows representative images of PDO treated with compound C4 and corresponding IC50 values ​​(scale bar 100 μm); CD shows the tumors removed and weighed after euthanasia in each group of PDX mice, with subcutaneous tumor size recorded by calipers every 7 days after inoculation; E shows the tumor inhibition rate of compound C4 in two PDX patients; F shows representative images of HE, SIN3A, and KI67 staining in two PDX tumor tissues (scale bar 50 μm); G shows the IC50 values ​​of Vorinostat and Panobinostat in gastric cancer cell lines; H shows representative images of PDX tumors treated with Vorinostat and Panobinostat in each group; I shows the tumors removed and weighed after euthanasia in mice; J shows the subcutaneous tumor size measured by calipers every 7 days after inoculation; K shows the tumor inhibition rates of Vorinostat and Panobinostat in two PDX patients. *p<0.05, **p<0.01, ****p<0.0001. Detailed Implementation

[0018] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0019] The experimental procedures involved in this invention are as follows:

[0020] Cell cycle assay

[0021] Seed cells into six-well plates and pre-treat at least one day in advance. Transfer cells to flow cytometry tubes, centrifuge at 1500×g for 5 min, and wash 2-3 times with PBS. Discard the supernatant, add 1 mL of PBS to each tube, and slowly add 3 mL of pre-chilled anhydrous ethanol. Incubate overnight at 4°C. The next day, wash 2-3 times with pre-chilled PBS. After the final centrifugation, add 300 μL of cycle reagent to each tube containing 100 μL of liquid, and incubate at 37°C for 30 min. After incubation at room temperature in the dark, perform flow cytometry analysis.

[0022] Cell viability assay

[0023] Cell viability was assessed using a CCK8 assay kit. Cells were seeded in 96-well plates containing 200 μl of RPMI-1640 medium at a density of 2 × 10⁶ cells / well. 3Cells / well. On the second day after inoculation, discard the original culture medium and add 100 μl of RPMI-1640 medium containing 10% CCK-8 solution to each well. Then incubate the cells at 37°C for 2 hours. Measure the absorbance at specified time points using a 450 nm microplate reader.

[0024] Drug screening

[0025] The OpenEye Apopdb2receptor tool was used to process and generate the OEDock virtual screening receptor file. Within the receptor, the docking region was defined using MOE-SiteFinder, with length, width, and height of [missing information]. To ensure that all possible conformations of each compound could dock with the acceptor, the 3D conformations of the compounds were generated using the omega2 plugin in OpenEye software. Molecular docking was performed using the OEDock program, and virtual screening was conducted using three compound databases: ChemDiv, Targetmol L1000, and TargetMol L6020. These databases underwent molecular washing to remove impurities such as salts, metal ions, and small fragments. The 3D structures of all compounds were generated through energy minimization, and then all compounds were protonated and charged using the AMBER10-EHT force field. To ensure that all possible conformations of the compounds participated in molecular docking, multiple conformations of the compounds were generated using the omega2 plugin (Ver 3.0.1.2) in OpenEye software, with no more than 50 conformations generated for each compound. Finally, three multi-conformation files for each database were saved, containing the 3D structure, compound information, and ID.

[0026] Dual-luciferase reporter gene assay

[0027] The full-length sequences of the HDAC1 and HDAC1-MUT promoters were synthesized and incorporated into the PGL3-BASIC plasmid. The pcDNA3.1 plasmid, PGL3- plasmid, and PRL-TK plasmid were transfected into HEK293T cells using Lipofectamine 3000 transfection reagent (Invitrogen). Dual-luciferase reporter gene assays were performed three days post-transfection.

[0028] IC50 Calculation

[0029] Cells were seeded at a density of 10,000 cells per well (200 μL per well) into 96-well plates. The drug was added to the cells using ten serial 2-fold dilutions. After 48 hours of culture, the cells were incubated with CCK-8, and absorbance was determined at 450 nm (OD450). Drug concentrations were converted to Log10 values, and cell viability was normalized based on the OD450 value of cells with 0 mg / ml of drug. IC50 values ​​were calculated after nonlinear regression analysis using GraphPad Prism.

[0030] GSEA Analysis

[0031] Gene set enrichment analysis (GSEA) was performed to identify significantly enriched pathways based on the MSIGDB database (C2.CP.Kegg.v7.2.2.symbols.gmt gene set). The R package GPLOT2 plotted the top 20 positively correlated pathways.

[0032] Immunohistochemistry (IHC)

[0033] Tissue was fixed in 4% paraformaldehyde and embedded in paraffin. The paraffin-coated tissue blocks were dehydrated, and the water was combined for antigen retrieval. After washing, slides were treated with 3% hydrogen peroxide for 15 minutes and washed with BSA for 15 minutes at room temperature. Subsequently, anti-SIN3A antibody (1:1200) and anti-KI67 antibody (1:400) were added to the sections and incubated overnight at 4°C. The streptavidin peroxidase method was used for signal detection, followed by staining with diaminoaniline (DAB) and hematoxylin anti-staining. The sections were observed and photographed under an optical microscope.

[0034] Immunoprecipitation (IP)

[0035] Immunoprecipitation was performed using the Pierce Crosslinked IP / CO-IP Kit (88805, Thermo). Antibodies against SIN3A and KLF4 (10 μg) were covalently linked to magnetin A / G beads as immunoprecipitation antibodies. Finally, the antigens were eluted and Western blotted, and antibodies against SIN3A, KLF4, RUNX1, KLF5, HDAC1, HDAC2, P300, and KLF4-AC were used for analysis.

[0036] Lentiviral transduction

[0037] For SIN3A knockdown, the target shRNA sequence was subcloned into the ZV102 shRNA lentiviral vector (U6-shRNA-PGK-PURO). The SIN3A shRNA knockdown sequence is as follows:

[0038] “GATCCGGTGGAACAGAATCGTTATTTCTTCCTGTCAGAAAATAACGATTCTGTTCCACC TTTTTG”. The full-length human SIN3A cDNA was subcloned into the FV026 lentiviral vector.

[0039] Analysis of hematoxylin and eosin (H&E)

[0040] Mouse tumors were fixed with 4% paraformaldehyde. Paraffin-embedded samples were stained with H&E (Sigma). The stained sections were observed and photographed under a microscope.

[0041] Construction of patient-derived organoid (PDO) models

[0042] Tumor and paired non-tumor tissue were removed from gastric cancer patients and washed with PBS to remove fat and connective tissue. The tissue was cut into 2 mm fragments with a scalpel and washed repeatedly with PBS. The remaining clear tissue was digested with PBS + EDTA (2 mM) at 4°C for 20 minutes with agitation. The tissue was collected, resuspended in 10 mL PBS, and repeatedly filtered through a 70 μm cell filter. The supernatant was discarded by centrifugation, and 100 μL of Matrigel was added to the pellet. Approximately 500 to 1000 cells were seeded into each well of a preheated 96-well plate, containing 20 μL of Matrigel. Add 0.1 mL of organoid culture medium to each well, consisting of advanced DMEM / F12+ serum-free B27, N2, N-acetylcysteine, recombinant mouse epidermal growth factor (EGF 50 ng / mL), Noggin (100 ng / mL), R-Spondin (1 μg / mL), Glutamax-I supplement (1:100), penicillin / streptomycin (400 μg / mL), and HEPES (10 μM). Cultures were incubated in a humidified incubator at 37°C with 5% CO2.

[0043] Construction of patient-derived xenotransplantation (PDX) models

[0044] Fresh gastric cancer tissue was collected, washed three times with PBS containing 1× penicillin / streptomycin, and then adipose tissue, connective tissue, and gastric mucus were removed. The tumor tissue was then cut into 1-2 mm fragments with sterilized scissors and subcutaneously inoculated into nude mice to establish a PDX model.

[0045] Acute toxicity of C4 in mice

[0046] Compound C4 was accurately weighed at doses of 17.5 mg (50 mg / kg group), 14 mg (40 mg / kg group), 11.2 mg (32 mg / kg group), 8.75 mg (25 mg / kg group), and 7 mg (20 mg / kg group), and 3.5 mL of solution was prepared using 20% ​​DMSO + 30% PEG 400 + 50% PBS buffer (containing 20% ​​hydroxypropyl-β-cyclodextrin) pH=8. Fifty ICR mice were randomly divided into 5 groups, with 10 males and half females in each group. Mice were injected intravenously via tail vein with C4 at doses of 20, 25, 32, 40, and 50 mg / kg, respectively. Mice mortality was observed and recorded within 24 hours.

[0047] Pharmacokinetics of C4 in rats

[0048] Accurately weigh 12.5 mg of C4 and prepare 8.0 mL of drug solution using 20% ​​DMSO + 20% PEG 400 + 60% PBS buffer (containing 20% ​​hydroxypropyl-β-cyclodextrin) pH=8. Administer the drug intravenously at 5 mg / kg. Collect whole blood in heparinized tubes at 2, 5, 10, 20, 30, 45 min, and 1, 2, and 4 h after administration. Centrifuge at 8000 rpm for 5 min to separate the plasma, and store at -20℃ for later analysis. Take 30 μL of drug-containing rat plasma, add 30 μL of 20 ng / mL internal standard diazepam and 60 μL of acetonitrile, shake for 5 min, centrifuge at 12,000 rpm, 4℃ for 10 min, and collect 60 μL of the supernatant in a 5 μL sample vial.

[0049] RNA extraction and quantitative real-time PCR (RT-PCR)

[0050] Cells were lysed using TRIzol reagent, and total RNA was extracted using chloroform and isopropanol. cDNA was synthesized using a reverse transcription kit according to the manufacturer's protocol, and RNA levels were relatively quantified using the SYBR Green Master Mix Kit. GAPDH was selected as an internal control, and its expression level was normalized to the internal control and determined using the 2-ΔΔCT method.

[0051] Protein blot

[0052] Cells were lysed in RIPA buffer on ice after washing with PBS. Protein concentration was quantified using a BCA protein assay kit. Subsequently, equal volumes of protein were separated by SDS-PAGE and transferred to a PVDF membrane. The membrane was blocked with 5% skim milk for 1 hour and incubated overnight with primary antibody at 4°C. After washing three times with TBST, the membrane was incubated with secondary antibody at room temperature for 1 hour and washed again. The blot was visualized using a chemiluminescence assay kit.

[0053] xenograft tumor model

[0054] Xenograft models were constructed using four- to six-week-old male BALB / c nude mice. 5 × 10 6 HGC27 / NC, HGC27 / shSIN3A, MKN45 / vector, and MKN45 / oeSIN3A cells were suspended in 0.1 mL of PBS and injected subcutaneously into nude mice. Tumor growth was assessed after seven days, and monitoring was performed every seven days. Tumor volume (mm3) was determined by measuring the longest diameter (a) and shortest width (b) and calculated using the following formula: volume(mm3) 3 )=0.5×a×b 2 .

[0055] Example 1

[0056] SIN3A levels and survival prognosis in patients

[0057] (1) Study Subjects: Tumor and adjacent non-tumor tissue specimens were collected from 95 gastric cancer patients who underwent D2 gastrectomy at the Department of Gastrointestinal Surgery of our hospital. Patients who had received preoperative treatments such as radiotherapy or chemotherapy were excluded from the study. All samples were obtained with the approval of the Ethics Committee of Ruijin Hospital affiliated to Shanghai Jiao Tong University School of Medicine and with the informed consent of the patients. General information, tumor grade, survival prognosis and other relevant data of the patients were collected. Data from the public database TCGA-STAD and our hospital's previous cohort GSE54129 were used.

[0058] (2) Detection steps: Western blot detection, IHC staining, and survival analysis.

[0059] (3) Detection results: SIN3A expression in gastric cancer tissues was higher than that in paired normal tissues, and expression in high-grade tumors was higher than that in low-grade tumors. Patients with high SIN3A expression had a poorer survival prognosis. Figure 1 AF).

[0060] Example 2

[0061] SIN3A can promote the growth of gastric cancer cells both in vivo and in vitro.

[0062] (1) Experimental subjects: human gastric cancer AGS cells, SGC7901 cells, GES1 cells, HGC 27 cells, NCI-N87 cells, HS746T cells, MKN45 cells, MGC803 cells and FU97 cells.

[0063] (2) Detection steps: The expression level of SIN3A in gastric cancer cells and immortalized gastric epithelial cells was detected by Western blotting. NC / shSIN3A / oeSIN3A cell lines were constructed by lentiviral transfection. Cell proliferation was measured by CCK-8 assay and colony formation assay. GSEA analysis based on differential expression of SIN3A was performed using the TCGA database. Cell cycle was detected by flow cytometry. Subcutaneous tumor models of nude mice with HGC27 / NC, HGC27 / shSIN3A, MKN45 / vector, and MKN45 / oeSIN3A were constructed and their size and weight were measured.

[0064] (3) Results: Decreased SIN3A expression significantly inhibited the proliferation of AGS and HGC27 cells, while SIN3A overexpression promoted the proliferation of MKN45 and HS-746T cells. Gene set enrichment analysis (GSEA) showed a positive correlation between cellular SIN3A levels and cell cycle pathways. Flow cytometry analysis showed that silencing SIN3A led to a decrease in the proportion of cells in S phase and a significant increase in the proportion of cells in G1 phase, while SIN3A overexpression promoted G1 / S transition. Xenograft (CDX) models derived from cell lines were constructed, revealing that tumors formed in the HGC27 / shSIN3A group were significantly smaller than those formed in the HGC27 / NC group (p<0.0001) and had a lower average weight (p=0.0023). Similarly, tumors formed in the MKN45 / oeSIN3A group were significantly larger than those formed in the MKN45 / vector group (p<0.0001) and had a higher average weight (p=0.0247). IHC results showed that SIN3A knockdown led to downregulation of KI67 expression, while SIN3A overexpression led to upregulation of KI67 expression. These findings suggest that SIN3A plays a carcinogenic role in GC. Figure 2 AG)

[0065] Example 3

[0066] The SIN3A / HDAC1 complex inhibited the regulation of downstream cell cycle-related genes by KLF4 by binding to the TSS region. (1) Experimental subject: human gastric cancer AGS cells.

[0067] (2) Detection steps: AGS / NC and AGS / shSIN3A cell lines were constructed using lentivirus. KLF4 transcription factor cut & tag detection, regulatory gene annotation, KEGG enrichment analysis, and differential peak analysis were performed on the AGS / NC and AGS / shSIN3A cell lines. ChIP-qPCR was used to detect the binding ability of KLF4 and HDAC1 in the AGS / NC and AGS / shSIN3A cell lines, and dual-luciferase reporter gene assay was used to find the binding site of KLF4 on HDAC1.

[0068] (3) Detection results: CUT & Tag-seq indicated that the SIN3A / HDAC1 complex inhibited the binding ability of KLF4 to the TSS region. KEGG enrichment analysis of KLF4-binding genes showed that cell cycle-related pathways were significantly enriched in both groups. In AGS / shSIN3A cells, the chromatin opening levels of differentially regulated cell cycle-related genes CDC6, BUB3, YWHAZ, HDAC1, MCM3, CDKN2A, CDKN2D, and YWHAE were significantly increased. Compared with AGS / NC, the transcription level of HDAC1 in the AGS / shSIN3A group was significantly downregulated (p<0.05), and ChIP-qPCR showed that the binding ability of KLF4 to HDAC1 was significantly enhanced in the AGS / shSIN3A group. When HEK293T / HDAC1-WT cells were transfected with KLF4 / KLF4-MUT1, P300, SIN3A, and HDAC1, the transcriptional level of HDAC1 was significantly increased, while this effect was not observed in HEK293T / HDAC1-mut cells, indicating that the mutation site in the HDAC1 promoter region is the KLF4 binding site. Figure 3 AN).

[0069] Example 4

[0070] Identify and characterize drugs targeting SIN3A-KLF4, and validate their pharmacokinetics and safety.

[0071] (1) Experimental subjects: Chemdiv, approved drug and natural compound database, mice and rats.

[0072] (2) Detection Procedure: Based on the SIN3A domain, the full-length -SIN3A-FLAG plasmid (1-1273aa) and six truncated SIN3A-FLAG plasmids were transfected into HEK293T cells. Anti-FLAG IP assays were used to identify key binding sites between SIN3A and KLF4. Computer algorithms were used to simulate the local spatial structure of the SIN3A-KLF4 binding site PAH3. Over 1.5 million drugs were screened from Chemdiv, approved drug, and natural compound databases and ranked according to their occupancy fraction at the PAH3 site. The top 200 drugs and eight compounds from natural products were used to verify their actual inhibitory effects on cell growth, whether they were positively correlated with SIN3A expression, and whether they could inhibit SIN3A-KLF4 binding at effective concentrations. The pharmacokinetics and effective therapeutic dose of C4 were detected by tail vein injection in mice.

[0073] (3) Detection results: Anti-FLAG IP assay showed that the PAH3 site is a key binding site for SIN3A and KLF4. The IC50 of C4 at 24 h was less than 10 μM in multiple gastric cancer cell lines. The anti-tumor effect of C4 was positively correlated with SIN3A expression in AGS, HGC27, MKN45, and Hs-746T. The IP assay showed that C4 inhibited the binding of KLF4 to SIN3A. Figure 4 Following intravenous injection of C4 (5 mg / kg) into rats, another substance (preliminarily hypothesized to be a tautomer of C4) was formed. Compound C4 was rapidly cleared from the body, with a short residence time and a half-life of 0.62 h (Table 1). Acute toxicity tests showed that the effective therapeutic dose concentration of C4 (5 mg / kg) was far below the median lethal dose concentration (0 mice died after intravenous injection of 50 mg / kg C4 in 10 mice, Table 2).

[0074] Table 1. Peak area ratio of tautomer to internal standard of compound 3253-2867 after intravenous injection in rats.

[0075]

[0076] Table 2. Acute toxicity studies of Compound 3253-2867 in mice.

[0077] mg / kg Before treatment After treatment 20 10 10 25 10 10 32 10 10 40 10 10 50 10 10

[0078] Example 5

[0079] In vitro and in vivo experiments confirmed the anti-tumor effects of C3.

[0080] (1) Experimental subjects: human gastric cancer PDO and PDX models.

[0081] (2) Detection Procedure: Three GC PDOs and one paired non-tumor tissue PDO were used to detect the SIN3A level of PDOs and the IC50 of C4. A PDX model was constructed using PDOs from two GC patients. Twenty-one days after inoculation, eight mice with similar tumor volumes were randomly divided into two groups: the DMSO group and the C4 group (5 mg / kg, 50 μL). Another 15 mice with similar tumor volumes were randomly divided into three groups: the MOCK group, the Voronostat (5 mg / kg, 50 μL) group, and the Panobinostat (5 mg / kg, 50 μL) group. The drugs were administered once every 3 days for a total of 5 times. Thirty-five days after administration, the mice were sacrificed, the tumor weight was measured, and IHC staining was performed on the tumor cells.

[0082] (3) Detection Results: PDO and PDX experimental results showed that C4 could effectively inhibit the growth of gastric cancer tumors. With the increase of SIN3A expression level, gastric cancer PDOs were more sensitive to C4. Immunohistochemistry of SIN3A and KI67 showed that PDX1 and PDX2 expressed SIN3A, and C4 reduced the proportion of KI67 positive cells in PDXs. Comparing the inhibitory effects of C4 with conventional HDAC inhibitors, the results showed that C4 had a stronger inhibitory effect on GC cells than Vorinostat, but weaker than Panobinostat. Vorinostat had almost no inhibitory effect on PDX, while Panobinostat significantly inhibited tumor growth. Taking all factors into consideration, the inhibitory effect of C4 on GC PDX is not inferior to Vorinostat and Panobinostat. Figure 5 AK).

Claims

1. The application of compound C4 in the preparation of drugs for treating gastric cancer, characterized in that: The structural formula of compound C4 is: The effective therapeutic dose concentration of the drug is 5 mg / kg.

2. The application according to claim 1, characterized in that: The drug also contains pharmaceutically acceptable carriers and / or excipients.

3. The application according to claim 2, characterized in that: The pharmaceutically acceptable carriers and / or excipients include at least one of diluents, binders, surfactants, humectants, adsorbents, lubricants, fillers, and disintegrants.

4. The application according to claim 1, characterized in that: The dosage form of the drug includes at least one of tablets, pills, powders, solutions, suspensions, emulsions, and granules.

5. The application according to claim 1, characterized in that: The drug can be administered via intravenous injection.

Images