Application of lncrna as gastric cancer biomarker and therapeutic target
By using LncLRR1-1 as a biomarker and therapeutic target for gastric cancer, and utilizing specific primers and siRNA inhibitors, the shortcomings in gastric cancer diagnosis and treatment have been addressed, achieving highly efficient diagnostic and therapeutic results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- JIANGSU UNIV
- Filing Date
- 2025-02-17
- Publication Date
- 2026-06-16
Smart Images

Figure CN119913153B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of a lncRNA as a biomarker and therapeutic target for gastric cancer. Background Technology
[0002] Gastric cancer (GC) is a common malignant tumor of the digestive tract. It progresses rapidly and is often diagnosed at an advanced stage, resulting in poor prognosis for many patients. Despite improvements in surgical treatment, immunotherapy, and targeted therapy, the overall survival rate for GC patients remains low. Postoperative metastasis and treatment resistance are still major obstacles to improving patient survival. Therefore, there is an urgent clinical need to identify new diagnostic biomarkers and therapeutic targets for GC. Summary of the Invention
[0003] The purpose of this invention is to provide an application of LncRNA as a biomarker and therapeutic target for gastric cancer. The LncRNA positively regulates the occurrence and development of gastric cancer and can be used as a biomarker and therapeutic target for gastric cancer.
[0004] The present invention provides a LncRNA, wherein the LncRNA is LncLRR1-1; the nucleotide sequence of the LncLRR1-1 is shown in SEQ ID NO.1.
[0005] The present invention also provides the application of the LncRNA described in the above scheme as a biomarker in the preparation of products for diagnosing gastric cancer; the LncRNA positively regulates the occurrence and development of gastric cancer.
[0006] As a preferred embodiment, the product includes a primer pair for detecting the LncRNA described above.
[0007] As a preferred embodiment, the primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.3.
[0008] The present invention also provides the application of the LncRNA described above as a therapeutic target in the preparation of drugs for the prevention and / or treatment of gastric cancer.
[0009] As a preferred embodiment, the drug comprises an inhibitor of the expression of the LncRNA.
[0010] As a preferred embodiment, the expression inhibitor comprises siRNA targeting LncLRR1-1.
[0011] As a preferred embodiment, the siRNA targeting LncLRR1-1 comprises at least one of si-LncLRR1-1-1, si-LncLRR1-1-2, and si-LncLRR1-1-3; wherein si-LncLRR1-1-1 consists of a sense strand with a nucleotide sequence as shown in SEQ ID NO.4 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.5; wherein si-LncLRR1-1-2 consists of a sense strand with a nucleotide sequence as shown in SEQ ID NO.6 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.7; and wherein si-LncLRR1-1-3 consists of a sense strand with a nucleotide sequence as shown in SEQ ID NO.8 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.9.
[0012] As a preferred embodiment, the drug has the following effects: inhibiting at least one of the proliferation, migration, and invasion of gastric cancer cells.
[0013] As a preferred embodiment, the gastric cancer cells include MKN-45 and / or HGC-27.
[0014] Beneficial Effects: This invention provides a lncRNA, specifically LncLRR1-1; the nucleotide sequence of LncLRR1-1 is shown in SEQ ID NO.1. The LncLRR1-1 described in this invention is highly expressed in tumor-associated macrophages and their exosomes. Validation using qRT-PCR on clinical samples showed that the expression level of LncLRR1-1 was significantly increased in gastric cancer tissue compared to adjacent normal tissue; the expression level of LncLRR1-1 was also higher in the serum of gastric cancer patients compared to the serum of healthy individuals. This indicates that LncLRR1-1 expression can effectively diagnose gastric cancer, exhibiting good specificity and sensitivity, meeting the criteria for a biomarker. Furthermore, gastric cancer cells transfected with LncLRR1-1 small interfering RNA (siRNA) showed significantly lower proliferation rate, plate colony formation, migration, and invasion capabilities compared to the control group. Knockdown of LncLRR1-1 can inhibit the proliferation and metastasis of gastric cancer cells in vitro, providing a new target for gastric cancer treatment. Attached Figure Description
[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0016] Figure 1 The results are high-throughput sequencing results for M0-EX and M2-EX; where A is a hierarchical clustering diagram of differentially expressed LncRNAs in M0-EX and M2-EX, and B is a volcano diagram of differentially expressed LncRNAs in M0-EX and M2-EX.
[0017] Figure 2 The expression levels of LncLRR1-1 in different groups are shown below; where A represents the expression level of LncLRR1-1 in M0 and M2, and B represents the expression level of LncLRR1-1 in M0-EX and M2-EX; * indicates a significant difference, p < 0.05; ** indicates a significant difference, p < 0.01.
[0018] Figure 3 This is a schematic diagram showing the expression of LncLRR1-1 in gastric cancer tissue and adjacent normal tissue; **** indicates that the data are highly significant, p < 0.0001;
[0019] Figure 4 The expression map and ROC curve of LncLRR1-1 in the serum of gastric cancer patients are shown; where A is the expression level of LncLRR1-1 in the serum of gastric cancer patients and normal examinees, ** indicates that the data are significantly different, p<0.01; B is the ROC curve of LncLRR1-1 in the serum of gastric cancer patients.
[0020] Figure 5 The image shows the knockdown efficiency of different LncLRR1-1 small interfering RNAs; where A represents MKN-45 cells and B represents HGC-27 cells; ns indicates no significant difference; ** indicates a significant difference (p < 0.01); **** indicates an extremely significant difference (p < 0.0001).
[0021] Figure 6 This is a schematic diagram showing the cell growth curves after transfection with different LncLRR1-1 small interfering RNAs; where A represents MKN-45 cells and B represents HGC-27 cells; **** indicates extremely significant differences, p < 0.0001;
[0022] Figure 7 Images shown are microscopic images of plate cloning results; where A is a microscopic image of plate cloning, and B is a statistical graph of the number of cloned cells; ** indicates a significant difference, p < 0.01; *** indicates an extremely significant difference, p < 0.001.
[0023] Figure 8 Images shown are microscopic images of the migration results; where A is a microscopic image of the migration, and B is a statistical graph of the number of migrated cells; **** indicates that the data are highly significant, p < 0.0001;
[0024] Figure 9 The images are microscopic images of the invasion results; where A is a microscopic image of the invasion and B is a statistical graph of the number of invasive cells; **** indicates that the data are highly significant, p < 0.0001. Detailed Implementation
[0025] This invention provides an LncRNA, wherein the LncRNA is LncLRR1-1; the nucleotide sequence of the LncLRR1-1 is shown in SEQ ID NO.1: 5'-CGCCGGGCGCGGUGGCGCGUGC CUGUAGUCCCAGCUACUCGGGAGGCUGAGGCUGGAGGAUCGCUUGAGUCCAGGAGUUCUGGGCUGUAGUGCGCUAUGCCGAUCGGGUGUCCGCACUAAGUUCGGCAUCAAUAUGGUGACCUCCCGGGAGCGGGGGACCACCAGGUUGCCUAAGGAGGGGUGAACCGGCCCAGGUCGAAACGGAGCAGGUCAAAACUCCCGUGCUGAUCAGUAGUGGGAUCGCGCCUGUGAAUAGCCACUGCACUCCAGCCUGGGCAACAUAGCGAGACCCCGUCUCU-3'.
[0026] This invention also provides the application of the LncRNA described above as a biomarker in the preparation of products for diagnosing gastric cancer; the LncRNA positively regulates the occurrence and development of gastric cancer. LncLRR1-1 is highly expressed in tumor-associated macrophages and their exosomes. qRT-PCR validation using clinical samples showed that, compared with adjacent normal tissues, the expression level of LncLRR1-1 in gastric cancer tissues was significantly increased; simultaneously, compared with the serum of normal individuals, the expression level of LncLRR1-1 in the serum of gastric cancer patients was also higher. This indicates that LncLRR1-1 expression can effectively diagnose gastric cancer, exhibiting good specificity and sensitivity, and meeting the standards for use as a biomarker.
[0027] In one embodiment, the product of the present invention includes a primer pair for detecting the LncRNA. In one embodiment, the primer pair includes a forward primer with the nucleotide sequence shown in SEQ ID NO. 2 and a reverse primer with the nucleotide sequence shown in SEQ ID NO. 3. In one embodiment, the product of the present invention further includes an internal reference gene detection primer. In a specific embodiment of the present invention, the internal reference gene is β-actin; the internal reference gene detection primer includes a forward primer with the nucleotide sequence shown in SEQ ID NO. 12 and a reverse primer with the nucleotide sequence shown in SEQ ID NO. 13.
[0028] In one embodiment, the primer pair described in this invention accurately characterizes the expression level of LncLRR1-1 via qPCR detection. In another embodiment, the qPCR detection reaction program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 sec, 57℃ annealing and extension for 30 s, repeated for 40 cycles; finally, a melting curve acquisition program is set at 95℃ for 15 sec, 60℃ for 60 sec, and 95℃ for 15 sec. In yet another embodiment, the product of this invention also includes qPCR amplification reagents and reverse transcription reaction reagents; the qPCR amplification reagents include 2×AceQ Universal SYBR qPCRMasterMix; the reverse transcription reaction reagents include the following components: 10×RTMix, HiScript III Enzyme Mix, and Oligo(dT). 20 VN and hexabase random primers.
[0029] This invention also provides the use of the LncRNA described above as a therapeutic target in the preparation of medicaments for the prevention and / or treatment of gastric cancer. As one embodiment, the medicament of this invention includes an expression inhibitor of the LncRNA. As one embodiment, the expression inhibitor includes siRNA targeting LncLRR1-1.
[0030] As one embodiment, the LncLRR1-1-targeting siRNA of the present invention includes at least one of si-LncLRR1-1-1, si-LncLRR1-1-2, and si-LncLRR1-1-3; si-LncLRR1-1-1 consists of a sense strand as shown in SEQ ID NO.4 and an antisense strand as shown in SEQ ID NO.5; si-LncLRR1-1-2 consists of a sense strand as shown in SEQ ID NO.6 and an antisense strand as shown in SEQ ID NO.7; si-LncLRR1-1-3 consists of a sense strand as shown in SEQ ID NO.8 and an antisense strand as shown in SEQ ID NO.9. The LncLRR1-1-targeting siRNA of the present invention exhibits high knockdown efficiency, which is beneficial for inhibiting the expression of LncLRR1-1 in gastric cancer cells, thereby improving the therapeutic effect.
[0031] In one specific embodiment, the drug's effects include inhibiting at least one of the following: proliferation, migration, and invasion of gastric cancer cells. In another specific embodiment, the gastric cancer cells include MKN-45 and / or HGC-27. In a specific embodiment of the present invention, inhibiting LncLRR1-1 expression can inhibit the proliferation, migration, and invasion of gastric cancer cells MKN-45 and HGC-27.
[0032] To further illustrate the present invention, the application of LncRNA as a biomarker and therapeutic target for gastric cancer provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0033] Unless otherwise specified, all methods described in the following examples are conventional. Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0034] Example 1
[0035] High-throughput sequencing to screen for lncRNAs specifically highly expressed in M2-EX
[0036] Exosomes were extracted from M0 macrophages and M2 tumor-associated macrophages using ultracentrifugation. The extraction method is described in: Théry C, Amigorena S, Raposo G, et al. Isolation and characterization of exosomes from cell culture supernatants and biological fluids [M]. Curr Protoc Cell Biol, 2006, Chapter 3: Unit 3.22. High-throughput sequencing analysis was performed on exosomes derived from M0 macrophages (M0-EX) and M2 tumor-associated macrophages (M2-EX). The results are as follows: Figure 1 As shown, A is a hierarchical clustering diagram of differentially expressed LncRNAs in M0-EX and M2-EX; B is a volcano diagram of differentially expressed LncRNAs in M0-EX and M2-EX. Figure 1In the graph, the horizontal axis represents the sequencing groups M0-EX and M2-EX; the vertical axis represents the LncRNA expression abundance; green indicates low expression, and red indicates high expression. Using p<0.05 and |log2FC|>1 as thresholds, a heatmap was used to show the LncRNA expression differences between M0-EX and M2-EX. Group 1 refers to M0-EX, and group 2 refers to M2-EX. A total of 80 differentially expressed LncRNAs were screened, including 21 upregulated LncRNAs and 69 downregulated LncRNAs. In particular, LncLRR1-1 (SEQ ID NO.1) ranked highly in terms of upregulation in gastric cancer.
[0037] Example 2
[0038] Primers were designed based on LncLRR1-1, and the expression of Lnc-MALAT1 in M0 macrophages, M2 tumor-associated macrophages, and M0-EX and M2-EX cells was determined by real-time quantitative PCR.
[0039] (1) Reverse transcription
[0040] A. Removal of genomic DNA: Prepare the mixture shown in Table 1 in an RNase-free EP tube on ice; gently mix by pipetting; react at 42°C for 2 min.
[0041] Table 1 Reverse transcription reaction system 1
[0042] RNase-freeddH2O Add to 10μL 5×gDNAwiperMix 2μL Total RNA 1μg
[0043] B. Prepare the cDNA synthesis reaction solution according to Table 2. After preparation, heat at 37°C for 15 min and then at 85°C for 5 s.
[0044] Table 2 Reverse transcription reaction system 2
[0045] The mixture from the previous step 10μL 10×RTMix 2uL HiScriptEnzymeMix 2uL Oligo(dT) 1μL Randomhexamers 1μL <![CDATA[RNase-freeddH2O]]> 4μL
[0046] (2) qPCR
[0047] A. Prepare the following mixture in the qPCR tube according to Table 3:
[0048] Table 3. Preparation of qPCR system
[0049] 2×AceQUniversalSYBRqPCRMasterMix 10μL Forward primer (10 μM) 0.4uL Reverse primer (10 μM) 0.4uL cDNA 2μL <![CDATA[RNase-freeddH2O]]> 7.2μL
[0050] B. The relative expression level of LncLRR1-1 was detected by qPCR using β-actin as an internal reference gene; the primers for LncLRR1-1 are shown in SEQ ID NO.2 and SEQ ID NO.3; the primers for β-actin are shown in SEQ ID NO.12 and SEQ ID NO.13.
[0051] LncLRR1-1-F (SEQ ID NO.2): 5'-TCAATATGGTGACCTCCCGG-3';
[0052] LncLRR1-1-R (SEQ ID NO.3): 5'-GACGGGGTCTCGCTATGTT-3';
[0053] β-actin-F (SEQ ID NO:12): 5'-CACGAAACTACCTTCAACTCC-3';
[0054] β-actin-R (SEQ ID NO: 13): 5'-CATACTCCTGCTTGCTGATC-3'.
[0055] The qPCR amplification procedure is as follows: ① Pre-denaturation at 95℃ for 5 min; ② Denaturation at 95℃ for 10 s; ③ Annealing and extension at 57℃ for 30 s; repeat steps ② and ③ for 40 cycles; ⑤ Finally, set the melting curve acquisition program to 95℃ for 15 s, 60℃ for 60 s, and 95℃ for 15 s. The detection results are as follows: Figure 2 As shown in Table 4.
[0056] Table 4. Phase expression levels of LncLRR1-1 in each group
[0057] Group M0 M2 M0-EX M2-EX Expression level 1.00 4.35 1.00 7.29
[0058] according to Figure 2 As shown in Table 4, in the experimental results of each group, both M2 and M2-EX showed significant high expression of LncLRR1-1, indicating that LncLRR1-1 can be used as a specific molecular detection for tumors.
[0059] Example 3
[0060] Expression of LncLRR1-1 in clinical and adjacent tissues of gastric cancer
[0061] (1) RNA was extracted from 35 gastric cancer tissue and adjacent tissue samples. The tissue samples were gastric cancer and adjacent tissue collected by Nantong Cancer Hospital, Jiangsu Province from June 2019 to March 2024.
[0062] A. Remove frozen gastric cancer tissue and adjacent normal tissue samples from a -80℃ freezer and thaw them on ice. B. After thawing, take 15 mg of tissue and place it in a 1.5 mL RNase-free EP tube, adding 200 μL of Trizol lysis buffer to each tube. C. Grind the tissue block on ice using a tissue grinder for 15 seconds each time, then incubate on ice for 45 seconds. Repeat this process 5 times. Then, add Trizol lysis buffer to each EP tube to a final volume of 1 mL, mix thoroughly, and incubate at 4℃ for 10 minutes. D. Add 200 μL of chloroform solution to each tube, vortex to mix, and incubate at 4℃ for 5 minutes. E. Centrifuge at 11200 rpm for 15 minutes at 4℃. Carefully aspirate 600 μL of the upper aqueous phase containing RNA into a new EP tube, avoiding the white residue. F. Add an equal volume of isopropanol solution to each tube, gently mix the mixture several times, and let it stand at 4℃ for 10 min; G. Centrifuge at 4℃, 11200 rpm for 10 min, discarding the supernatant in small amounts several times to avoid aspirating RNA precipitate from the bottom of the tube; H. Add 1 mL of freshly prepared 75% anhydrous ethanol with DEPC water and gently wash the RNA precipitate; I. Centrifuge at 4℃, 11200 rpm for 5 min, carefully discard the supernatant, and allow to air dry at room temperature. When the RNA precipitate becomes translucent, add an appropriate amount of DEPC water to resuspend the precipitate; J. After dissolving at 4℃ overnight, mix by pipetting, take 1 μL of DEPC water as a blank control, and take 1 μL of the sample to be tested to detect the RNA concentration and purity on a NanoDrop spectrophotometer. Store at -80℃ for a long time.
[0063] (2) Reverse transcription was performed according to step (1) of Example 2.
[0064] (3) qPCR was performed according to step (2) of Example 2, and the results are as follows. Figure 3 As shown.
[0065] according to Figure 3 It can be seen that LncLRR1-1 is significantly highly expressed in gastric cancer tissue compared to adjacent tissue (normal tissue).
[0066] Example 4
[0067] Expression of LncLRR1-1 in the serum of gastric cancer patients and healthy individuals
[0068] (1) RNA was extracted from the serum of 25 gastric cancer patients and 25 normal physical examination subjects. The serum samples were collected from gastric cancer patients and normal physical examination subjects at Nantong Cancer Hospital in Jiangsu Province from January 2021 to July 2024. The gastric cancer patient serum in this embodiment and the 35 gastric cancer tissues in embodiment 3 were from different gastric cancer patients.
[0069] A. Take 200 μL of serum sample into a 1.5 mL RNase-free EP tube, add 4 μL of RNA carrier and mix well, then add 200 μL of lysis buffer and 20 μL of digestion buffer, vortex to mix, and incubate at 65 °C for 10 min; B. Add 900 μL of anhydrous ethanol, mix well, and transfer to the adsorption column, centrifuge at 12000 rpm for 1 min at 4 °C, and discard the waste liquid; C. Add 500 μL of wash buffer A containing 30% anhydrous ethanol, let stand for 2 min, centrifuge at 12000 rpm for 1 min at 4 °C, and discard the waste liquid; D. Add 500 μL of wash buffer B containing 70% anhydrous ethanol, centrifuge at 12000 rpm for 1 min at 4 °C, discard the waste liquid, and centrifuge for another 3 min; E. Remove the adsorption column into a new EP tube, add preheated elution buffer, let stand for 2 min, centrifuge at 12000 rpm for 2 min at 4 °C, collect the RNA solution and detect its concentration and purity, and use it directly for the next experiment or store at -80 °C.
[0070] (2) Reverse transcription was performed according to step (1) of Example 2.
[0071] (3) qPCR was performed according to step (2) of Example 2, and the results are as follows. Figure 4 As shown in Figure A, the sensitivity and specificity of LncLRR1-1 in diagnosing gastric cancer were evaluated using ROC curves, and the results are as follows. Figure 4 As shown in B.
[0072] according to Figure 4 It can be seen that LncLRR1-1 is highly expressed in the serum of gastric cancer patients compared with healthy individuals. In terms of diagnostic efficacy, LncLRR1-1 has an AUC of 0.7088 and a sensitivity of 80%, and can be used as a biomarker for the diagnosis of gastric cancer.
[0073] Example 5
[0074] (1) Small disturbance construction
[0075] Shanghai Yigou Biotechnology Co., Ltd. was commissioned to design and synthesize three small interfering RNAs (si-LncLRR1-1-1, si-LncLRR1-1-2, and si-LncLRR1-1-3) and one small interfering RNA control group (si-control). The nucleotide sequences are shown below:
[0076] si-LncLRR1-1-1-S (SEQ ID NO.4): 5'-GCACUAAGUUCGGCAUCAA-3';
[0077] si-LncLRR1-1-1-AS (SEQ ID NO.5): 5'-UUGAUGCCGAACUUAGUGC-3';
[0078] si-LncLRR1-1-2-S (SEQ ID NO.6): 5'-GGAGGAUCGCUUGAGUCCA-3';
[0079] si-LncLRR1-1-2-AS (SEQ ID NO.7): 5'-UGGACUCAAGCGAUCCUCC-3';
[0080] si-LncLRR1-1-3-S (SEQ ID NO.8): 5'-CGGAAACGGAGCAGGUCAA-3';
[0081] si-LncLRR1-1-3-AS (SEQ ID NO. 9): 5'-UUGACCUGCUCCGUUUCCG-3'.
[0082] si-control (SEQ ID NO. 10): 5'-UUCUCCGAACGUGUCACGU-3';
[0083] si-control (SEQ ID NO. 11): 5'-ACGUGACACGUUCGGAGAA-3';
[0084] Simultaneously, the addition of TT dangling ends to the small interfering RNA to form sticky ends enhances the stability of the siRNA, promotes binding to the target sequence, improves ligation efficiency, facilitates screening and identification, and promotes cellular uptake and RISC loading. LncLRR1 was knocked down using the above small interfering RNA to obtain si-LncLRR1-1, si-LncLRR1-2, and si-LncLRR1-3.
[0085] (2) Cell transfection
[0086] A. Take cells in good growth condition (HGC-27 and MKN-45) and seed them in 6-well plates 18 hours before transfection to achieve 50% cell confluence before transfection. B. Take 5 μL each of si-control, si-LncLRR1-1-1, si-LncLRR1-1-2, and si-LncLRR1-1-3 from step (1) and add them to Eppendorf tubes containing 250 μL of blank culture medium, and mix gently. Use si-control as the control group and add it to Eppendorf tubes containing 250 μL of blank culture medium. C. Take 5 μL of Lipofectamine... TMAdd 2000 μL of transfection reagent to another Eppendorf tube containing 250 μL of blank culture medium, mix gently, and incubate at room temperature for 5 min. D. Mix the liquids from steps B and C, incubate at room temperature for 20 min, add to the 6-well plate from step A, add 1640 μL of culture medium to 2 mL, and perform transfection in an incubator; after 6 h, remove the mixture and add 2 mL of complete culture medium. E. After culturing for 48 h, trypsin digest the cells and perform subsequent experiments.
[0087] (2) Measurement of transfection efficiency
[0088] A. Wash the cells from step (2) with pre-chilled PBS, discard the PBS, and add 1 mL of Trizol lysis buffer for pipetting. Collect the solution after pipetting into a 1.5 mL RNase-free EP tube. Place the treated centrifuge tube in a 4°C refrigerator for 10 min; B. After standing, add 200 μL of chloroform to each tube and mix by hand shaking 15 times to ensure thorough mixing of chloroform and Trizol, then place in a refrigerator or ice box for 5 min; C. Centrifuge at 4°C, 12000 g for 15 min, carefully aspirate the upper aqueous phase into a new EP tube, add an equal volume of pre-chilled isopropanol, invert to mix, and let stand at room temperature for 10 min; D. Centrifuge at 4°C, 12000 g for 10 min, and a white flocculent precipitate will be visible at the bottom of the tube. Carefully discard the supernatant, add 1 mL of 75% ethanol (prepared with DEPC water), and wash the precipitate thoroughly; E. Centrifuge at 12000g for 5 min at 4℃, discarding as much ethanol as possible, and allow the precipitate to dry in a clean environment for 2-5 min. When the precipitate forms a semi-transparent film, add an appropriate amount of DEPC water to fully dissolve the RNA. F. Reverse transcription is performed according to the procedure in Example 2. G. qPCR is performed according to the procedure in Example 2. The LncLRR1-1 detection results are as follows. Figure 5 As shown in Table 5.
[0089] Table 5. Results of LncLRR1-1 expression level detection
[0090] Group MNK-45 HGC-27 si-control 1.00 1.00 si-LncLRR1-1-1 0.87 0.61 si-LncLRR1-1-2 0.43 0.70 si-LncLRR1-1-3 0.32 0.43
[0091] according to Figure 5 As shown in Table 5, si-LncLRR1-1-2 and si-LncLRR1-1-3 have higher knockdown efficiencies. Therefore, si-LncLRR1-1-2 and si-LncLRR1-1-3, which have higher knockdown efficiencies, were selected for subsequent experiments.
[0092] Example 6: Effects of inhibiting LncLRR1-1 expression on the proliferation, migration, and invasion of gastric cancer cells.
[0093] (1) Cell transfection
[0094] HGC-27 and MKN-45 were transfected using si-LncLRR1-1-2 and si-LncLRR1-1-3, respectively, following the procedure in Example 5.
[0095] (1) Cell growth curve
[0096] After transfection in step (1), the cells were digested and counted, and seeded at 10,000 cells / well in 24-well plates containing 1 mL of complete culture medium. The plates were then incubated in a cell culture incubator. One group was digested and counted every 24 hours. A cell growth curve was plotted with time on the x-axis and cell count on the y-axis. The results are shown below. Figure 6 As shown in Table 6.
[0097] Table 6 Cell growth curves
[0098]
[0099]
[0100] according to Figure 6 As shown in Table 6, the proliferation rate of gastric cancer cells transfected with si-LncLRR1-1-2 and si-LncLRR1-1-3 was much lower than that of the control group.
[0101] (2) Plate cloning
[0102] A. Digest and count the transfected cells from step (1), and seed 1000 cells / well into 6-well plates containing 2 mL of complete culture medium. B. Incubate in a cell culture incubator for 9 days, changing the medium every 3 days. C. When the cells form a visible cell colony, discard the culture medium and wash with PBS. Fix with 1 mL of 4% paraformaldehyde for 30 min, then discard the PBS. Add 1 mL of crystal violet staining solution and stain for 15 min. Remove the staining solution, rinse with running water until no purple stain drips, and air dry. D. Take photos; the results are as follows. Figure 7 As shown in Figure A; count the number of cell clones in each well, and the results are as follows. Figure 7 As shown in B and Table 7.
[0103] Table 7 Number of cell clones
[0104] MNK-45 HGC-27 si-control 201 184 Si-LncLRR1-1-2 40 58 Si-LncLRR1-1-3 101 95
[0105] according to Figure 7 As shown in Table 7, the plate colonies of gastric cancer cells transfected with si-LncLRR1-1-2 and si-LncLRR1-1-3 were much lower than those in the control group.
[0106] (3) Transwell migration experiment
[0107] A. Trypsin-digest the transfected cells from step (1), resuspend the cells in basal culture medium, count the cells, and adjust the cell density to 2.5 × 10⁻⁶. 5 A. Add 200 μL of the culture medium per mL to a Tranwell chamber. B. Place the Tranwell chamber in a 24-well plate containing 600 μL of complete culture medium and incubate for 24 h. C. Discard the culture medium and wash with PBS. Fix with 1 mL of 4% paraformaldehyde for 30 min, then discard the paraformaldehyde. Stain with 1 mL of crystal violet solution for 15 min. D. Carefully wipe away any unmigrated cells with a cotton swab and photograph under a microscope. The results are as follows: Figure 8 As shown in Figure A; the number of migrating cells was counted, and the results are as follows. Figure 8 As shown in B and Table 8.
[0108] Table 8 Number of migrating cells
[0109] Group MNK-45 HGC-27 si-control 497 596 Si-LncLRR1-1-2 393 461 Si-LncLRR1-1-3 303 205
[0110] according to Figure 8 As shown in Table 8, the migration ability of gastric cancer cells transfected with si-LncLRR1-1-2 and si-LncLRR1-1-3 was lower than that of the control group.
[0111] (4) Matrix adhesive invasion test
[0112] A. The day before the experiment, place the Matrigel from -20℃ to 4℃ overnight to allow it to melt from a solid to a liquid state. B. Prepare a 10% volume concentration of Matrigel on ice, take 50 μL and spread it evenly on the upper layer of the chamber, place it at 37℃ for 30 minutes to allow the Matrigel to solidify. C. Digest the cells transfected in step (1) using trypsin, resuspend the cells in basal medium and count them, adjusting the cell density to 5 × 10⁶ cells / year. 5 D. Add 200 μL of the culture medium per mL to a Tranwell chamber. E. Place the Tranwell chamber in a 24-well plate containing 600 μL of complete culture medium and incubate for 48 h. F. Discard the culture medium and wash with PBS. Fix with 1 mL of 4% paraformaldehyde for 30 min, then discard the paraformaldehyde. Stain with 1 mL of crystal violet solution for 15 min. G. Carefully wipe away any uninvaded cells with a cotton swab and photograph under a microscope. The results are as follows: Figure 9 As shown in Figure A; the number of invading cells was counted, and the results are as follows. Figure 9 As shown in B and Table 9.
[0113] Table 9 Number of Invading Cells
[0114] Group MNK-45 HGC-27 si-control 566 579 Si-LncLRR1-1-2 362 477 Si-LncLRR1-1-3 232 254
[0115] according to Figure 9As shown in Table 9, the invasive ability of gastric cancer cells transfected with si-LncLRR1-1-2 and si-LncLRR1-1-3 was lower than that of the control group.
[0116] As can be seen, the proliferation rate, plate colony size, migration, and invasion ability of gastric cancer cells transfected with si-LncLRR1-1-2 and si-LncLRR1-1-3 were significantly lower than those of the control group. These results indicate that knocking down LncLRR1-1 can inhibit the proliferation and metastasis of gastric cancer cells in vitro, providing a new target for gastric cancer treatment.
[0117] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. The use of an inhibitor of lncRNA expression in the preparation of a drug for the prevention and / or treatment of gastric cancer, wherein the lncRNA is LncLRR1-1; the nucleotide sequence of the lncLRR1-1 is shown in SEQ ID NO.1; The expression inhibitor is a siRNA that targets LncLRR1-1; The siRNA targeting LncLRR1-1 is si-LncLRR1-1-2 and / or si-LncLRR1-1-3; si-LncLRR1-1-2 consists of a sense strand with a nucleotide sequence as shown in SEQ ID NO.6 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.7; si-LncLRR1-1-3 consists of a sense strand with a nucleotide sequence as shown in SEQ ID NO.8 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.
9.
2. The application according to claim 1, characterized in that, The drug's effects include inhibiting at least one of the following: proliferation, migration, and invasion of gastric cancer cells.
3. The application according to claim 2, characterized in that, The gastric cancer cells include MKN-45 and / or HGC-27.