SNP molecular markers associated with bovine sperm deformity rate based on HNRNPA2B1 gene and their application

By detecting the SNP site polymorphism of the bovine HNRNPA2B1 gene, a haplotype combination with low sperm malformation rate was screened out, which solved the problem of difficulty in evaluating bovine sperm malformation rate in the prior art, and achieved efficient and low-cost breeding guidance.

CN120060502BActive Publication Date: 2025-08-12INST OF ANIMAL SCI & VETERINARY MEDICINE SHANDONG ACADEMY OF AGRI SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510550887.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-29
Publication Date
2025-08-12
Estimated Expiration
2045-04-29

AI Technical Summary

Technical Problem

There is a lack of effective means in the prior art to evaluate and improve the rate of sperm abnormalities of cows, affecting the breeding effect of male livestock for dairy crops.

Method used

By detecting the polymorphisms of the SNP1 and SNP2 loci of the bovine HNRNPA2B1 gene, specific primers were designed for PCR reactions, sequencing to determine the genotype, and screening out haplotype combinations with low sperm malformation rates to evaluate bull sperm mobility.

Benefits of technology

It achieves efficient and low-cost evaluation of bull sperm abnormality rates, provides reliable breeding guidance, and improves the reliability and efficiency of breeding high-quality next generations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060502B_ABST
    Figure CN120060502B_ABST
Patent Text Reader

Abstract

The present invention discloses a bovine sperm deformity rate-associated SNP molecular marker based on the HNRNPA2B1 gene and its application, belonging to the field of genetic molecular biology technology. There are two SNP molecular markers: SNP1 is located at the cattle genome chr4:69733358 position, with a polymorphism of C or A; SNP2 is located at the cattle genome chr4:69733387 position, with a polymorphism of T or G. The two SNP sites provided by the present invention, g.-1713A>C and g.-1684G>T, have dominant genotypes of AA and GG, respectively, and their semen collection volume and sperm deformity rate have better performance. By detecting the polymorphisms of these two SNP sites, bull sperm motility assessment can be achieved, thereby assisting breeding and providing reliable support for breeding high-quality next-generation breeding, with advantages such as high reliability, high efficiency, and low cost.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic molecular biology, and in particular to a bovine sperm deformity rate-related SNP molecular marker based on the HNRNPA2B1 gene and an application thereof. Background Art

[0002] The selection and breeding of dairy cattle sires is a core component of the modern dairy industry's genetic improvement system, crucial for achieving herd genetic gain and sustainable development. Bull semen traits, as the biological vehicle for genetic transmission, are influenced by a multifactorial regulatory system, with genetic architecture being the essential determinant. The formation of phenotypic traits involves a cascade of reactions from genomic polymorphisms to transcriptional regulatory networks, providing a theoretical basis for improving the reproductive performance of sires through marker-assisted selection (MAS).

[0003] The genomic segment analysis strategy based on linkage disequilibrium can effectively analyze the functional association between the haplotype block composed of polymorphic sites and reproductive traits. By integrating the interaction effects of multiple SNPs, it can significantly improve the explanatory power of the genetic evaluation model and provide a scientific basis for establishing an accurate molecular breeding indicator system.

[0004] Heterogeneous nuclear ribonucleoprotein A2 / B1 (hnRNPA2B1) is a protein molecule that binds to RNA in the cell nucleus and participates in mRNA splicing, transport, and other mRNA- and miRNA-related processes. Currently, research on HNRNPA2B1 focuses primarily on human diseases, with very little research on bovine hnRNPA2B1.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The purpose of the present invention is to provide a bovine sperm deformity rate-related SNP molecular marker based on the HNRNPA2B1 gene and an application thereof.

[0007] The technical solution of the present invention is described in detail as follows:

[0008] In the first aspect, the present invention provides a bovine sperm deformity rate-related SNP molecular marker based on the HNRNPA2B1 gene, including SNP1 and SNP2, wherein SNP1 is located at position 69733358 of the bovine genome chr4, and the polymorphism is C or A, and SNP2 is located at position 69733387 of the bovine genome chr4, and the polymorphism is T or G.

[0009] Optionally or preferably, the SNP1 is the 182nd nucleotide of SEQ ID NO: 1 in the sequence listing, which is C or A; the SNP2 is the 211th nucleotide of SEQ ID NO: 1 in the sequence listing, which is T or G.

[0010] In a second aspect, the present invention provides a product for detecting the above-mentioned SNP molecular marker, which is a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2~3.

[0011] In a third aspect, the present invention provides a product for detecting the above-mentioned SNP molecular markers, wherein the product is a detection kit, and the detection kit comprises a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2~3.

[0012] In a fourth aspect, the present invention provides an application of any of the above-mentioned products for evaluating the sperm deformity rate of bulls.

[0013] In a fifth aspect, the present invention provides a method for evaluating the sperm deformity rate of a bull, detecting the genotype of the above-mentioned SNP molecular markers in the semen of the bull to be tested, the SNP molecular markers including SNP1 and SNP2, and evaluating the bull's sperm deformity rate based on the genotypes of SNP1 and SNP2 of the bull to be tested; the haplotype combination with the lowest sperm deformity rate of the bull is AG / AG.

[0014] Optionally or preferably, the above method comprises the following steps:

[0015] (1) Using the genomic DNA of the blood or semen of the bull to be tested as a template;

[0016] (2) Design specific primers for the above-mentioned SNP molecular markers, including SNP1 and SNP2, and perform PCR reaction to obtain the amplified product sequence;

[0017] (3) Sequencing was used to determine the genotypes of SNP1 and SNP2 in the amplified product sequence. The haplotype combinations of SNP1 and SNP2 in the order of low to high sperm deformity rates in bulls were AG / AG, AG / CT, and CT / CT.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] This study of the HNRNPA2B1 gene discovered and identified two new SNPs associated with sperm abnormality rates. The dominant genotypes, g. -1713A>C and g. -1684G>T, are AA and GG, respectively, and are associated with improved semen yield and sperm abnormality rates. Testing for these two SNPs allows for the assessment of bull sperm motility, assisting breeding efforts and providing reliable support for the production of high-quality offspring. This approach offers advantages such as high reliability, high efficiency, and low cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the peak diagram of the position of SNP1-2 molecular markers in the promoter region of the HNRNPA2B1 gene. DETAILED DESCRIPTION

[0021] In order to enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below in conjunction with the embodiments and drawings. Obviously, the embodiments described are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of this application. The instruments and reagents used in the embodiments are all derived from commercial channels unless otherwise specified.

[0022] Example 1

[0023] A total of 235 bulls were selected for the experiment, originating from the Beijing Dairy Center, Shanghai Guangming Holstein Farming Co., Ltd., and Shandong Aokes Bull Station. Semen was collected from the bulls, and genomic DNA was extracted using conventional methods and diluted to 50 ng / μL for later use. Semen collection volume, sperm density, sperm motility, sperm deformity rate, post-freezing sperm motility, and final sperm motility were also measured and recorded for each bull.

[0024] Amplification primers were designed based on the HNRNPA2B1 gene sequence (NCBI reference sequence Gene ID: 507564), and PCR amplification was performed using the genomic DNA of the bull as a template.

[0025] PCR amplification system (25 μL): 1 μL of template (50 ng / μL), 1 μL of 10 μmol / L upstream and downstream primers, 12.5 μL of 2× Taq PCR Master Mix, and 9.5 μL of ddH2O.

[0026] PCR reaction conditions: denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 10 min, and storage at 4°C.

[0027] The obtained PCR products were sent to Beijing BGI for sequencing. The sequencing results of different samples were compared using SnapGene software. Combined with the sequencing peak graph, the SNP sites in the target fragment were determined to be: SNP1: g.-1713A>C, SNP2: g. -1684G>T. Figure 1 shown.

[0028] Gene frequencies, genotype frequencies, and allele frequencies were calculated using Excel software, and association analysis was performed on the HNRNPA2B1 gene SNP1-2 polymorphism using SPSS 26.0 software. Results are presented as mean ± standard error, with P < 0.01 indicating an extremely significant difference and P < 0.05 indicating a significant difference (see Table 1 below).

[0029] Table 1 Results of association analysis between SNP sites in the promoter region of HNRNPA2B1 gene and semen quality

[0030]

[0031] Note: Different letters in the same column indicate significant differences (P < 0.05); the same letters or no letters in the same column indicate no significant differences (P > 0.05).

[0032] As shown in Table 1, when the genotype of SNP1 is AA and the genotype of SNP2 is GG, the semen collection amount is the highest and the sperm deformity rate is the lowest. They can be used as molecular markers to screen individuals with low sperm deformity rate.

[0033] Example 2

[0034] Primers were designed for the sequence SEQ ID NO: 1 containing the two SNP molecular markers g. -1713A>C and g. -1684G>T. The primer sequences are shown below:

[0035] Upstream primer: AATCAGACAAGTGCCCAATCG, SEQ ID NO: 2,

[0036] Downstream primer: ACAAAGCGCATTTTCCCCTC, SEQ ID NO: 3.

[0037] The sequence of SEQ ID NO: 1 containing the SNP1-2 polymorphic site is as follows: AATCAGACAAGTGCCAATCGATTACAATAATTAGTGTGAATTTTTCCTCTAGACATTAACAATCTGAAGAGTCGTCTATGTAATTTAATTCTAACTTGGGTTTCTTCTTAGAGACCTTTCCAATCACTAGTTGAAAAACTAAAACATACCGAGATGCTCCAGTTACATTTCGTGCCACTT A TGAAAACAAATCAGCTATTTCTGCACTT G CATCCGCTCCCCTTAAACCCCTACCCCACCCGGCTTAAAGAGGCCTTAGCGCCCGGCCCCTAACCCCGCCAAAGGAGAGCGCGGGCCTCGTGGTCAGCGCATCCGAGGGGAGAAACAAAAGGCCGCGGCGCGGGGGCTCAAGGGCACTGCGCCACGGGGCCCGAGCCTCTCCCCACCCGCGGCGGCCACGTAACGGAGCGCCCGCCGCAGTCTGCGGACACTCGGCTGCGCGGATGCGGGAGAATGCACCGCCCTCCCTGGAGGCCCAAGTCGCCGACCAAGCACGGGACGGGAAGGAAGGCCCCCTCAACCTCGTCCGGGATGGGGGAGGGGAGGGGAAAATGCGCTTTGT. SNP1 is located at position 182 of the sequence, and SNP2 is located at position 211 of the sequence.

[0038] Semen from experimental bulls was collected, and total DNA was extracted as a template. PCR amplification was performed using primers from SEQ ID NOs: 2-3. The amplified products were sequenced to identify the SNP polymorphism. Semen quality was also assessed. The results showed that the genotype combinations at SNPs 1-2 corresponded consistently with the sperm abnormality rate: The haplotype combinations corresponding to the lowest sperm abnormality rate were AG / AG, AG / CT, and CT / CT, respectively.

[0039] This document uses specific examples to illustrate the inventive concept in detail. The above embodiments are only intended to help understand the core concept of the present invention. It should be noted that any obvious modifications, equivalent substitutions, or other improvements made by a person skilled in the art without departing from the inventive concept should be included within the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting SNP molecular markers associated with bull sperm deformity rate in the HNRNPA2B1 gene in the preparation of a product for evaluating the level of bull sperm deformity rate, characterized in that: The SNP molecular markers include SNP1 and SNP2, wherein SNP1 is located at position 69733358 of the cattle genome chr4, and the polymorphism is C or A; SNP2 is located at position 69733387 of the cattle genome chr4, and the polymorphism is T or G; The NCBI reference sequence of the HNRNPA2B1 gene is Gene ID: 507564.

2. The use according to claim 1, characterized in that The SNP1 is the 182nd nucleotide of SEQ ID NO: 1 in the sequence listing, which is C or A; the SNP2 is the 211th nucleotide of SEQ ID NO: 1 in the sequence listing, which is T or G.

3. The use according to claim 1, characterized in that The reagents include a primer pair, and the nucleotide sequence is shown in SEQ ID NO: 2-3.

4. The use according to claim 1, characterized in that The product is a detection kit, which includes a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2-3.