Engineered meganucleases specific for recognition sequences in the dystrophin gene

Abstract

This disclosure covers engineered macronucleases that bind to and cleave recognition sequences within the dystrophin gene. This disclosure also covers methods for preparing genetically modified cells using such engineered macronucleases. Furthermore, this disclosure covers pharmaceutical compositions comprising engineered macronuclease proteins or polynucleotides encoding engineered macronucleases of this disclosure, and the use of such compositions for modifying the dystrophin gene in a subject or for treating Duchenne muscular dystrophy.

Description

[0001] This application is a divisional application of the invention patent application filed on November 12, 2021, with application number 202180088740.3 and invention title "Engineering wide-range nuclease with specificity for recognition sequence in dystrophin gene". Technical Field

[0002] This application relates to the fields of engineered large-scale nucleases, molecular biology, and recombinant nucleic acid technologies. In a particular aspect, the present invention relates to engineered large nucleases that can be used to remove exons from dystrophin genes and to treat subjects suffering from Duchenne muscular dystrophy.

[0003] References to sequence lists submitted as text files via EFS-WEB

[0004] This application contains a sequence list, which has been submitted via EFS-Web in ASCII format, the entire contents of which are incorporated herein by reference. This ASCII copy, created on November 12, 2021, is named P109070054WO00-SEQ-EPG and has a size of 279,819 bytes. Background Technology

[0005] Duchenne muscular dystrophy (DMD) is a rare X-linked myodegenerative disease affecting approximately 1 in 3,500 boys worldwide. The disease is caused by mutations in the dystrophin gene, the largest known gene. This 2.2 Mb gene spans the X chromosome and primarily encodes a 14 kb transcript from 79 exons. The full-length dystrophin expressed in skeletal, smooth, and cardiac muscle cells is 3,685 amino acids with a molecular weight of 427 kDa. Severe Duchenne phenotype is typically associated with the absence of full-length dystrophin in skeletal and cardiac muscle, leading to debilitating muscle degeneration and ultimately heart failure. Numerous different dystrophin gene mutations have been described, many of which result in severe DMD or milder Becker muscular dystrophy.

[0006] Several therapeutic strategies exist for treating DMD. First, the "gene replacement" strategy is an active area of ​​research (Oshima et al., (2009) J. Am. Soc. Gene Ther. 17:73-80; Liu et al., (2005) Mol. Ther. 11:245-56; Lai et al., (2006) Hum Gene Ther. 17:1036-42; Odom et al., (2008) Mol. Ther. 16:1539-45). This method involves using a viral delivery vector, typically adeno-associated virus (AAV), to deliver a functional copy of the dystrophin gene to the patient. However, the large size of the dystrophin gene makes it incompatible with the limited carrying capacity of common viral vectors. This necessitates the use of "mini-dystrophin" genes, in which most of the repetitive central portion of the gene is removed, leaving only the minimum functional protein. However, it remains unclear whether the expression of "mini-dystrophin" is sufficient to achieve clinical benefit. Furthermore, this method carries the risk of random gene integration into the patient's genome, which could lead to insertional mutations and potential immune responses to the delivery vector.

[0007] A second approach to treating DMD involves transplanting healthy myoprogenitor cells into the patient's muscle fibers (Peault et al., (2007) Mol. Ther. 15:867-77; Skuk et al., (2007) Neuromuscul. Disord. 17:38-46). This approach suffers from low migration efficiency of transplanted myoprogenitor cells and the potential for immune rejection in patients.

[0008] The third approach involves using PTC124 to suppress meaningless mutations (Welch et al., (2007) Nature 447:87-91). However, this requires lifelong dosing, and this approach has not yet shown any significant clinical benefit.

[0009] The fourth approach used to treat DMD is called “exon skipping” (Williams et al., (2008) BMC Biotechnol. 8:35; Jearawiriyapaisarn et al., (2008) Mol Ther. 16:1624-29; Yokota et al., (2007) Acta Myol. 26:179-84; van Deutekom et al., (2001) Hum. Mol. Gen. 10:1547-54; Benedetti et al., (2013) FEBS J. 280:4263-80; Rodino-Klapac (2013) Curr Neurol Neurosci Rep. 13:332; Verhaart & Aartsma-Rus (2012) Curr Opin Neurol. 25:588-96). Generally, the N- and C-terminal portions of the dystrophin gene are crucial for its role as a "scaffold" protein maintaining the integrity of the myofibril membrane, while the central "barrel domain," containing 24 spectrin-like repeat sequences, is at least partially optional. In fact, severe Duchenne phenotypes are often associated with mutations in the dystrophin gene that introduce frameshifts and / or premature stop codons, resulting in a shortened form of dystrophin lacking the essential C-terminal domain. Mutations in the central rod domain, including large deletions of entire exons, typically lead to a milder Becker phenotype if the reading frame is preserved, allowing the C-terminal domain to remain intact.

[0010] The most common cause of DMD is the deletion of one or more intact exons, leading to reading frame shift. For example, exon 45 is often deleted in Duchenne muscular dystrophy (DMD) patients. Because exon 45 is 176 bp long, which is not divisible by three, all deleted exons would cause exons 46-79 to enter the wrong reading frame. The same is true for exon 44, which is 148 bp long. However, if exons 44 and 451 are deleted, the total size of the deletion is 324 bp, which is divisible by three. Thus, the deletion of two exons does not cause reading frame shift. Since these exons encode part of the non-essential rod domain of dystrophin, deletion of them from the protein is expected to lead to a mild Becker-like phenotype. Therefore, patients with the DMD phenotype due to the deletion of one or more exons can be treated by restoring the reading frame by eliminating one or more adjacent exons. This is the principle behind "exon skipping," in which modified oligonucleotides are used to block the splice acceptor site in the dystrophin precursor mRNA, resulting in the absence of one or more specific exons in the processed transcript. This method has been used to restore the expression of the dystrophin gene in an MDX mouse model by skipping exon 23, where exon 23 carries a disease-inducing, meaningless mutation (Mann et al., (2001) Proc. Nat. Acad. Sci. USA 98:42-47). Oligonucleotide analogs that induce exon 51 skipping have also shown promise in early human clinical trials (Benedetti et al., (2013) FEBS J. 280:4263-80). The main limitations of this approach are: (1) the exon skipping process is inefficient, resulting in relatively low levels of functional dystrophin expression; and (2) the exon skipping oligonucleotides have relatively short half-lives, so the effects are transient, requiring repeated and lifelong dosing. Therefore, despite the promising results shown by the exon skipping approach in clinical trials, the improvement in disease progression is minimal and variable.

[0011] This disclosure improves upon current methods of exon skipping by correcting gene expression at the genomic DNA level rather than the pre-mRNA level. The invention is a permanent treatment for DMD, involving the excision of specific exons from the dystrophin coding sequence using a pair of engineered, site-specific homing endonucleases (commonly referred to as macronucleases). By targeting a pair of such endonucleases to sites in intron regions flanking the exons of the dystrophin gene, intermediate segments can be permanently removed from the genome. The resulting cells and their progeny will express modified dystrophin, in which some non-essential spectrin repetitive sequence domains are removed, but the essential N- and C-terminal domains remain intact.

[0012] Homing endonucleases, or large-scale nucleases, are a group of naturally occurring nucleases that recognize 15-40 base-pair cleavage sites common in plant and fungal genomes. They frequently bind to parasitic DNA elements, such as group 1 self-splicing introns and inteins. They recruit cellular DNA repair mechanisms by naturally promoting homologous recombination or gene insertion at specific locations in the host genome through the creation of double-strand breaks on chromosomes (Stoddard (2006) Q. Rev. Biophys. 38:49-95). Homing endonucleases are generally classified into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cys box family, and the HNH family. These families are characterized by structural motifs that influence catalytic activity and recognition sequences. For example, members of the LAGLIDADG family are characterized by having one or two conserved copies of the LAGLIDADD motif (see Chevalier et al., (2001) Nucleic Acids Res. 29:3757-74). LAGLIDADD homing endonucleases with one copy of the LAGLIDADD motif form homodimers, while members with two LAGLIDADD motifs are found to be monomers.

[0013] I-CreI (SEQ ID NO:1) is a member of the homing endonuclease family LAGLIDADG, which recognizes and cleaves a 22-base-pair recognition sequence in the chloroplast chromosome of the alga *Chlamydomonas reinhardtii*. Genetic selection techniques have been used to modify the preference of wild-type I-CreI cleavage sites (Sussman et al., (2004) J.Mol.Biol.342:31-41; Chames et al., (2005) Nucleic Acids Res.33:e178; Seligman et al., (2002) Nucleic Acids Res.30:3870-79; Arnould et al., (2006) J.Mol.Biol.355:443-58). A method for rationally designing single LAGLIDADG homing endonucleases has been described, which enables comprehensive redesign of I-CreI and other homing endonucleases to target a wide range of diverse DNA sites, including sites in the genomes of mammals, yeast, plants, bacteria, and viruses (WO 2007 / 047859).

[0014] As first described in WO 2009 / 059195, I-CreI and its engineered derivatives are typically dimers, but can be fused into a single polypeptide using short peptide linkers connecting the C-terminus of the first subunit and the N-terminus of the second subunit (Li et al., (2009) Nucleic Acids Res. 37:1650-62; Grizot et al., (2009) Nucleic Acids Res. 37:5405-19). Therefore, functional “single-stranded” macronucleases can be expressed from a single transcript. By delivering genes encoding two different single-stranded macronucleases into the same cell, two distinct sites can be cleaved simultaneously. This, combined with the extremely low off-target cleavage frequency observed with engineered macronucleases, makes them the preferred endonucleases of this disclosure. Summary of the Invention

[0015] This disclosure provides engineered large-scale nucleases that bind to and cleave recognition sequences in dystrophin genes (e.g., human dystrophin gene), compositions comprising such engineered large-scale nucleases, and methods of using them. In some embodiments, engineered large-scale nuclease pairs are used to remove multiple exons from the dystrophin gene by generating a first cleavage site in an intron upstream of a first exon and a second cleavage site in an intron downstream of a second exon. In a particular example described herein, the first cleavage site is generated in intron 5' upstream of exon 45 of the dystrophin gene, while the second cleavage site is generated in intron 3' downstream of exon 55. This process allows for the excision and removal of exons 45-55 from the dystrophin gene following annealing at both cleavage sites and genomic repair. The disclosed engineered wide-range nuclease-targeting recognition sequence was selected as a central sequence with the same four base pairs, such that the first and second cleavage sites would have four complementary 3' overhangs that could be perfectly linked together (i.e., each base pair of one overhang is complementary to the one on the other overhang). This approach resulted in the restoration of the normal (i.e., wild-type) reading frame of the dystrophin gene by removing exons 45-55 from a mutant dystrophin gene lacking one or more of these exons. Cells treated in this way will express a shortened modified form of dystrophin, in which a portion of the central spectral repeat sequence domain is absent, but the N- and C-terminal domains are intact. In many cases, this will reduce disease severity. In some cases, it will lead to a more mild Becker's phenotype.

[0016] Therefore, in one aspect, the present invention provides an engineered wide-range nuclease that binds to and cleaves a recognition sequence in a dystrophin gene, wherein the engineered wide-range nuclease comprises a first subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and wherein the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region.

[0017] In some implementations, the identification sequence includes SEQ ID NO:6.

[0018] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NO:36-44. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75 and 77 of any one of SEQ ID NO:36-44. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75 and 77 of any one of SEQ ID NO:36-44. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to any one of SEQ ID NO:36-44. In some embodiments, the HVR1 region contains residues 24-79 of any one of SEQ ID NO:36-44 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of any one of SEQ ID NO:36-44.

[0019] In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of any one of SEQ ID NO:36-44. In some embodiments, the first subunit contains G, S, or A at a residue corresponding to residue 19 of any one of SEQ ID NO:36-44. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of any one of SEQ ID NO:36-44. In some embodiments, the first subunit contains E, Q, or K at a residue corresponding to residue 80 of any one of SEQ ID NO:36-44. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of any one of SEQ ID NO:38, 39, or 149. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NO:36-44 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NO:36-44.

[0020] In some such embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NO:36-44. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of any one of SEQ ID NO:36-44. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to any one of SEQ ID NO:36-44. In some embodiments, the HVR2 region comprises Y, R, K, or D at the residue corresponding to residue 257 of any one of SEQ ID NO:36-44. In some embodiments, the HVR2 region comprises residue 236 corresponding to residue 236 of SEQ ID NO:39. In some embodiments, the HVR2 region comprises residue 239 corresponding to residue 239 of SEQ ID NO:37. In some embodiments, the HVR2 region comprises residue 241 corresponding to residue 241 of any one of SEQ ID NO:36-37. In some embodiments, the HVR2 region comprises residue 263 corresponding to residue 263 of SEQ ID NO:36. In some embodiments, the HVR2 region comprises residue 264 corresponding to any one of SEQ ID NO:36-44. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NO:36-44 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NO:36-44.

[0021] In some such embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 corresponding to any one of SEQ ID NO: 36-44. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 corresponding to any one of SEQ ID NO: 36-44. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 corresponding to any one of SEQ ID NO: 36-44. In some embodiments, the second subunit comprises a residue corresponding to residue 271 corresponding to any one of SEQ ID NO: 36, 39, 40, 43, or 44. In some embodiments, the second subunit comprises a residue corresponding to residue 330 corresponding to any one of SEQ ID NO: 36-38 or 40-44. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NO:36-44 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NO:36-44.

[0022] In some such embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with any of SEQ ID NO:36-44. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence of any of SEQ ID NO:36-44. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the nucleic acid sequence shown in any of SEQ ID NO:60-68. In some implementations, the engineered wide-range nuclease is encoded by a nucleic acid sequence shown in any of SEQ ID NO:60-68.

[0023] In some implementations, the identification sequence includes SEQ ID NO:10.

[0024] In some such embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with residues 24-79 corresponding to any one of SEQ ID NO:45-52. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75 and 77 corresponding to any one of SEQ ID NO:45-52. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75 and 77 corresponding to any one of SEQ ID NO:45-52. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to any one of SEQ ID NO:45-52. In some embodiments, the HVR1 region contains residues 24-79 of any one of SEQ ID NO:45-52 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of any one of SEQ ID NO:45-52.

[0025] In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of any one of SEQ ID NO:45-52. In some embodiments, the first subunit contains G, S, or A at a residue corresponding to residue 19 of any one of SEQ ID NO:45-52. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of any one of SEQ ID NO:45-52. In some embodiments, the first subunit contains E, Q, or K at a residue corresponding to residue 80 of any one of SEQ ID NO:45-52. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of any one of SEQ ID NO:45-51. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NO:45-52 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NO:45-52.

[0026] In some such embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NO:45-52. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of any one of SEQ ID NO:45-52. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to any one of SEQ ID NO:45-52. In some embodiments, the HVR2 region comprises Y, R, K, or D at the residue corresponding to residue 257 of any one of SEQ ID NO:45-52. In some embodiments, the HVR2 region comprises residues 239, 241, and 264 corresponding to any one of SEQ ID NO:45-52. In some embodiments, the HVR2 region comprises residue 250 corresponding to residue 250 of SEQ ID NO:45. In some embodiments, the HVR2 region comprises residue 263 corresponding to residue 263 of any one of SEQ ID NO:45 or 46. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NO:45-52 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions.

[0027] In some such embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of any one of SEQ ID NO:45-52. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of any one of SEQ ID NO:45-52. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of any one of SEQ ID NO:45-52. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO:52. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of any one of SEQ ID NO:45-52. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NO:45-52 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NO:45-52.

[0028] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with any of SEQ ID NO:45-52. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence of any of SEQ ID NO:45-52. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with any of the nucleic acid sequences shown in SEQ ID NO:69-76. In some implementations, the engineered wide-range nuclease is encoded by a nucleic acid sequence shown in any of SEQ ID NO:69-76.

[0029] In some implementations, the identification sequence includes SEQ ID NO:12.

[0030] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NO: 53-59. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NO: 53-59. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NO: 53-59. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to any one of SEQ ID NO:53-59. In some embodiments, the HVR1 region contains residue 64 corresponding to residue 64 of SEQ ID NO:54. In some embodiments, the HVR1 region contains residues 24-79 of any one of SEQ ID NO:53-59 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of any one of SEQ ID NO:53-59.

[0031] In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of any one of SEQ ID NO: 53-59. In some embodiments, the first subunit contains G, S, or A at a residue corresponding to residue 19 of any one of SEQ ID NO: 53-59. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of any one of SEQ ID NO: 53-59. In some embodiments, the first subunit contains E, Q, or K at a residue corresponding to residue 80 of any one of SEQ ID NO: 53-59. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of any one of SEQ ID NO: 53-55, 57, or 58. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NO:53-59 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NO:53-59.

[0032] In some such embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NO: 53-59. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of any one of SEQ ID NO: 53-59. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to any one of SEQ ID NO: 53-59. In some embodiments, the HVR2 region comprises Y, R, K, or D at the residue corresponding to residue 257 of any one of SEQ ID NO: 53-59. In some embodiments, the HVR2 region comprises residue 239 corresponding to residue 239 of SEQ ID NO: 53 or SEQ ID NO: 55. In some embodiments, the HVR2 region comprises residue 241 corresponding to residue 241 of any one of SEQ ID NO: 53-55. In some embodiments, the HVR2 region comprises residue 255 corresponding to residue 255 of SEQ ID NO: 55. In some embodiments, the HVR2 region comprises residue 263 corresponding to residue 263 of any one of SEQ ID NO: 56-59. In some embodiments, the HVR2 region comprises residue 264 corresponding to any one of SEQ ID NO:53-59. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NO:53-59 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NO:53-59.

[0033] In some such embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of any one of SEQ ID NO: 53-59. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of any one of SEQ ID NO: 53-59. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of any one of SEQ ID NO: 53-59. In some embodiments, the second subunit comprises residue 271 corresponding to residue 271 of any one of SEQ ID NO: 53 or 55-59. In some embodiments, the second subunit comprises residue 330 corresponding to residue 330 of any one of SEQ ID NO: 54-59. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NO:53-59 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NO:53-59.

[0034] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with any of SEQ ID NO:53-59. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence of any of SEQ ID NO:53-59. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with any of SEQ ID NO:77-83. In some implementations, the engineered wide-range nuclease is encoded by a nucleic acid sequence shown in any of SEQ ID NO:77-83.

[0035] In the various embodiments described above, the engineered large-scale nuclease may include a nuclear localization signal. In some embodiments, the nuclear localization signal is located at the N-terminus of the engineered large-scale nuclease. In some embodiments, the nuclear localization signal comprises an amino acid sequence having at least 80% or at least 90% sequence identity with SEQ ID NO:3. In some embodiments, the nuclear localization signal comprises SEQ ID NO:3.

[0036] In another aspect, the present invention provides a polynucleotide comprising a nucleic acid sequence encoding an engineered wide-ranging nuclease as described herein. In some embodiments, the polynucleotide is mRNA.

[0037] In another aspect, the present invention provides a recombinant DNA construct comprising a polynucleotide containing a nucleic acid sequence encoding an engineered wide-ranging nuclease as described herein.

[0038] In some embodiments, the recombinant DNA construct encodes a recombinant virus comprising a polynucleotide. In some embodiments, the recombinant virus is a recombinant adenovirus, recombinant lentivirus, recombinant retrovirus, or recombinant AAV. In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an rh.74 capsid. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the rh.74 capsid contains an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity to SEQ ID NO:182. In some embodiments, the rh.74 capsid contains the amino acid sequence of SEQ ID NO:182. In some embodiments, the AAV9 capsid comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with SEQ ID NO:183. In some embodiments, the AAV9 capsid comprises the amino acid sequence of SEQ ID NO:183. In some embodiments, the recombinant AAV has an AAV8 capsid.

[0039] In some embodiments, the nucleic acid sequence includes a promoter operatively linked to a nucleic acid sequence encoding the engineered wide-ranging nuclease described herein. In some embodiments, the promoter is a muscle-specific promoter. In some embodiments, the muscle-specific promoter includes the MCK promoter, C5-12 promoter, spc 5-12 promoter, MHCK7 promoter, CK8 promoter, SK-CRM4 promoter, SP-301 promoter, SP-817 promoter, or SP-905 promoter. In some embodiments, the promoter enables the expression of the engineered wide-ranging nuclease described herein in myogenic precursor cells (e.g., satellite cells or stem cells).

[0040] In another aspect, the present invention provides a recombinant virus comprising a polynucleotide containing a nucleic acid sequence encoding an engineered wide-ranging nuclease as described herein.

[0041] In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant AAV. In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an rh.74 capsid. In some embodiments, the rh.74 capsid comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with SEQ ID NO:182. In some embodiments, the rh.74 capsid comprises the amino acid sequence of SEQ ID NO:182. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the AAV9 capsid comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with SEQ ID NO:183. In some embodiments, the AAV9 capsid comprises the amino acid sequence of SEQ ID NO:183. In some embodiments, the recombinant AAV has an AAV8 capsid.

[0042] In some embodiments, the polynucleotide includes a promoter operatively linked to a nucleic acid sequence encoding the engineered wide-ranging nucleases described herein. In some embodiments, the promoter is a muscle-specific promoter. In some embodiments, muscle-specific promoters include the MCK promoter, C5-12 promoter, spc 5-12 promoter, MHCK7 promoter, CK8 promoter, SK-CRM4 promoter, SP-301 promoter, SP-817 promoter, or SP-905 promoter. In some embodiments, the promoter enables the expression of the engineered wide-ranging nucleases described herein in myogenic precursor cells (e.g., satellite cells or stem cells).

[0043] In another aspect, the present invention provides a lipid nanoparticle composition comprising lipid nanoparticles containing a polynucleotide, wherein the polynucleotide comprises a nucleic acid sequence encoding an engineered wide-ranging nuclease described herein. In some embodiments, the polynucleotide is mRNA.

[0044] In another aspect, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and an engineered, wide-ranging nuclease as described herein.

[0045] In another aspect, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and the polynucleotide described herein.

[0046] In another aspect, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a recombinant DNA construct as described herein.

[0047] In another aspect, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and the recombinant virus described herein.

[0048] In another aspect, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and the lipid nanoparticle composition described herein.

[0049] In another aspect, the present invention provides a polynucleotide comprising a first nucleic acid sequence encoding a first engineered macronuclease and a second nucleic acid sequence encoding a second engineered macronuclease, wherein the first engineered macronuclease is an engineered macronuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO:6, and wherein the second engineered macronuclease is an engineered macronuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO:10, or wherein the second engineered macronuclease is an engineered macronuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO:12.

[0050] In some embodiments, the first engineered broad-spectrum nuclease is an engineered broad-spectrum nuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO: 6, and the second engineered broad-spectrum nuclease is an engineered broad-spectrum nuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO: 10. In some embodiments, the first and second engineered broad-spectrum nucleases are selected from combinations of broad-spectrum nucleases (and their variants described herein) provided in Table 1.

[0051] Table 1:

[0052]

[0053]

[0054]

[0055] In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD 35-36x.63 (SEQ ID NO:45), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD 35-36x.81 (SEQ ID NO:46), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD 35-36x.81 (SEQ ID NO:46), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD 35-36x.63 (SEQ ID NO:45), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20L.249 (SEQ ID NO:38), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD 35-36L.195 (SEQ ID NO:47), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20L.302 (SEQ ID NO:39), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD 35-36L.282 (SEQ ID NO:48), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20L.329 (SEQ ID NO:40), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD 35-36L.282 (SEQ ID NO:48), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20L.302 (SEQ ID NO:39), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD 35-36L.349 (SEQ ID NO:49), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20L.329 (SEQ ID NO:40), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD 35-36L.349 (SEQ ID NO:49), or a variant thereof described herein.

[0056] In some embodiments, the first engineered broad-spectrum nuclease is an engineered broad-spectrum nuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO: 6, and the second engineered broad-spectrum nuclease is an engineered broad-spectrum nuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO: 12. In some embodiments, the first and second engineered broad-spectrum nucleases are selected from combinations of broad-spectrum nucleases (and their variants described herein) provided in Table 2.

[0057] Table 2:

[0058]

[0059]

[0060]

[0061] In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.15 (SEQ ID NO:53), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.15 (SEQ ID NO:53), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.66 (SEQ ID NO:54), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.66 (SEQ ID NO:54), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.79 (SEQ ID NO:55), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.79 (SEQ ID NO:55), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20L.249 (SEQ ID NO:38), or a variant thereof as described herein, and the second engineered wide-range nuclease is DMD37-38L.166 (SEQ ID NO:56), or a variant thereof as described herein.

[0062] In some embodiments, the polynucleotide is mRNA. In some embodiments, the first and second nucleic acid sequences are separated by an IRES or a 2A sequence. In some embodiments, the 2A sequence is a T2A, P2A, E2A, or F2A sequence.

[0063] In another aspect, the present invention provides a recombinant DNA construct comprising the polynucleotides described herein (i.e., comprising a first nucleic acid sequence encoding a first engineered broad-spectrum nuclease and a second nucleic acid sequence encoding a second engineered broad-spectrum nuclease).

[0064] In some embodiments, the first and second nucleic acid sequences are separated by an IRES or a 2A sequence. In some embodiments, the 2A sequence is a T2A, P2A, E2A, or F2A sequence.

[0065] In some embodiments, the polynucleotide includes a promoter operatively linked to a first nucleic acid sequence and a second nucleic acid sequence. In some embodiments, the promoter is a muscle-specific promoter. In some embodiments, the muscle-specific promoter includes the MCK promoter, C5-12 promoter, spc 5-12 promoter, MHCK7 promoter, CK8 promoter, SK-CRM4 promoter, SP-301 promoter, SP-817 promoter, or SP-905 promoter. In some embodiments, the promoter is capable of expressing the first and second engineered broad-spectrum nucleases described herein in myoprogenitor cells (e.g., satellite cells or stem cells).

[0066] In some embodiments, the polynucleotide comprises a first promoter operatively linked to a first nucleic acid sequence and a second promoter operatively linked to a second nucleic acid sequence. In some embodiments, the first and second promoters are muscle-specific promoters. In some embodiments, the muscle-specific promoters include the MCK promoter, C5-12 promoter, spc 5-12 promoter, MHCK7 promoter, CK8 promoter, SK-CRM4 promoter, SP-301 promoter, SP-817 promoter, SP-905 promoter, or combinations thereof. In some embodiments, the promoters are capable of expressing the first and second engineered broad-spectrum nucleases described herein in myoprogenitor cells (e.g., satellite cells or stem cells).

[0067] In some embodiments, the recombinant DNA construct encodes a recombinant virus comprising a polynucleotide. In some embodiments, the recombinant virus is a recombinant adenovirus, recombinant lentivirus, recombinant retrovirus, or recombinant AAV. In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an rh.74 capsid. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the rh.74 capsid contains an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity to SEQ ID NO:182. In some embodiments, the rh.74 capsid contains the amino acid sequence of SEQ ID NO:182. In some embodiments, the AAV9 capsid comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with SEQ ID NO:183. In some embodiments, the AAV9 capsid comprises the amino acid sequence of SEQ ID NO:183. In some embodiments, the recombinant AAV has an AAV8 capsid.

[0068] In another aspect, the present invention provides a recombinant virus comprising the polynucleotides described herein (i.e., comprising a first nucleic acid sequence encoding a first engineered broad-spectrum nuclease and a second nucleic acid sequence encoding a second engineered broad-spectrum nuclease).

[0069] In some embodiments, the polynucleotide includes a promoter operatively linked to a first nucleic acid sequence and a second nucleic acid sequence. In some embodiments, the first and second nucleic acid sequences are separated by an IRES or a 2A sequence. In some embodiments, the 2A sequence is a T2A, P2A, E2A, or F2A sequence.

[0070] In some embodiments, the promoter is a muscle-specific promoter. In some embodiments, the muscle-specific promoter includes the MCK promoter, C5-12 promoter, spc 5-12 promoter, MHCK7 promoter, CK8 promoter, SK-CRM4 promoter, SP-301 promoter, SP-817 promoter, or SP-905 promoter. In some embodiments, the promoter is capable of expressing the engineered broad-spectrum nucleases described herein in myogenic precursor cells (e.g., satellite cells or stem cells).

[0071] In some embodiments, the polynucleotide comprises a first promoter operatively linked to a first nucleic acid sequence and a second promoter operatively linked to a second nucleic acid sequence. In some embodiments, the first and second promoters are muscle-specific promoters. In some embodiments, the muscle-specific promoters include the MCK promoter, C5-12 promoter, spc 5-12 promoter, MHCK7 promoter, CK8 promoter, SK-CRM4 promoter, SP-301 promoter, SP-817 promoter, SP-905 promoter, or combinations thereof. In some embodiments, the promoter is capable of expressing the engineered wide-ranging nucleases described herein in myoprogenitor cells (e.g., satellite cells or stem cells). In some embodiments, the recombinant virus is a recombinant adenovirus, recombinant lentivirus, recombinant retrovirus, or recombinant AAV. In some embodiments, the recombinant virus is recombinant AAV. In some embodiments, the recombinant AAV has an rh.74 capsid. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the rh.74 capsid comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with SEQ ID NO:182. In some embodiments, the rh.74 capsid comprises the amino acid sequence of SEQ ID NO:182. In some embodiments, the AAV9 capsid comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with SEQ ID NO:183. In some embodiments, the AAV9 capsid comprises the amino acid sequence of SEQ ID NO:183. In some embodiments, the recombinant AAV has an AAV8 capsid.

[0072] In another aspect, the present invention provides a lipid nanoparticle composition comprising lipid nanoparticles containing the polynucleotides described herein (i.e., comprising a first nucleic acid sequence encoding a first engineered broad-spectrum nuclease and a second nucleic acid sequence encoding a second engineered broad-spectrum nuclease).

[0073] In some embodiments, the polynucleotide is the mRNA described herein. In some embodiments, the polynucleotide is the recombinant DNA construct described herein.

[0074] In another aspect, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a polynucleotide as described herein (i.e., comprising a first nucleic acid sequence encoding a first engineered broad-spectrum nuclease and a second nucleic acid sequence encoding a second engineered broad-spectrum nuclease).

[0075] In some embodiments, the polynucleotide comprises the mRNA described herein. In some embodiments, the polynucleotide comprises the recombinant DNA construct described herein. In some embodiments, the pharmaceutical composition comprises the recombinant virus described herein. In some embodiments, the pharmaceutical composition comprises the lipid nanoparticle composition described herein.

[0076] In another aspect, the present invention provides a method for preparing genetically modified eukaryotic cells having a modified target sequence in the dystrophin gene of genetically modified eukaryotic cells, the method comprising: introducing a polynucleotide into the eukaryotic cell, the polynucleotide comprising a nucleic acid sequence encoding an engineered macronuclease as described herein, wherein the engineered macronuclease is expressed in the eukaryotic cell, and wherein the engineered macronuclease generates a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 6. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a myogenic precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell, or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into the eukaryotic cell via lipid nanoparticles, mRNA, or a recombinant virus (e.g., recombinant AAV).

[0077] In another aspect, the present invention provides a method for preparing genetically modified eukaryotic cells having a modified target sequence in the dystrophin gene of genetically modified eukaryotic cells, the method comprising: introducing an engineered macronuclease as described herein into the eukaryotic cells, wherein the engineered macronuclease generates a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO:6. In some embodiments, the eukaryotic cells are mammalian cells. In some embodiments, the mammalian cells are muscle cells. In some embodiments, the muscle cells are myogenic precursor cells (e.g., satellite cells or stem cells), skeletal muscle cells, or cardiomyocytes. In some embodiments, the mammalian cells are human cells.

[0078] In another aspect, the present invention provides a method for producing genetically modified eukaryotic cells, comprising inserting a target exogenous sequence into a dystrophin gene of a genetically modified eukaryotic cell. The method includes introducing one or more polynucleotides into the eukaryotic cell, comprising: a first nucleic acid sequence encoding an engineered macronuclease as described herein, wherein the engineered macronuclease is expressed in the eukaryotic cell; and a second nucleic acid sequence comprising the target sequence, wherein the engineered macronuclease creates a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO:6; and wherein the target sequence is inserted into the dystrophin gene at the cleavage site. In some embodiments, the second nucleic acid sequence comprises a nucleic acid sequence homologous to a nucleic acid sequence flanking the cleavage site, and the target sequence is inserted into the cleavage site via homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a myogenic precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell, or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some implementations, one or more polynucleotides are introduced into eukaryotic cells via lipid nanoparticles, mRNA, or recombinant viruses (e.g., recombinant AAV).

[0079] In another aspect, the present invention provides a method for producing genetically modified eukaryotic cells, comprising inserting a target exogenous sequence into the dystrophin gene of the genetically modified eukaryotic cell, the method comprising introducing an engineered macronuclease as described herein and a polynucleotide comprising the target sequence into the eukaryotic cell, wherein the engineered macronuclease generates a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO:6, and wherein the target sequence is inserted into the dystrophin gene at the cleavage site. In some embodiments, the polynucleotide comprises a nucleic acid sequence homologous to a nucleic acid sequence flanking the cleavage site, and the target sequence is inserted into the cleavage site via homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a myogenic precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell, or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into the eukaryotic cell via lipid nanoparticles, mRNA, or a recombinant virus (e.g., recombinant AAV).

[0080] In another aspect, the present invention provides a method for preparing genetically modified eukaryotic cells having a modified target sequence in the dystrophin gene of genetically modified eukaryotic cells, the method comprising: introducing a polynucleotide into the eukaryotic cell, the polynucleotide comprising a nucleic acid sequence encoding an engineered macronuclease as described herein, wherein the engineered macronuclease is expressed in the eukaryotic cell, and wherein the engineered macronuclease generates a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO:10. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a myogenic precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell, or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into the eukaryotic cell via lipid nanoparticles, mRNA, or a recombinant virus (e.g., recombinant AAV).

[0081] In another aspect, the present invention provides a method for preparing genetically modified eukaryotic cells having a modified target sequence in the dystrophin gene of genetically modified eukaryotic cells, the method comprising: introducing an engineered macronuclease as described herein into the eukaryotic cells, wherein the engineered macronuclease generates a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO:10. In some embodiments, the eukaryotic cells are mammalian cells. In some embodiments, the mammalian cells are muscle cells. In some embodiments, the muscle cells are myogenic precursor cells (e.g., satellite cells or stem cells), skeletal muscle cells, or cardiomyocytes. In some embodiments, the mammalian cells are human cells.

[0082] In another aspect, the present invention provides a method for producing genetically modified eukaryotic cells, comprising inserting a target exogenous sequence into a dystrophin gene of a genetically modified eukaryotic cell. The method includes introducing one or more polynucleotides into the eukaryotic cell, comprising: a first nucleic acid sequence encoding an engineered macronuclease as described herein, wherein the engineered macronuclease is expressed in the eukaryotic cell; and a second nucleic acid sequence comprising the target sequence, wherein the engineered macronuclease creates a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 10; and wherein the target sequence is inserted into the dystrophin gene at the cleavage site. In some embodiments, the second nucleic acid sequence comprises a nucleic acid sequence homologous to a nucleic acid sequence flanking the cleavage site, and the target sequence is inserted at the cleavage site via homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a myogenic precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell, or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some implementations, one or more polynucleotides are introduced into eukaryotic cells via lipid nanoparticles, mRNA, or recombinant viruses (e.g., recombinant AAV).

[0083] In another aspect, the present invention provides a method for producing genetically modified eukaryotic cells, comprising inserting a target exogenous sequence into a dystrophin gene of a genetically modified eukaryotic cell, the method comprising introducing an engineered macronuclease as described herein and a polynucleotide comprising the target sequence into the eukaryotic cell, wherein the engineered macronuclease generates a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 10, and wherein the target sequence is inserted into the dystrophin gene at the cleavage site. In some embodiments, the polynucleotide comprises a nucleic acid sequence homologous to a nucleic acid sequence flanking the cleavage site, and the target sequence is inserted at the cleavage site via homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a myogenic precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell, or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into the eukaryotic cell via lipid nanoparticles, mRNA, or a recombinant virus (e.g., recombinant AAV).

[0084] In another aspect, the present invention provides a method for preparing genetically modified eukaryotic cells having a modified target sequence in the dystrophin gene of genetically modified eukaryotic cells, the method comprising: introducing a polynucleotide into the eukaryotic cell, the polynucleotide comprising a nucleic acid sequence encoding an engineered macronuclease as described herein, wherein the engineered macronuclease is expressed in the eukaryotic cell, and wherein the engineered macronuclease generates a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO:12. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a myogenic precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell, or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into the eukaryotic cell via lipid nanoparticles, mRNA, or a recombinant virus (e.g., recombinant AAV).

[0085] In another aspect, the present invention provides a method for preparing genetically modified eukaryotic cells having a modified target sequence in the dystrophin gene of genetically modified eukaryotic cells, the method comprising: introducing an engineered macronuclease as described herein into the eukaryotic cells, wherein the engineered macronuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO:12. In some embodiments, the eukaryotic cells are mammalian cells. In some embodiments, the mammalian cells are muscle cells. In some embodiments, the muscle cells are myogenic precursor cells (e.g., satellite cells or stem cells), skeletal muscle cells, or cardiomyocytes. In some embodiments, the mammalian cells are human cells.

[0086] In another aspect, the present invention provides a method for producing genetically modified eukaryotic cells, comprising inserting a target exogenous sequence into a dystrophin gene of a genetically modified eukaryotic cell, the method comprising introducing one or more polynucleotides into the eukaryotic cell, the polynucleotides comprising: a first nucleic acid sequence encoding an engineered macronuclease as described herein, wherein the engineered macronuclease is expressed in the eukaryotic cell; and a second nucleic acid sequence comprising the target sequence, wherein the engineered macronuclease creates a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO:12, and wherein the target sequence is inserted into the dystrophin gene at the cleavage site. In some embodiments, the second nucleic acid sequence comprises a nucleic acid sequence homologous to a nucleic acid sequence flanking the cleavage site, and the target sequence is inserted at the cleavage site by homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell, or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some implementations, one or more polynucleotides are introduced into eukaryotic cells via lipid nanoparticles, mRNA, or recombinant viruses (e.g., recombinant AAV).

[0087] In another aspect, the present invention provides a method for producing genetically modified eukaryotic cells, comprising inserting a target exogenous sequence into the dystrophin gene of the genetically modified eukaryotic cell, the method comprising introducing an engineered macronuclease as described herein and a polynucleotide comprising the target sequence into the eukaryotic cell, wherein the engineered macronuclease generates a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO:12, and wherein the target sequence is inserted into the dystrophin gene at the cleavage site. In some embodiments, the polynucleotide comprises a nucleic acid sequence homologous to a nucleic acid sequence flanking the cleavage site, and the target sequence is inserted at the cleavage site via homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a myogenic precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell, or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into the eukaryotic cell via lipid nanoparticles, mRNA, or a recombinant virus (e.g., recombinant AAV).

[0088] In another aspect, the present invention provides a method for producing genetically modified eukaryotic cells comprising a modified dystrophin gene, the method comprising: introducing one or more polynucleotides into the eukaryotic cell, the polynucleotides comprising a first nucleic acid sequence encoding a first engineered nuclease and a second nucleic acid sequence encoding a second engineered nuclease, wherein the first engineered nuclease binds to and cleaves a recognition sequence in an intron 5' upstream of exon 45, and wherein the second engineered nuclease binds to and cleaves a recognition sequence in an intron 3' downstream of exon 55, wherein the first engineered nuclease and the second engineered nuclease are expressed in the eukaryotic cell, wherein the first engineered nuclease generates a first cleavage site in the dystrophin gene at its recognition sequence, wherein the second engineered nuclease generates a second cleavage site in the dystrophin gene at its recognition sequence, wherein the first cleavage site and the second cleavage site have complementary overhangs, wherein intermediate genomic DNA between the first cleavage site and the second cleavage site is excised from the dystrophin gene, and wherein the dystrophin gene is annealed to produce the modified dystrophin gene.

[0089] In some embodiments, the first engineered nuclease is an engineered broad-spectrum nuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO:6, and the second engineered nuclease is an engineered broad-spectrum nuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO:10. In some embodiments, the first and second engineered broad-spectrum nucleases are selected from combinations of broad-spectrum nucleases (and their variants described herein) provided in Table 1. In such embodiments, the first and second cleavage sites have complementary 3' overhangs. In some embodiments, the first engineered broad-spectrum nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered broad-spectrum nuclease is DMD35-36x.63 (SEQ ID NO:45), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD35-36x.81 (SEQ ID NO:46), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD35-36x.81 (SEQ ID NO:46), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD35-36x.63 (SEQ ID NO:45), or a variant thereof described herein. In some embodiments, the first engineered wide-ranging nuclease is DMD 19-20L.249 (SEQ ID NO:38), or a variant thereof described herein, and the second engineered wide-ranging nuclease is DMD35-36L.195 (SEQ ID NO:47), or a variant thereof described herein. In some embodiments, the first engineered wide-ranging nuclease is DMD 19-20L.302 (SEQ ID NO:39), or a variant thereof described herein, and the second engineered wide-ranging nuclease is DMD35-36L.282 (SEQ ID NO:48), or a variant thereof described herein. In some embodiments, the first engineered wide-ranging nuclease is DMD 19-20L.329 (SEQ ID NO:40), or a variant thereof described herein, and the second engineered wide-ranging nuclease is DMD35-36L.282 (SEQ ID NO:48), or a variant thereof described herein.In some embodiments, the first engineered wide-ranging nuclease is DMD 19-20L.302 (SEQ ID NO:39), or a variant thereof described herein, and the second engineered wide-ranging nuclease is DMD35-36L.349 (SEQ ID NO:49), or a variant thereof described herein. In some embodiments, the first engineered wide-ranging nuclease is DMD 19-20L.329 (SEQ ID NO:40), or a variant thereof described herein, and the second engineered wide-ranging nuclease is DMD35-36L.349 (SEQ ID NO:49), or a variant thereof described herein.

[0090] In some embodiments, the first engineered nuclease is an engineered broad-spectrum nuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO:6, and the second engineered nuclease is an engineered broad-spectrum nuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO:12. In such embodiments, the first and second cleavage sites have complementary 3' overhangs. In some embodiments, the first and second engineered broad-spectrum nucleases are selected from combinations of broad-spectrum nucleases (and their variants described herein) provided in Table 2. In some embodiments, the first engineered broad-spectrum nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered broad-spectrum nuclease is DMD37-38x.15 (SEQ ID NO:53), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.15 (SEQ ID NO:53), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.66 (SEQ ID NO:54), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.66 (SEQ ID NO:54), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.79 (SEQ ID NO:55), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.79 (SEQ ID NO:55), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20L.249 (SEQ ID NO:38), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38L.166 (SEQ ID NO:56), or a variant thereof described herein.

[0091] In some implementations, the complementary protrusions (e.g., 3' protrusions) of the first and second cleavage sites are fully connected to each other.

[0092] In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO:32 or 34. In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO:32. In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO:34.

[0093] In some implementations, the normal reading frames in the modified dystrophin gene are restored compared to the full-length wild-type dystrophin gene.

[0094] In some embodiments, the modified dystrophin gene encodes a modified dystrophin polypeptide that lacks the amino acids encoded by exons 45-55 of the wild-type dystrophin gene. In some embodiments, the modified dystrophin polypeptide comprises the amino acid sequence shown in SEQ ID NO:5.

[0095] In some embodiments, the method includes introducing a first polynucleotide and a second polynucleotide into a eukaryotic cell, the first polynucleotide comprising a first nucleic acid sequence encoding a first engineered wide-ranging nuclease and the second polynucleotide comprising a second nucleic acid sequence encoding a second engineered wide-ranging nuclease. In some embodiments, the first polynucleotide is a first mRNA. In some embodiments, the second polynucleotide is a second mRNA. In some embodiments, the first mRNA and / or the second mRNA is the mRNA described herein (i.e., encoding the engineered wide-ranging nuclease described herein). In some embodiments, the first polynucleotide is a first recombinant DNA construct. In some embodiments, the second polynucleotide is a second recombinant DNA construct. In some embodiments, the first recombinant DNA construct and / or the second recombinant DNA construct is the recombinant DNA construct described herein (i.e., comprising a nucleic acid sequence encoding the engineered wide-ranging nuclease described herein). In some embodiments, the first polynucleotide and the second polynucleotide are introduced into the eukaryotic cell via one or more lipid nanoparticles. In some embodiments, the first polynucleotide is introduced into the eukaryotic cell via a first lipid nanoparticle. In some embodiments, the second polynucleotide is introduced into the eukaryotic cell via a second lipid nanoparticle. In some embodiments, a first polynucleotide is introduced into a eukaryotic cell via a first recombinant virus. In some embodiments, a second polynucleotide is introduced into a eukaryotic cell via a second recombinant virus. In some embodiments, the first and / or second recombinant viruses are recombinant viruses as described herein (i.e., containing a polynucleotide with a nucleic acid sequence encoding the engineered wide-range nucleases described herein).

[0096] In some embodiments, the method includes introducing a polynucleotide comprising a first nucleic acid sequence encoding a first engineered macronuclease and a second nucleic acid sequence encoding a second engineered macronuclease into a eukaryotic cell. In some embodiments, the polynucleotide is mRNA. In some embodiments, the mRNA is the mRNA described herein (i.e., comprising first and second nucleic acid sequences encoding the macronuclease described herein, respectively). In some embodiments, the polynucleotide is a recombinant DNA construct. In some embodiments, the recombinant DNA construct is the recombinant DNA construct described herein (i.e., comprising first and second nucleic acid sequences encoding the macronuclease described herein, respectively). In some embodiments, the polynucleotide is introduced into the eukaryotic cell via lipid nanoparticles. In some embodiments, the polynucleotide is introduced into the eukaryotic cell via a recombinant virus. In some embodiments, the recombinant virus is the recombinant virus described herein (i.e., comprising a polynucleotide containing a first nucleic acid sequence encoding the macronuclease described herein, respectively).

[0097] In some embodiments, the eukaryotic cells are mammalian cells. In some embodiments, the mammalian cells are muscle cells. In some embodiments, the muscle cells are myogenic precursor cells (e.g., satellite cells or stem cells), skeletal muscle cells, or cardiomyocytes. In some embodiments, the mammalian cells are human cells.

[0098] In another aspect, the present invention provides a method for modifying a dystrophin gene in target cells of a subject, wherein the dystrophin gene is characterized by a mutation altering the reading frame of the dystrophin gene from a wild-type source, the method comprising: delivering one or more polynucleotides to target cells, the polynucleotides comprising a first nucleic acid sequence encoding a first engineered nuclease and a second nucleic acid sequence encoding a second engineered nuclease, wherein the first engineered nuclease binds to and cleaves a recognition sequence in the 5' intron upstream of exon 45, and wherein the second engineered nuclease binds to and cleaves a recognition sequence in the 3' intron downstream of exon 55, wherein... A first engineered nuclease and a second engineered nuclease are expressed in target cells, wherein the first engineered nuclease generates a first cleavage site in the dystrophin gene at its recognition sequence, wherein the second engineered nuclease generates a second cleavage site in the dystrophin gene at its recognition sequence, wherein the first cleavage site and the second cleavage site have complementary overhangs, wherein the intermediate genomic DNA between the first cleavage site and the second cleavage site is excised from the dystrophin gene, wherein the dystrophin gene is annealed, and wherein the normal reading frame of the dystrophin gene is restored compared to the full-length wild-type dystrophin gene.

[0099] In some embodiments, the first engineered nuclease is an engineered broad-spectrum nuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO:6, and the second engineered nuclease is an engineered broad-spectrum nuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO:10. In some embodiments, the first and second engineered broad-spectrum nucleases are selected from combinations of broad-spectrum nucleases (and their variants described herein) provided in Table 1. In such embodiments, the first and second cleavage sites have complementary 3' overhangs. In some embodiments, the first engineered broad-spectrum nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered broad-spectrum nuclease is DMD35-36x.63 (SEQ ID NO:45), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD35-36x.81 (SEQ ID NO:46), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD35-36x.81 (SEQ ID NO:46), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD35-36x.63 (SEQ ID NO:45), or a variant thereof described herein. In some embodiments, the first engineered wide-ranging nuclease is DMD 19-20L.249 (SEQ ID NO:38), or a variant thereof described herein, and the second engineered wide-ranging nuclease is DMD35-36L.195 (SEQ ID NO:47), or a variant thereof described herein. In some embodiments, the first engineered wide-ranging nuclease is DMD 19-20L.302 (SEQ ID NO:39), or a variant thereof described herein, and the second engineered wide-ranging nuclease is DMD35-36L.282 (SEQ ID NO:48), or a variant thereof described herein. In some embodiments, the first engineered wide-ranging nuclease is DMD 19-20L.329 (SEQ ID NO:40), or a variant thereof described herein, and the second engineered wide-ranging nuclease is DMD35-36L.282 (SEQ ID NO:48), or a variant thereof described herein.In some embodiments, the first engineered wide-ranging nuclease is DMD 19-20L.302 (SEQ ID NO:39), or a variant thereof described herein, and the second engineered wide-ranging nuclease is DMD35-36L.349 (SEQ ID NO:49), or a variant thereof described herein. In some embodiments, the first engineered wide-ranging nuclease is DMD 19-20L.329 (SEQ ID NO:40), or a variant thereof described herein, and the second engineered wide-ranging nuclease is DMD35-36L.349 (SEQ ID NO:49), or a variant thereof described herein.

[0100] In some embodiments, the first engineered nuclease is an engineered broad-spectrum nuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO:6, and the second engineered nuclease is an engineered broad-spectrum nuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO:12. In some embodiments, the first and second engineered broad-spectrum nucleases are selected from combinations of broad-spectrum nucleases (and their variants described herein) provided in Table 2. In such embodiments, the first and second cleavage sites have complementary 3' overhangs. In some embodiments, the first engineered broad-spectrum nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered broad-spectrum nuclease is DMD37-38x.15 (SEQ ID NO:53), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.15 (SEQ ID NO:53), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.66 (SEQ ID NO:54), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.66 (SEQ ID NO:54), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.79 (SEQ ID NO:55), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.79 (SEQ ID NO:55), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20L.249 (SEQ ID NO:38), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38L.166 (SEQ ID NO:56), or a variant thereof described herein.

[0101] In some implementations, the complementary protrusions (e.g., 3' protrusions) of the first and second cleavage sites are fully connected to each other.

[0102] In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO:32 or 34. In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO:32. In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO:34.

[0103] In some embodiments, the dystrophin gene encodes a modified dystrophin polypeptide that lacks the amino acids encoded by exons 45-55 of the wild-type dystrophin gene. In some embodiments, the modified dystrophin polypeptide comprises the amino acid sequence shown in SEQ ID NO:5. In some embodiments, the subject is converted to the Becker muscular dystrophy phenotype.

[0104] In some embodiments, the method includes delivering a first polynucleotide and a second polynucleotide to target cells, the first polynucleotide comprising a first nucleic acid encoding a first engineered macronuclease and the second polynucleotide comprising a second nucleic acid sequence encoding a second engineered macronuclease. In some embodiments, the first polynucleotide is a first mRNA. In some embodiments, the second polynucleotide is a second mRNA. In some embodiments, the first mRNA and / or the second mRNA are those described herein (i.e., encoding the engineered macronuclease described herein). In some embodiments, the first polynucleotide is a first recombinant DNA construct. In some embodiments, the second polynucleotide is a second recombinant DNA construct. In some embodiments, the first recombinant DNA construct and / or the second recombinant DNA construct are recombinant DNA constructs described herein (i.e., comprising a nucleic acid sequence encoding the engineered macronuclease described herein). In some embodiments, the first and second polynucleotides are delivered to target cells via one or more lipid nanoparticles. In some embodiments, the first polynucleotide is delivered to target cells via a first lipid nanoparticle. In some embodiments, the second polynucleotide is delivered to target cells via a second lipid nanoparticle. In some embodiments, the first polynucleotide is delivered to target cells via a recombinant virus. In some embodiments, the second polynucleotide is delivered to the target cell via a second recombinant virus. In some embodiments, the first and / or second recombinant virus are recombinant viruses as described herein (i.e., containing a polynucleotide with a nucleic acid sequence encoding an engineered wide-ranging nuclease as described herein).

[0105] In some embodiments, the method includes delivering a first polynucleotide and a second polynucleotide to target cells, the first polynucleotide comprising a first nucleic acid encoding a first engineered macronuclease and the second polynucleotide comprising a second nucleic acid sequence encoding a second engineered macronuclease. In some embodiments, the polynucleotide is mRNA. In some embodiments, the mRNA is the mRNA described herein (i.e., comprising first and second nucleic acid sequences encoding the macronuclease described herein, respectively). In some embodiments, the polynucleotide is a recombinant DNA construct. In some embodiments, the recombinant DNA construct is the recombinant DNA construct described herein (i.e., comprising first and second nucleic acid sequences encoding the macronuclease described herein, respectively). In some embodiments, the polynucleotide is delivered to target cells via lipid nanoparticles. In some embodiments, the polynucleotide is delivered to target cells via a recombinant virus. In some embodiments, the recombinant virus is the recombinant virus described herein (i.e., comprising a polynucleotide containing a first nucleic acid sequence encoding the macronuclease described herein, respectively).

[0106] In some embodiments, the subject is a mammal. In some embodiments, the target cells are muscle cells. In some embodiments, the muscle cells are myogenic precursor cells (e.g., satellite cells or stem cells), skeletal muscle cells, or cardiomyocytes. In some embodiments, the subject is a human.

[0107] In another aspect, the present invention provides a method for treating DMD in a subject with this need, wherein the DMD is characterized by a mutation in the dystrophin gene, said mutation altering the reading frame of the dystrophin gene relative to the full-length wild-type dystrophin gene, the method comprising: administering to the subject an effective amount of one or more polynucleotides comprising a first nucleic acid sequence encoding a first engineered nuclease and a second nucleic acid sequence encoding a second engineered nuclease, wherein the first engineered nuclease binds to and cleaves a recognition sequence in the 5' intron upstream of exon 45, and wherein the second engineered nuclease binds to and cleaves a recognition sequence in the 3' intron downstream of exon 55, wherein... One or more polynucleotides are delivered to target cells of a subject, wherein a first engineered nuclease and a second engineered nuclease are expressed in the target cells, wherein the first engineered nuclease generates a first cleavage site in the dystrophin gene at its recognition sequence, wherein the second engineered nuclease generates a second cleavage site in the dystrophin gene at its recognition sequence, wherein the first cleavage site and the second cleavage site have complementary overhangs, wherein intermediate genomic DNA between the first cleavage site and the second cleavage site is excised from the dystrophin gene, wherein the dystrophin gene is annealed, and wherein the normal reading frame of the dystrophin gene is restored compared to the full-length wild-type dystrophin gene.

[0108] In some embodiments, the first engineered nuclease is an engineered broad-spectrum nuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO:6, and the second engineered nuclease is an engineered broad-spectrum nuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO:10. In some embodiments, the first and second engineered broad-spectrum nucleases are selected from combinations of broad-spectrum nucleases (and their variants described herein) provided in Table 1. In such embodiments, the first and second cleavage sites have complementary 3' overhangs. In some embodiments, the first engineered broad-spectrum nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered broad-spectrum nuclease is DMD35-36x.63 (SEQ ID NO:45), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD35-36x.81 (SEQ ID NO:46), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD35-36x.81 (SEQ ID NO:46), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD35-36x.63 (SEQ ID NO:45), or a variant thereof described herein. In some embodiments, the first engineered wide-ranging nuclease is DMD 19-20L.249 (SEQ ID NO:38), or a variant thereof described herein, and the second engineered wide-ranging nuclease is DMD35-36L.195 (SEQ ID NO:47), or a variant thereof described herein. In some embodiments, the first engineered wide-ranging nuclease is DMD 19-20L.302 (SEQ ID NO:39), or a variant thereof described herein, and the second engineered wide-ranging nuclease is DMD35-36L.282 (SEQ ID NO:48), or a variant thereof described herein. In some embodiments, the first engineered wide-ranging nuclease is DMD 19-20L.329 (SEQ ID NO:40), or a variant thereof described herein, and the second engineered wide-ranging nuclease is DMD35-36L.282 (SEQ ID NO:48), or a variant thereof described herein.In some embodiments, the first engineered wide-ranging nuclease is DMD 19-20L.302 (SEQ ID NO:39), or a variant thereof described herein, and the second engineered wide-ranging nuclease is DMD35-36L.349 (SEQ ID NO:49), or a variant thereof described herein. In some embodiments, the first engineered wide-ranging nuclease is DMD 19-20L.329 (SEQ ID NO:40), or a variant thereof described herein, and the second engineered wide-ranging nuclease is DMD35-36L.349 (SEQ ID NO:49), or a variant thereof described herein.

[0109] In some embodiments, the first engineered nuclease is an engineered broad-spectrum nuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO:6, and the second engineered nuclease is an engineered broad-spectrum nuclease described herein that binds to and cleaves the recognition sequence comprising SEQ ID NO:12. In some embodiments, the first and second engineered broad-spectrum nucleases are selected from combinations of broad-spectrum nucleases (and their variants described herein) provided in Table 2. In such embodiments, the first and second cleavage sites have complementary 3' overhangs. In some embodiments, the first engineered broad-spectrum nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered broad-spectrum nuclease is DMD37-38x.15 (SEQ ID NO:53), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.15 (SEQ ID NO:53), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.66 (SEQ ID NO:54), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.66 (SEQ ID NO:54), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.13 (SEQ ID NO:36), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.79 (SEQ ID NO:55), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20x.87 (SEQ ID NO:37), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38x.79 (SEQ ID NO:55), or a variant thereof described herein. In some embodiments, the first engineered wide-range nuclease is DMD 19-20L.249 (SEQ ID NO:38), or a variant thereof described herein, and the second engineered wide-range nuclease is DMD37-38L.166 (SEQ ID NO:56), or a variant thereof described herein.

[0110] In some implementations, the complementary protrusions (e.g., 3' protrusions) of the first and second cleavage sites are fully connected to each other.

[0111] In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO:32 or 34. In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO:32. In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO:34.

[0112] In some embodiments, the dystrophin gene encodes a modified dystrophin polypeptide that lacks the amino acids encoded by exons 45-55 of the wild-type dystrophin gene. In some embodiments, the modified dystrophin polypeptide comprises the amino acid sequence shown in SEQ ID NO:5. In some embodiments, the subject is converted to the Becker muscular dystrophy phenotype.

[0113] In some embodiments, the method includes administering a first polynucleotide and a second polynucleotide to a subject, the first polynucleotide comprising a first nucleic acid encoding a first engineered macronuclease and the second polynucleotide comprising a second nucleic acid sequence encoding a second engineered macronuclease. In some embodiments, the first polynucleotide is a first mRNA. In some embodiments, the second polynucleotide is a second mRNA. In some embodiments, the first mRNA and / or the second mRNA is the mRNA described herein (i.e., encoding the engineered macronuclease described herein). In some embodiments, the first polynucleotide is a first recombinant DNA construct. In some embodiments, the second polynucleotide is a second recombinant DNA construct. In some embodiments, the first recombinant DNA construct and / or the second recombinant DNA construct is the recombinant DNA construct described herein (i.e., comprising a nucleic acid sequence encoding the engineered macronuclease described herein). In some embodiments, the first and second polynucleotides are administered to a subject via lipid nanoparticles. In some embodiments, the first polynucleotide is administered to a subject via first lipid nanoparticles. In some embodiments, the second polynucleotide is administered to a subject via second lipid nanoparticles. In some embodiments, the first polynucleotide is administered to a subject via a first recombinant virus. In some embodiments, the second polynucleotide is administered to the subject via a second recombinant virus. In some embodiments, the first and / or second recombinant virus are recombinant viruses as described herein (i.e., containing a polynucleotide with a nucleic acid sequence encoding an engineered wide-ranging nuclease as described herein).

[0114] In some embodiments, the method includes administering a polynucleotide to a subject, which comprises a first nucleic acid sequence encoding a first engineered macronuclease and a second nucleic acid sequence encoding a second engineered macronuclease. In some embodiments, the polynucleotide is mRNA. In some embodiments, the mRNA is the mRNA described herein (i.e., comprising first and second nucleic acid sequences respectively encoding the macronuclease described herein). In some embodiments, the polynucleotide is a recombinant DNA construct. In some embodiments, the recombinant DNA construct is the recombinant DNA construct described herein (i.e., comprising first and second nucleic acid sequences respectively encoding the macronuclease described herein). In some embodiments, the polynucleotide is administered to a subject via lipid nanoparticles. In some embodiments, the polynucleotide is administered to a subject via a recombinant virus. In some embodiments, the recombinant virus is the recombinant virus described herein (i.e., comprising a polynucleotide containing a first nucleic acid sequence and a second nucleic acid sequence respectively encoding the macronuclease described herein).

[0115] In some embodiments, the subject is a mammal. In some embodiments, the target cells are muscle cells. In some embodiments, the muscle cells are myogenic precursor cells (e.g., satellite cells or stem cells), skeletal muscle cells, or cardiomyocytes. In some embodiments, the subject is a human.

[0116] In another aspect, the present invention provides a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO:32 or SEQ ID NO:34.

[0117] In some embodiments, the polynucleotide comprises a nucleic acid sequence as shown in SEQ ID NO:32. In some embodiments, the polynucleotide is a dystrophin gene in the genome of a cell (e.g., human muscle cells) that comprises a nucleic acid sequence as shown in SEQ ID NO:32. In some embodiments, the polynucleotide is a precursor mRNA in a cell (e.g., human muscle cells) that comprises a nucleic acid sequence as shown in SEQ ID NO:32.

[0118] In some embodiments, the polynucleotide comprises a nucleic acid sequence as shown in SEQ ID NO:34. In some embodiments, the polynucleotide is a dystrophin gene in the genome of a cell (e.g., human muscle cells) that comprises a nucleic acid sequence as shown in SEQ ID NO:34. In some embodiments, the polynucleotide is a precursor mRNA in a cell (e.g., human muscle cells) that comprises a nucleic acid sequence as shown in SEQ ID NO:34.

[0119] In another aspect, the present invention provides a genetically modified eukaryotic cell containing a modified dystrophin gene in its genome, wherein the modified dystrophin gene lacks exons 45-55, and wherein the modified dystrophin gene contains a nucleic acid sequence as shown in SEQ ID NO:32 or as shown in SEQ ID NO:34 within an intron located between exons 44 and 56.

[0120] In some embodiments, the nucleic acid sequence includes SEQ ID NO:32. In some embodiments, the nucleic acid sequence includes SEQ ID NO:34.

[0121] In some embodiments, the genetically modified eukaryotic cells are mammalian cells. In some embodiments, the genetically modified eukaryotic cells are human cells. In some embodiments, the genetically modified eukaryotic cells are muscle cells. In some embodiments, the muscle cells are myogenic precursor cells (e.g., satellite cells or stem cells), skeletal muscle cells, or cardiomyocytes.

[0122] In another aspect, the present invention provides a polypeptide comprising an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with SEQ ID NO:5, wherein said polypeptide is a modified dystrophin lacking the amino acids encoded by exons 45-55 of the dystrophin gene, and said polypeptide comprises the C-terminal domain of dystrophin. In some embodiments, the polypeptide comprises the amino acid sequence shown in SEQ ID NO:5.

[0123] In another aspect, the present invention provides engineered macronucleases as described herein, or polynucleotides as described herein encoding engineered macronucleases, or cells as described herein expressing engineered macronucleases, which are used as pharmaceuticals.

[0124] In some embodiments, the drug can be used to prepare a modified dystrophin gene in a subject. In some embodiments, the drug can be used to treat DMD.

[0125] In another aspect, the present invention provides the use of the engineered macronuclease described herein, or the polynucleotide disclosed herein encoding the engineered macronuclease, or the cells described herein expressing the engineered macronuclease, in the preparation of a medicament for treating DMD, said medicament for increasing the level of modified dystrophin (i.e., lacking the amino acid encoded by exons 45-55 of the dystrophin gene) or reducing symptoms associated with DMD. Attached Figure Description

[0126] Figure 1 This diagram illustrates the approximate location of the DMD large-scale nuclease recognition sequences and explains a method using a dual large-scale nuclease to remove multiple exons from the dystrophin gene. As shown, engineered large-scale nuclease pairs that bind and cleave the DMD 19-20 and DMD 35-36 recognition sequences, or the DMD 19-20 and DM 37-38 recognition sequences, result in the removal of exons 45-55 from the dystrophin gene. These recognition sequence pairs are located within introns, have the same four-base-pair central sequence, and produce cleavage sites with complementary overhangs. Therefore, after exon removal, the gene is joined at the cleavage site, which will be located within an intron between exons 44 and 56. Following posttranscriptional splicing, this genetic modification results in the production of dystrophin mRNA with exon 44 in the same frame as exon 56, which restores the dystrophin gene reading frame and leads to Becker dystrophin expression. It also shows the approximate location where a pair of engineered wide-range nucleases bind to and cleave the DMD 19-20 and DMD 29-30 recognition sequences, resulting in the removal of exon 45 from the dystrophin gene.

[0127] Figure 2 This is a schematic diagram illustrating the exemplary recognition sequences disclosed herein, including sense and antisense sequences for recognition sequences targeting DMD 19-20 (SEQ ID NO: 6 and 7), DMD 29-30 (SEQ ID NO: 8 and 9), DMD 35-36 (SEQ ID NO: 10 and 11), and DMD 37-38 (SEQ ID NO: 12 and 13) in the human dystrophin gene. Each DMD recognition sequence for engineered wide-ranging nuclease targeting described herein comprises two recognition halves. Each recognition halves comprises 9 base pairs separated by a 4-base-pair central sequence. For example, the DMD 19-20 recognition sequence has a 5' DMD19 halves and a 3' DMD20 halves, which have a 4-base-pair central sequence GTAT.

[0128] Figure 3 The engineered large-scale nuclease described herein comprises two subunits, wherein a first subunit contains an HVR1 region (e.g., DMD19) that binds to a first recognition half-site, and a second subunit contains an HVR2 region (e.g., DMD20) that binds to a second recognition half-site. In embodiments in which the engineered large-scale nuclease is a single-stranded large-scale nuclease, the first subunit containing the HVR1 region may be located in an N-terminal or C-terminal subunit. Similarly, the second subunit containing the HVR2 region may be located in an N-terminal or C-terminal subunit.

[0129] Figures 4A-4C . Figure 4A It provides a wide range of nuclease sequences from DMD 19 to 20. Figure 4B It provides a wide range of DMD 35-36 engineered nuclease sequences for comparison. Figure 4C Alignments of DMD 37-38 engineered nuclease sequences are provided. An asterisk indicates conserved residues between all aligned nucleases, and a space indicates that there is at least one amino acid difference between the nucleases.

[0130] Figure 5 This is a schematic diagram of reporter gene assays in CHO cells for evaluating engineered macronucleases targeting recognition sequences found in the dystrophin gene. For the engineered macronucleases described herein, CHO cell lines were generated in which the reporter gene cassette was stably integrated into the cell's genome. The reporter gene cassette contains, in 5' to 3' order: the SV40 early promoter; 5' 2 / 3 of the GFP gene; the recognition sequence of the engineered macronuclease described herein (e.g., recognition sequences for DMD 19-20, DMD 29-30, DMD 35-36, or DMD 37-38); the recognition sequence of the CHO-23 / 24 macronuclease (WO 2012 / 167192); and 3' 2 / 3 of the GFP gene. Cells stably transfected with this cassette do not express GFP in the absence of a DNA breakage inducer. Macronucleases are introduced by transducing the mRNA encoding each macronuclease. When DNA breaks are induced at any of the large-scale nuclease recognition sequences, the repetitive regions of the GFP gene recombine with each other, producing a functional GFP gene. The percentage of cells expressing GFP can then be determined by flow cytometry as an indirect indicator of the frequency of genome cleavage by large-scale nucleases.

[0131] Figure 6A-6I . Figure 6A , 6B 6G provides the efficiency of engineered DMD 19-20 broad-spectrum nuclease binding and cleavage of the DMD 19-20 recognition sequence expressed in CHO cell reporter gene assays. Figure 6C It provides the efficiency of engineered DMD 29-30 broad-spectrum nuclease binding and cleavage of the DMD 29-30 recognition sequence expressed in CHO cell reporter gene assays. Figure 6D and Figure 6H It provides the efficiency of engineered DMD 35-36 broad-spectrum nuclease binding and cleavage of the DMD 35-36 recognition sequence expressed in CHO cell reporter gene assays. Figure 6E , Figure 6F and Figure 6IThe efficiency of the engineered DMD 37-38 macronuclease in binding to and cleaving the DMD 37-38 recognition sequence expressed in a CHO cell reporter gene assay is provided. The relative activity index, representing the percentage of GFP-positive cells expressing the tested macronuclease, is normalized to CHO-23 / 24 macronuclease-expressing cell lines to illustrate macronuclease toxicity.

[0132] Figures 7A-7D The bar graph shows the percentage frequency of insertions and deletions (indels) of the macronucleases tested at two doses targeting the indicated recognition sequences in MRC5 cells. Each macronuclease was tested at three time points (days 2, 5, and 8) post-transfection. Figure 7A The percentage of edits using a wide range of nucleases from DMD 19-20 is provided. Figure 7B The percentage of edits using a wide range of nucleases from DMD 35 to 36 is provided. Figure 7C The percentage of edits using a wide range of nucleases from DMD 37-38 is provided. Figure 7D The percentage of edits using a wide range of nucleases from DMD 29 to 30 is provided.

[0133] Figure 8A and Figure 8B We provide PCR products and sequencing data of perfectly ligated dystrophin genes after engineering with a pair of wide-range nucleases designed to bind and cleave the recognition sequences of DMD 19-20 and DMD 35-36. Figure 8A These are gel images of PCR products using primers ligated with specific amplification complementary recognition sequences from DMD 19-20 and DMD 35-36. Lane 5 represents a combination of DMD 19-20 x.13 and DMD 35-36 x.63 macronucleases. Lane 6 represents a combination of DMD 19-20 x.87 and DMD 35-36 x.81 macronucleases. Lane 7 represents a combination of DMD 19-20 x.13 and DMD 35-36 x.81 macronucleases. Lane 8 represents a combination of DMD 19-20 x.87 and DMD 35-36 x.63 macronucleases. Lane M represents a simulated control. Figure 8B Representative sequencing data are provided showing perfect ligation of a wide range of nuclease recognition sequences in DMD 19-20 and DMD35-36 after genomic sequence cutting and excision.

[0134] Figure 9A and Figure 9B This provides PCR products and sequencing data of perfectly ligated dystrophin genes after engineering with a wide range of nucleases designed to bind and cleave the recognition sequences of DMD 19-20 and DMD 37-38. Figure 8A These are gel images of PCR products using primers ligated with specific amplification complementary recognition sequences from DMD 19-20 and DMD 37-38. Lane 9 represents a combination of DMD 19-20 x.13 and DMD 37-38 x.15 nucleases. Lane 10 represents a combination of DMD 19-20 x.87 and DMD 37-38 x.15 nucleases. Lane 11 represents a combination of DMD 19-20 x.13 and DMD 37-38 x.66 nucleases. Lane 12 represents a combination of DMD 19-20 x.87 and DMD 37-38 x.66 nucleases. Lane 13 represents a combination of DMD 19-20 x.13 and DMD 37-38 x.79 nucleases. Lane 14 represents a combination of DMD19-20x.87 and DMD 37-38x.79 nucleases. Lane M represents a simulated control. Figure 9B Representative sequencing data are provided showing perfect ligation of a wide range of nuclease recognition sequences in DMD 19-20 and DMD 37-38 after genomic sequence cutting and excision.

[0135] Figure 10 PCR products of perfectly ligated dystrophin genes obtained by engineering wide-range nucleases designed to bind and cleave the recognition sequences of DMD 19-20 and DMD 29-30 are provided. Gel images of the PCR products from ligation primers specifically amplifying complementary recognition sequences of DMD 19-20 and DMD 29-30 are shown. Lane 1 represents a combination of wide-range nucleases DMD 19-20x.13 and DMD 29-30x.18. Lane 2 represents a combination of wide-range nucleases DMD 19-20x.87 and DMD 29-30x.40. Lane 3 represents a combination of wide-range nucleases DMD 19-20x.13 and DMD 29-30x.40. Lane 4 represents a combination of wide-range nucleases DMD 19-20x.87 and DMD 29-30x.18. Lane M represents a simulated control.

[0136] Figure 11 A schematic diagram is provided showing the approximate positions of the forward and reverse primers and probes in the reference and perfectly ligated primer sets used to detect post-cleavage ligation events in digital droplet PCR (ddPCR) assays. The diagram illustrates the recognition sequences for ligation of DMD 19-20 and DMD 37-38.

[0137] Figures 12A-12C A bar chart is provided showing the percentage of exon 45-55 or exon 45 alone as assessed by ddPCR. Figure 12AExon deletion data are provided for combinations and simulated controls of DMD 19-20x.13 and DMD 35-36x.63 large-scale nucleases, DMD 19-20x.87 and DMD 35-36x.81 large-scale nucleases, DMD 19-20x.13 and DMD 35-36x.81 large-scale nucleases, and DMD 19-20x.87 and DMD 35-36x.63 large-scale nucleases. Figure 12B Combinations of DMD 19-20x.13 and DMD 37-38x.15 broad-spectrum nucleic acids, DMD 19-20x.87 and DMD 37-38x.15 broad-spectrum nucleases, DMD 19-20x.13 and DMD 37-38x.66 broad-spectrum nucleases, DMD 19-20x.87 and DMD 37-38x.66 broad-spectrum nucleases, DMD 19-20x.13 and DMD 37-38x.79 broad-spectrum nucleases, and DMD 19-20x.87 and DMD 37-38x.79 broad-spectrum nucleases, as well as exon deletion data for simulated controls, are provided. Figure 12C Exon 45 data are provided individually, as well as combinations of DMD 19-20x.13 and DMD 29-30x.18 large-scale nucleases, DMD 19-20x.87 and DMD 29-30x.40 large-scale nucleases, DMD 19-20x.13 and DMD 29-30x.40 large-scale nucleases, DMD 19-20x.87 and DMD 29-30x.18 large-scale nucleases, and exon deletion data for simulated controls.

[0138] Figure 13 Line graphs of perfect ligation events, assessed by ddPCR using a wide range of engineered nucleases in various combinations, are provided.

[0139] Figure 14 Bar graphs showing the percentage of exon 45-55 deletions are provided, evaluated in human skeletal muscle myoblasts (HSMMs) by ddPCR using engineered wide-range nuclease pairs DMD19-20L.249 and DMD37-38L.166. HSMM cells were transfected with mRNA encoding each engineered wide-range nuclease at doses of 20 ng, 40 ng, 80 ng, or 160 ng.

[0140] Figure 15A bar chart is provided showing the percentage of perfectly ligated macronuclease pairs (DMD 19-20L.249 and DMD 37-38L.166) in immortalized myoblast cell lines derived from patients with DMD (AB1098 cells), as assessed by ddPCR. AB1098 cells were transfected with mRNA encoding each macronuclease at doses of 10 ng, 20 ng, 40 ng, 80 ng, or 160 ng.

[0141] Figures 16A-16C Protein expression data are provided for the mRNA or simulated control of a wide range of engineered nucleases encoding DMD 19-20L.249 and DMD 37-38L.166 in AB1098 cells after treatment with 10 ng, 20 ng, 40 ng, 80 ng, or 160 ng. Figure 16A This is a graph showing the expression of dystrophin after treatment with engineered wide-range nuclease combinations or simulated controls. Figure 16B Gel images of shortened dystrophin bands (i.e., lacking the amino acids encoded by exons 45-55) of the correct size are provided. Figure 16C The amount of dystrophin relative to the reference ligand protein gene is provided.

[0142] Figure 17 A bar graph is provided showing RNA splicing of exons 44 to 56 in AB1098 cell mRNA after transfection with mRNA encoding DMD 19-20L.249 and DMD 37-38L.166 engineered wide-range nucleases at doses of 10 ng, 20 ng, 40 ng, 80 ng, or 160 ng, or a simulated control.

[0143] Figure 18 A bar chart is provided showing the percentage of perfectly ligated engineered wide-range nuclease pairs as assessed by ddPCR in HSMM cells. HSMM cells were transfected with 40 ng of mRNA encoding each engineered wide-range nuclease.

[0144] Figure 19 A schematic diagram of an oligo capture assay for determining off-target effects of engineered nucleases (e.g., the engineered broad-spectrum nucleases described herein) is provided. As shown, the integration cassette or oligomer anneals to double-strand breaks in the genome, likely due to cleavage by the engineered nuclease. The DNA is then sheared by sonication, adaptors are ligated, and PCR amplification is performed, followed by sequence analysis to determine the location of the double-strand breaks.

[0145] Figure 20A graph depicting the results of an oligonucleotide capture assay was provided, used to identify off-target cleavage induced by a wide range of nucleases transfected with DMD 19-20x.13, DMD19-20L.249, DMD 19 / 20L.329, DMD 19:20L.374, DMD19-20L.375, DMD 19-20L.431, and DMD 19-20-L.458 in HEK293 cells. Circled dots represent on-target sites, and uncircled dots represent off-target sites. The X-axis represents the number of sequencing reads for each detected off-target site. Shading of the dots indicates the number of base pair mismatches between the on-target site and each detected off-target site. The closer the dot is to the top of the row, the fewer the mismatches.

[0146] Figure 21 A graph depicting the results of the oligo capture assay is provided to identify off-target cleavage induced by a wide range of nucleases transfected with DMD35-36x.63, DMD 35-36L.195, DMD 35-36L.364, DMD 35.36L.372, DMD 35-36L.457, and DMD35.36L.469 in HEK 293 cells. Circled dots represent on-target sites, and uncircled dots represent off-target sites. The X-axis represents the number of sequencing reads for each off-target site. The shading and proximity at the top of the rows indicate the number of base pair mismatches between the on-target site and each detected off-target site.

[0147] Figure 22 A bar chart is provided showing the total percentage (%) of genomic DNA adjacent to exons 45-55 after the recognition sequences of DMD 19-20 and DMD 35-36 are cleaved by the engineered DMD 19-20 and DMD 35-36 extensive nucleases shown for each pair.

[0148] Figure 23AWES protein intensity reads were provided for the shortened modified dystrophin level in AB1098 cells lacking exons 45-55 of the dystrophin gene, which were treated with a wide range of nucleases including DMD 19-20 and DMD 35-36. Lane 1 is the marker control; Lane 2 is the positive control for cardiac dystrophin; Lane 3 is the blank control; Lane 4 is a combination of DMD 19-20L.374 and DMD 35-36L.376 broad-spectrum nucleases; Lane 5 is a combination of DMD 19-20L.374 and DMD 35-36L.457 broad-spectrum nucleases; Lane 6 is a combination of DMD 19-20L.374 and DMD 35-36L.469 broad-spectrum nucleases; Lane 7 is a combination of DMD 19-20L.375 and DMD 35-36L.376 broad-spectrum nucleases; Lane 8 is a combination of DMD19-20L.375 and DMD 35-36L.457 broad-spectrum nucleases; Lane 9 is a combination of DMD 19-20L.375 and DMD... The first track contains a combination of DMD 19-20L.431 and DMD 35-36L.376 nucleases; the second track contains a combination of DMD 19-20L.431 and DMD 35-36L.457 nucleases; the third track contains a combination of DMD 19-20L.458 and DMD 35-36L.376 nucleases; the fourth track contains a combination of DMD 19-20L.458 and DMD 35-36L.457 nucleases; and the fifth track contains a combination of DMD 19-20L.458 and DMD 35-36L.457 nucleases. The combination of nucleases in lanes 35-36L.469; and lane 16 is a control that mimics the AB1098 cell line, which lacks the expression of dystrophin. Figure 23B A bar chart is provided showing the shortened modified dystrophin levels by WES analysis, normalized to a ligand loading control for each pair of engineered DMD 19-20 and DMD 35-36 wide-range nucleases.

[0149] Figures 24A-24B . Figure 24A A bar chart is provided showing the total percentage (%) of genomic DNA adjacent to exons 45-55 after the recognition sequences of DMD 19-20 and DMD 37-38 are cleaved by the engineered DMD 19-20 and DMD 37-38 nucleases shown in each pair. Figure 24BA bar graph is provided showing the percentage (%) of dystrophin recovery for each pair of engineered DMD 19-20 and DMD 37-38 wide-range nucleases, compared to loading equivalent rat quadriceps tissue lysates based on a standard curve generated from this tissue.

[0150] Figures 25A-25E Bar graphs are provided showing the percentage (%) of perfectly linked genomic DNA adjacent to exons 45-55 in muscle tissue after DMD 19-20x.13 and DMD 37-38x.15 engineered wide-range nuclease pairs using different muscle-specific promoter combinations cleaved the recognition sequences of DMD 19-20 and DMD 37-38. Figure 25A The percentage of perfect connectivity in the quadriceps femoris tissue is shown. Figure 25B The percentage of perfect connectivity in the heart tissue is shown. Figure 25C The percentage of perfect connectivity in the diaphragm tissue is shown. Figure 25D The percentage of perfect connectivity in the soleus muscle tissue is shown. Figure 25E The percentage of perfect connectivity in liver tissue is shown.

[0151] Figures 26A-26E A bar chart is provided showing the total percentage (%) of genomic DNA adjacent to exons 45-55 in muscle tissue after the DMD 19-20L.329 and DMD 37-38L.219 engineered wide-range nuclease pairs cleaved the recognition sequences of DMD 19-20 and DMD 35-36. Figure 26A This shows the total percentage of connections within the quadriceps femoris tissue. Figure 26B It shows the total percentage of connections in the heart tissue. Figure 26C This shows the total percentage of connections in the diaphragmatic tissue. Figure 25D The percentage of total connectivity in the soleus muscle tissue is shown. Figure 26E The percentage of total connectivity in liver tissue is shown.

[0152] Figures 27A-27E A bar graph is provided, showing the results at two different dose levels (2x10) with total AAV expressed as total dose. 12 Or 4x10 12 The percentage (%) of total ligation of genomic DNA adjacent to exons 45-55 in muscle tissue after DMD 19-20x.13 and DMD 37-38x.15 recognized sequences were cleaved by DMD 19-20 and DMD 35-36 engineered wide-range nucleases. Figure 27A This shows the total percentage of connections in the quadriceps femoris tissue. Figure 27B It shows the total percentage of connections in the heart tissue. Figure 27CThis shows the total percentage of connections in the diaphragmatic tissue. Figure 27D The percentage of total connections in the tibialis anterior (TA) muscle tissue is shown. Figure 27E The percentage of total connectivity in liver tissue is shown.

[0153] Figures 28A-28C WES protein intensity reads were provided for the shortened modified dystrophin level after treatment with DMD 19–20x.13 and DMD 37–38x.15 nucleases, which removed exons 45–55 of the dystrophin gene. Figures 28A-28C Channels 1-6 represent standard curves showing the intensity of the full-length human dystrophin protein bands from mice expressing human dystrophin; channels 7-8 represent standard curves using 1x10⁻¹⁰ standard curves. 14 Shortened protein band intensity of modified dystrophin in mice treated with a combination of DMD 19-20x.13 and DMD 37-38x.15 wide range of nucleases at VG / kg; channels 9-10 represent the intensity of protein bands from mice treated with 2x10 14 Shortened protein band intensity of modified dystrophin in mice treated with a combination of DMD 19-20x.13 and DMD 37-38x.15 macronucleases at VG / kg; lanes 11-12 represent mice treated with PBS and mice not treated with macronucleases. Figure 28A This indicates the level of shortened modified dystrophin detected in cardiac tissue at the indicated dose; Figure 28B This indicates the level of shortened modified dystrophin detected in diaphragmatic tissue at the indicated dose; Figure 28C This indicates the level of shortened modified dystrophin detected in quadriceps femoris tissue at the indicated dose.

[0154] Figure 29 A graph is provided showing the total percentage (%) of genomic DNA adjacent to exons 45-55 in quadriceps, heart, and diaphragm muscle tissues after the DMD 19-20L.329 and DMD 35-36L.349 engineered wide-range nuclease pairs cleave the recognition sequences of DMD 19-20 and DMD 35-36.

[0155] Figures 30A-30C WES protein intensity reads were provided for the shortened modified dystrophin level after treatment with DMD19-20L.329 and DMD 35-36L.349 nucleases utilizing different muscle-specific promoters, resulting in the deletion of exons 45-55 of the dystrophin gene. Figures 30A-30CThe first lane represents the ladder (molecular weight standard); lanes 2-6 represent the band intensity of the full-length human dystrophin from mice expressing human dystrophin; lane 7 represents the intensity of the band at 1x10⁻⁶ under the control of the CK8 muscle-specific promoter. 14 The intensity of the shortened modified dystrophin band in mice treated with a combination of DMD 19-20L.329 and DMD 35-36L.349 large-scale nucleases at VG / kg; lane 8 represents the intensity of the band at 1x10⁻⁶ under the control of the MHCK7 muscle-specific promoter. 14 Band intensity of shortened modified dystrophin in mice treated with a combination of DMD 19-20L.329 and DMD 35-36L.349 large-scale nucleases at VG / kg; lane 9 indicates the intensity of the band at 1x10⁻¹⁰. 14 Shortened band intensity of modified dystrophin in mice treated with a combination of DMD 19-20L.329 and DMD 35-36L.349 macronucleases at VG / kg, where the DMD 19-20L.329 macronuclease is controlled by the CK8 muscle-specific promoter and the DMD 35-36L.349 macronuclease is controlled by the SPc5-12 muscle-specific promoter; lanes 10-11 represent mice treated with PBS. Figure 30A This indicates the level of shortened modified dystrophin detected in cardiac tissue at the indicated dose; Figure 30B This indicates the level of shortened modified dystrophin detected in diaphragmatic tissue at the indicated dose; and Figure 30C This indicates the level of shortened modified dystrophin detected in quadriceps femoris tissue at the indicated dose.

[0156] Figure 31 A bar graph is provided showing the shortened modified dystrophin levels in mice treated with DMD19-20L.329 and DMD 35-36L.349 broad-spectrum nucleases or PBS in the quadriceps, heart, and diaphragm tissues, normalized to the ligamentin loading control by WES analysis.

[0157] Figure 32 Immunohistochemical images of quadriceps, heart, and diaphragm muscle tissues from mice treated with a combination of DMD 19-20L.329 and DMD 35-36L.349 broad-spectrum nucleases or PBS are provided. Dark staining represents detection of human dystrophin, which is only visible in mice treated with the broad-spectrum nuclease combination.

[0158] Figure 33A and Figure 33BFluorescent immunohistochemical images of mouse quadriceps femoris tissue after treatment with a wide range of nuclease pairs, delivered to hDMDdel52 / mdx (hDMD) mice using AAV9 capsid delivery of PBS or DMD 19-20L.329 and DMD35-36L.349, are provided. Figure 33A Images of Pax7 expression in quadriceps femoris muscle tissue from PBS-treated mice are provided. The left image is a control image showing any background staining from the primary and secondary antibodies used to detect the expression of the broadly expressed nuclease. The middle image shows cells expressing Pax7, indicated by white arrows; and the right image shows Pax7 (white arrows) and any background staining from the antibodies used to detect the expression of the broadly expressed nuclease. Figure 33B Images of macronuclease and Pax7 expression in quadriceps femoris muscle tissue from macronuclease-treated mice are provided. The left image shows cells expressing only macronuclease, indicated by white arrows; cells expressing both macronuclease protein and Pax7 are indicated by full arrows. The middle image shows cells expressing only Pax7 (indicated by white arrows) or Pax7 and macronuclease protein (indicated by full arrows). The right image shows cells expressing either macronuclease protein or Pax7 (indicated by arrows), or both macronuclease protein and Pax7 (indicated by full arrows).

[0159] Figure 34 A schematic diagram of the BaseScope assay for detecting mRNA expression of modified dystrophin transcripts is provided, in which exons 45-55 of the human dystrophin gene have been deleted following expression of two nucleases. The first nuclease binds to and cleaves the recognition sequence located in the 5' immediate neighbor intron of exon 45, while the second nuclease binds to and cleaves the recognition sequence located in the 3' immediate neighbor intron of exon 55. As shown, the nucleases binding to and cleaving the recognition sequences in these introns cause double-strand breaks, which are then repaired by direct rejoining of the genome. Following transcription and splicing, mRNA is produced with exons 44 and 56 spliced ​​together. This modified human dystrophin transcript is then detected in muscle tissue sections using probes designed to recognize this exon 44-exon 56 link (denoted as the E44-E56 link).

[0160] Figure 35A and Figure 35B BaseScope staining of mouse quadriceps femoris tissue from hDMDdel52 / mdx (hDMD) mice treated with PBS or DMD 19-20L.329 and DMD 35-36L.349 broad-spectrum nucleases was provided. Figure 35ABaseScope staining of Pax7 transcript expression from muscle tissue of PBS-treated mice is shown, along with any background staining used to detect probes for modified human dystrophin transcript expression. Figure 35B BaseScope staining of muscle tissue from mice treated with DMD 19-20L.329 and DMD 35-36L.349 macronucleases shows Pax7 transcript expression and modified human dystrophin transcript expression.

[0161] Figure 36 WES protein intensity reads were provided for the shortened modified dystrophin level targeting exons 45-55 of the dystrophin gene after electroporation of KM1328 patient cell lines that normally lack dystrophin expression with 20 ng, 80 ng, and 160 ng of mRNA encoding macronucleases. The results were obtained by electroporation of macronucleases encoding DMD19-20L.329 and DMD 35-36L.349 macronucleases. Lane 1 represents the ladder (molecular weight standard); Lane 2 represents the simulated control; Lanes 3-5 represent the band intensity of shortened modified dystrophin in cells treated with 20 ng, 80 ng, and 160 ng macronuclease mRNA; and Lane 6 represents the band intensity of full-length human dystrophin.

[0162] Figure 37 WES protein intensity reads were provided for the shortened modified dystrophin level targeting exons 45-55 of the dystrophin gene after electroporation of AB1098 patient cell lines normally lacking dystrophin with 80 ng of mRNA encoding a broad range of nucleases using DMD 19-20L.329 and DMD 35-36L.349 broad range nucleases. Lane 1 represents the band intensity of full-length human dystrophin; Lane 2 represents the simulated control; and Lane 3 represents the band intensity of shortened modified dystrophin in cells treated with 80 ng of broad range nuclease mRNA.

[0163] Figures 38A-38D Fluorescent immunohistochemical images of mouse quadriceps femoris tissue after treatment with PBS or DMD19-20L.329 and DMD35-36L.349 broad-spectrum nuclease pairs delivered to hDMDdel52 / mdx (hDMD) mice using AAVrH74 capsid are provided. Figure 38AImages of Pax7 expression in quadriceps femoris muscle tissue from PBS-treated mice are provided. The left image is a control image, showing any background staining with primary and secondary antibodies used to detect broad nuclease expression; asterisks indicate non-specific background detection. The middle image shows Pax7-expressing cells indicated by white arrows; the right image shows Pax7 (white arrows) and any background staining from antibodies used to detect broad nuclease expression indicated by asterisks. Figure 38B Provided from 1x10 14 Images of extensive nuclease and Pax7 expression in the quadriceps femoris muscle tissue of mice treated with a VG / kg dose of extensive nucleases; Figure 38C Provided from 3x10 13 Images of mice subjected to a wide range of nuclease treatments at VG / kg doses; and Figure 38D Provided from 1x10 13 Images of mice treated with a wide range of nucleases at doses of VG / kg. Figures 38B-38D The left image in the middle shows cells expressing only a wide range of nucleases; the middle image shows cells expressing Pax7; and the image in the left image shows cells expressing only a wide range of nucleases. Figures 38B-38D The right image shows cells expressing a wide range of nuclease proteins or Pax7, or cells expressing both a wide range of nuclease proteins and Pax7, as indicated by the full arrow. An asterisk indicates non-specific background staining.

[0164] Brief description of the sequence

[0165] SEQ ID NO:1 shows the amino acid sequence of the wild-type I-CreI macronuclease from Chlamydomonas reinhardtii.

[0166] SEQ ID NO:2 shows the amino acid sequence of the LAGLIDADG motif.

[0167] SEQ ID NO:3 shows the amino acid sequence of the nuclear localization signal.

[0168] SEQ ID NO:4 shows the amino acid sequence of wild-type muscular dystrophy protein CCDS48091.1 (GeneID 1756).

[0169] SEQ ID NO:5 shows the amino acid sequence of wild-type dystrophin CCDS48091.1 (GeneID 1756) lacking the amino acids encoded by exons 45-55.

[0170] SEQ ID NO:6 shows the nucleic acid sequence of the sense strand of the DMD 19-20 recognition sequence.

[0171] SEQ ID NO:7 shows the nucleic acid sequence with the antisense strand of the DMD 19-20 recognition sequence.

[0172] SEQ ID NO:8 shows the nucleic acid sequence of the sense strand of the DMD 29-30 recognition sequence.

[0173] SEQ ID NO:9 shows the nucleic acid sequence of the antisense strand of the DMD 29-30 recognition sequence.

[0174] SEQ ID NO:10 shows the nucleic acid sequence of the sense strand of the DMD 35-36 recognition sequence.

[0175] SEQ ID NO:11 shows the nucleic acid sequence of the antisense strand of the DMD 35-36 recognition sequence.

[0176] SEQ ID NO:12 shows the nucleic acid sequence of the sense strand of the DMD 37-38 recognition sequence.

[0177] SEQ ID NO:13 shows the nucleic acid sequence of the antisense strand of the DMD 37-38 recognition sequence.

[0178] SEQ ID NO:14 shows the nucleic acid sequence of the sense strand at the first half site of the DMD 19-20 recognition sequence.

[0179] SEQ ID NO:15 shows the nucleic acid sequence of the first half site of the antisense strand of the DMD 19-20 recognition sequence.

[0180] SEQ ID NO:16 shows the nucleic acid sequence of the sense strand at the first half site of the DMD 29-30 recognition sequence.

[0181] SEQ ID NO:17 shows the nucleic acid sequence of the first half site of the antisense strand of the DMD 29-30 recognition sequence.

[0182] SEQ ID NO:18 shows the nucleic acid sequence of the sense strand at the first half site of the DMD 35-36 recognition sequence.

[0183] SEQ ID NO:19 shows the nucleic acid sequence of the first half site of the antisense strand of the DMD 35-36 recognition sequence.

[0184] SEQ ID NO:20 shows the nucleic acid sequence of the sense strand at the first half site of the DMD 37-38 recognition sequence.

[0185] SEQ ID NO:21 shows the nucleic acid sequence of the first half site of the antisense strand of the DMD 37-38 recognition sequence.

[0186] SEQ ID NO:22 shows the nucleic acid sequence of the sense strand at the second half of the DMD 19-20 recognition sequence.

[0187] SEQ ID NO:23 shows the nucleic acid sequence of the antisense strand of the second half site of the DMD 19-20 recognition sequence.

[0188] SEQ ID NO:24 shows the nucleic acid sequence of the sense strand at the second half of the DMD 29-30 recognition sequence.

[0189] SEQ ID NO:25 shows the nucleic acid sequence of the second half site of the antisense strand of the DMD 29-30 recognition sequence.

[0190] SEQ ID NO:2 shows the nucleic acid sequence of the sense strand at the second half of the DMD 35-36 recognition sequence.

[0191] SEQ ID NO:27 shows the nucleic acid sequence of the antisense strand of the second half site of the DMD 35-36 recognition sequence.

[0192] SEQ ID NO:28 shows the nucleic acid sequence of the sense strand at the second half of the DMD 37-38 recognition sequence.

[0193] SEQ ID NO:29 shows the nucleic acid sequence of the antisense strand of the second half site of the DMD 37-38 recognition sequence.

[0194] SEQ ID NO:30 shows the nucleic acid sequence of the sense strand of the linked hybrid DMD 19-20 / 29-30.

[0195] SEQ ID NO:31 shows the nucleic acid sequence of the sense strand of the ligated hybrid DMD 19-20 / 29-30.

[0196] SEQ ID NO:32 shows the nucleic acid sequence of the linked hybrid DMD 19-20 / 35-36 sense strand.

[0197] SEQ ID NO:33 shows the nucleic acid sequence of the ligated hybrid DMD 19-20 / 35-36 sense strand.

[0198] SEQ ID NO:34 shows the nucleic acid sequence of the linked hybrid DMD 19-20 / 37-38 sense strand.

[0199] SEQ ID NO:35 shows the nucleic acid sequence of the linked hybrid DMD 19-20 / 37-38 sense strand.

[0200] SEQ ID NO:36 shows the amino acid sequence of the DMD 19-20x.13 engineered wide range of nucleases.

[0201] SEQ ID NO:37 shows the amino acid sequence of the DMD 19-20x.87 engineered wide range of nucleases.

[0202] SEQ ID NO:38 shows the amino acid sequence of the DMD 19-20L.249 engineered wide range of nucleases.

[0203] SEQ ID NO:39 shows the amino acid sequence of the DMD 19-20L.302 engineered wide range of nucleases.

[0204] SEQ ID NO:40 shows the amino acid sequence of the DMD 19-20L.329 engineered wide range of nucleases.

[0205] SEQ ID NO:41 shows the amino acid sequence of the DMD 19-20L.374 engineered wide range of nucleases.

[0206] SEQ ID NO:42 shows the amino acid sequence of the DMD 19-20L.375 engineered wide range of nucleases.

[0207] SEQ ID NO:43 shows the amino acid sequence of the DMD 19-20L.431 engineered wide range of nucleases.

[0208] SEQ ID NO:44 shows the amino acid sequence of the DMD 19-20L.458 engineered wide range of nucleases.

[0209] SEQ ID NO:45 shows the amino acid sequence of the DMD 35-36x.63 engineered wide range of nucleases.

[0210] SEQ ID NO:46 shows the amino acid sequence of the DMD 35-36x.81 engineered wide range of nucleases.

[0211] SEQ ID NO:47 shows the amino acid sequence of the DMD 35-36L.195 engineered wide range of nucleases.

[0212] SEQ ID NO:48 shows the amino acid sequence of the DMD35-36L.282 engineered wide range of nucleases.

[0213] SEQ ID NO:49 shows the amino acid sequence of the DMD35-36L.349 engineered wide range of nucleases.

[0214] SEQ ID NO:50 shows the amino acid sequence of the DMD 35-36L.376 engineered wide range of nucleases.

[0215] SEQ ID NO:51 shows the amino acid sequence of the DMD 35-36L.457 engineered wide range of nucleases.

[0216] SEQ ID NO:52 shows the amino acid sequence of the DMD 35-36L.469 engineered wide-range nuclease.

[0217] SEQ ID NO:53 shows the amino acid sequence of the DMD 37-38x.15 engineered wide range of nucleases.

[0218] SEQ ID NO:54 shows the amino acid sequence of the DMD 37-38x.66 engineered wide-range nuclease.

[0219] SEQ ID NO:55 shows the amino acid sequence of the DMD 37-38x.79 engineered wide range of nucleases.

[0220] SEQ ID NO:56 shows the amino acid sequence of the DMD 37-38x.166 engineered wide-range nuclease.

[0221] SEQ ID NO:57 shows the amino acid sequence of the DMD 37-38L.478 engineered wide range of nucleases.

[0222] SEQ ID NO:58 shows the amino acid sequence of the DMD 37-38L.512 engineered wide range of nucleases.

[0223] SEQ ID NO:59 shows the amino acid sequence of the DMD 37-38L.528 engineered wide range of nucleases.

[0224] SEQ ID NO:60 shows the nucleic acid sequence encoding the DMD 19-20x.13 engineered wide-range nuclease.

[0225] SEQ ID NO:61 shows the nucleic acid sequence encoding the DMD 19-20x.87 engineered wide-range nuclease.

[0226] SEQ ID NO:62 shows the nucleic acid sequence encoding the DMD 19-20L.249 engineered wide-range nuclease.

[0227] SEQ ID NO:64 shows the nucleic acid sequence encoding the DMD 19-20L.302 engineered wide-range nuclease.

[0228] SEQ ID NO:64 shows the nucleic acid sequence encoding the DMD 19-20L.309 engineered wide-range nuclease.

[0229] SEQ ID NO:65 shows the nucleic acid sequence encoding the DMD 19-20L.374 engineered wide-range nuclease.

[0230] SEQ ID NO:66 shows the nucleic acid sequence encoding the DMD 19-20L.375 engineered wide-range nuclease.

[0231] SEQ ID NO:67 shows the nucleic acid sequence encoding the DMD 19-20L.431 engineered wide range of nucleases.

[0232] SEQ ID NO:68 shows the nucleic acid sequence encoding the DMD 19-20L.458 engineered wide-range nuclease.

[0233] SEQ ID NO:69 shows the nucleic acid sequence encoding the DMD 35-36x.63 engineered wide-range nuclease.

[0234] SEQ ID NO:70 shows the nucleic acid sequence encoding the DMD 35-36x.81 engineered wide-range nuclease.

[0235] SEQ ID NO:71 shows the nucleic acid sequence encoding the DMD 35-36L.195 engineered wide range of nucleases.

[0236] SEQ ID NO:72 shows the nucleic acid sequence encoding the DMD 35-36L.282 engineered wide range of nucleases.

[0237] SEQ ID NO:73 shows the nucleic acid sequence encoding the DMD 35-36L.349 engineered wide range of nucleases.

[0238] SEQ ID NO:74 shows the nucleic acid sequence encoding the DMD 35-36L.376 engineered wide range of nucleases.

[0239] SEQ ID NO:75 shows the nucleic acid sequence encoding the DMD 35-36L.457 engineered wide range of nucleases.

[0240] SEQ ID NO:76 shows the nucleic acid sequence encoding the DMD 35-36L.469 engineered wide range of nucleases.

[0241] SEQ ID NO:77 shows the nucleic acid sequence encoding the DMD 37-38x.15 engineered wide-range nuclease.

[0242] SEQ ID NO:78 shows the nucleic acid sequence encoding the DMD 37-38x.66 engineered wide-range nuclease.

[0243] SEQ ID NO:79 shows the nucleic acid sequence encoding the DMD 37-38x.79 engineered wide-range nuclease.

[0244] SEQ ID NO:80 shows the nucleic acid sequence encoding the DMD 37-38L.166 engineered wide-range nuclease.

[0245] SEQ ID NO:81 shows the nucleic acid sequence encoding the DMD 37-38L.478 engineered wide range of nucleases.

[0246] SEQ ID NO:82 shows the nucleic acid sequence encoding the DMD 37-38L.512 engineered wide range of nucleases.

[0247] SEQ ID NO:83 shows the nucleic acid sequence encoding the DMD 37-38L.528 engineered wide range of nucleases.

[0248] SEQ ID NO:84 shows the amino acid sequence of the DMD19 binding subunit of the DMD19-20x.13 engineered wide-range nuclease.

[0249] SEQ ID NO:85 shows the amino acid sequence of the DMD19 binding subunit of the DMD19-20x.87 engineered wide range of nucleases.

[0250] SEQ ID NO:86 shows the amino acid sequence of the DMD19 binding subunit of the DMD19-20L.249 engineered wide range of nucleases.

[0251] SEQ ID NO:87 shows the amino acid sequence of the DMD19 binding subunit of the DMD19-20L.302 engineered wide-range nuclease.

[0252] SEQ ID NO:88 shows the amino acid sequence of the DMD19 binding subunit of the DMD19-20L.329 engineered wide range of nucleases.

[0253] SEQ ID NO:89 shows the amino acid sequence of the DMD19 binding subunit of the DMD19-20L.374 engineered wide-range nuclease.

[0254] SEQ ID NO:90 shows the amino acid sequence of the DMD19 binding subunit of the DMD19-20L.375 engineered wide-range nuclease.

[0255] SEQ ID NO:91 shows the amino acid sequence of the DMD19 binding subunit of the DMD19-20L.431 engineered wide range of nucleases.

[0256] SEQ ID NO:92 shows the amino acid sequence of the DMD19 binding subunit of the DMD19-20L.458 engineered wide-range nuclease.

[0257] SEQ ID NO:93 shows the amino acid sequence of the DMD35 binding subunit of the DMD 35-36x.63 engineered wide-range nuclease.

[0258] SEQ ID NO:94 shows the amino acid sequence of the DMD35 binding subunit of the DMD 35-36x.81 engineered wide range of nucleases.

[0259] SEQ ID NO:95 shows the amino acid sequence of the DMD35 binding subunit of the DMD35-36L.195 engineered wide range of nucleases.

[0260] SEQ ID NO:96 shows the amino acid sequence of the DMD35 binding subunit of the DMD35-36L.282 engineered wide range of nucleases.

[0261] SEQ ID NO:97 shows the amino acid sequence of the DMD35 binding subunit of the DMD35-36L.349 engineered wide range of nucleases.

[0262] SEQ ID NO:98 shows the amino acid sequence of the DMD35 binding subunit of the DMD35-36L.376 engineered wide range of nucleases.

[0263] SEQ ID NO:99 shows the amino acid sequence of the DMD35 binding subunit of the DMD35-36L.457 engineered wide range of nucleases.

[0264] SEQ ID NO:100 shows the amino acid sequence of the DMD35 binding subunit of the DMD35-36L.469 engineered wide range of nucleases.

[0265] SEQ ID NO:101 shows the amino acid sequence of the DMD37 binding subunit of the DMD 37-38x.15 engineered wide range of nucleases.

[0266] SEQ ID NO:102 shows the amino acid sequence of the DMD37-38x.66 engineered wide-range nuclease DMD37 binding subunit.

[0267] SEQ ID NO:103 shows the amino acid sequence of the DMD37-38x.79 engineered wide-range nuclease DMD37 binding subunit.

[0268] SEQ ID NO:104 shows the amino acid sequence of the DMD37 binding subunit of the DMD37-38L.166 engineered wide range of nucleases.

[0269] SEQ ID NO:105 shows the amino acid sequence of the DMD37 binding subunit of the DMD37-38L.478 engineered wide range of nucleases.

[0270] SEQ ID NO:106 shows the amino acid sequence of the DMD37 binding subunit of the DMD 37-38L.512 engineered wide range of nucleases.

[0271] SEQ ID NO:107 shows the amino acid sequence of the DMD37 binding subunit of the DMD37-38L.528 engineered wide range of nucleases.

[0272] SEQ ID NO:108 shows the amino acid sequence of the DMD20 binding subunit of the DMD 19-20x.13 engineered wide-range nuclease.

[0273] SEQ ID NO:109 shows the amino acid sequence of the DMD20 binding subunit of the DMD 19-20x.87 engineered wide-range nuclease.

[0274] SEQ ID NO:110 shows the amino acid sequence of the DMD20 binding subunit of the DMD 19-20L.249 engineered wide-range nuclease.

[0275] SEQ ID NO:111 shows the amino acid sequence of the DMD20 binding subunit of the DMD 19-20L.302 engineered wide-range nuclease.

[0276] SEQ ID NO:112 shows the amino acid sequence of the DMD20 binding subunit of the DMD 19-20L.329 engineered wide range of nucleases.

[0277] SEQ ID NO:113 shows the amino acid sequence of the DMD20 binding subunit of the DMD 19-20L.374 engineered wide-range nuclease.

[0278] SEQ ID NO:114 shows the amino acid sequence of the DMD20 binding subunit of the DMD 19-20L.375 engineered wide-range nuclease.

[0279] SEQ ID NO:115 shows the amino acid sequence of the DMD20 binding subunit of the DMD 19-20L.431 engineered wide-range nuclease.

[0280] SEQ ID NO:116 shows the amino acid sequence of the DMD20 binding subunit of the DMD 19-20L.458 engineered wide-range nuclease.

[0281] SEQ ID NO:117 shows the amino acid sequence of the DMD36 binding subunit of the DMD 35-36x.63 engineered wide-range nuclease.

[0282] SEQ ID NO:118 shows the amino acid sequence of the DMD36 binding subunit of the DMD 35-36x.81 engineered wide-range nuclease.

[0283] SEQ ID NO:119 shows the amino acid sequence of the DMD36 binding subunit of the DMD35-36L.195 engineered wide range of nucleases.

[0284] SEQ ID NO:120 shows the amino acid sequence of the DMD36 binding subunit of the DMD35-36L.282 engineered wide range of nucleases.

[0285] SEQ ID NO:121 shows the amino acid sequence of the DMD36 binding subunit of the DMD35-36L.349 engineered wide range of nucleases.

[0286] SEQ ID NO:122 shows the amino acid sequence of the DMD36 binding subunit of the DMD35-36L.376 engineered wide range of nucleases.

[0287] SEQ ID NO:123 shows the amino acid sequence of the DMD36 binding subunit of the DMD35-36L.457 engineered wide range of nucleases.

[0288] SEQ ID NO:124 shows the amino acid sequence of the DMD36 binding subunit of the DMD35-36L.469 engineered wide range of nucleases.

[0289] SEQ ID NO:125 shows the amino acid sequence of the DMD38 binding subunit of the DMD 37-38x.15 engineered wide-range nuclease.

[0290] SEQ ID NO:126 shows the amino acid sequence of the DMD38 binding subunit of the DMD 37-38x.66 engineered wide-range nuclease.

[0291] SEQ ID NO:127 shows the amino acid sequence of the DMD38 binding subunit of the DMD 37-38x.79 engineered wide-range nuclease.

[0292] SEQ ID NO:128 shows the amino acid sequence of the DMD38 binding subunit of the DMD 37-38L.166 engineered wide-range nuclease.

[0293] SEQ ID NO:129 shows the amino acid sequence of the DMD38 binding subunit of the DMD37-38L.468 engineered wide range of nucleases.

[0294] SEQ ID NO:130 shows the amino acid sequence of the DMD38 binding subunit of the DMD 37-38L.512 engineered wide range of nucleases.

[0295] SEQ ID NO:131 shows the amino acid sequence of the DMD38 binding subunit of the DMD 37-38L.528 engineered wide range of nucleases.

[0296] SEQ ID NO:132 shows the amino acid sequence of the linker sequence.

[0297] SEQ ID NO:133 shows the nucleic acid sequence of the probe used in a ddPCR assay for detecting INDEL at the DMD 19-20 recognition sequence.

[0298] SEQ ID NO:134 shows the nucleic acid sequence of the forward PCR primers used in a ddPCR assay for detecting INDEL at the DMD 19-20 recognition sequence.

[0299] SEQ ID NO:135 shows the nucleic acid sequence of the forward PCR primers used in a ddPCR assay for detecting INDEL at the DMD 19-20 recognition sequence.

[0300] SEQ ID NO:136 shows the nucleic acid sequence of the probe used as a reference in a ddPCR assay for detecting INDEL.

[0301] SEQ ID NO:137 shows the nucleic acid sequence of the forward PCR primer used as a reference in a ddPCR assay for detecting INDEL.

[0302] SEQ ID NO:138 shows the nucleic acid sequence of the forward PCR primer used as a reference in a ddPCR assay for detecting INDEL.

[0303] SEQ ID NO:139 shows the nucleic acid sequence of the probe used in a ddPCR assay for detecting INDEL at the DMD 37-38 recognition sequence.

[0304] SEQ ID NO:140 shows the nucleic acid sequence of the forward PCR primers used in a ddPCR assay for detecting INDEL at the DMD 37-38 recognition sequence.

[0305] SEQ ID NO:141 shows the nucleic acid sequence of the forward PCR primers used in a ddPCR assay for detecting INDEL at the DMD 37-38 recognition sequence.

[0306] SEQ ID NO:142 shows the nucleic acid sequence of the probe used in a ddPCR assay for detecting INDEL at the DMD 35-36 recognition sequence.

[0307] SEQ ID NO:143 shows the nucleic acid sequence of the forward PCR primers used in a ddPCR assay for detecting INDEL at the DMD 35-36 recognition sequence.

[0308] SEQ ID NO:144 shows the nucleic acid sequence of the forward PCR primers used in a ddPCR assay for detecting INDEL at the DMD 35-36 recognition sequence.

[0309] SEQ ID NO:145 shows the nucleic acid sequence of the probe used in a ddPCR assay for detecting INDEL at the DMD 29-30 recognition sequence.

[0310] SEQ ID NO:146 shows the nucleic acid sequence of the forward PCR primers used in a ddPCR assay for detecting INDEL at the DMD 29-30 recognition sequence.

[0311] SEQ ID NO:147 shows the nucleic acid sequence of the forward PCR primers used in a ddPCR assay for detecting INDEL at the DMD 29-30 recognition sequence.

[0312] SEQ ID NO:148 shows the nucleic acid sequence of the forward PCR primers used in the PCR amplification assay for the recognition sequence ligation of DMD 19-20 to DMD 35-36.

[0313] SEQ ID NO:149 shows the nucleic acid sequence of the reverse PCR primers used in the PCR amplification assay for the recognition sequence ligation of DMD 19-20 to DMD 35-36.

[0314] SEQ ID NO:150 shows the nucleic acid sequence of the forward PCR primers used in the PCR amplification assay for the recognition sequence ligation of DMD 19-20 to DMD 35-36.

[0315] SEQ ID NO:151 shows the nucleic acid sequence of the reverse PCR primers used in the PCR amplification assay for the recognition sequence ligation of DMD 19-20 to DMD 35-36.

[0316] SEQ ID NO:152 shows the nucleic acid sequence of the forward PCR primers used in the PCR amplification assay for the recognition sequence ligation from DMD 19-20 to DMD 29-30.

[0317] SEQ ID NO:153 shows the nucleic acid sequence of the reverse PCR primers used in the PCR amplification assay for the recognition sequence ligation of DMD 19-20 to DMD 29-30.

[0318] SEQ ID NO:154 shows the nucleic acid sequence of the forward PCR primers used in the PCR amplification assay for the recognition sequence ligation from DMD 19-20 to DMD 29-30.

[0319] SEQ ID NO:155 shows the nucleic acid sequence of the reverse PCR primers used in the PCR amplification assay for the recognition sequence ligation of DMD 19-20 to DMD 29-30.

[0320] SEQ ID NO:156 shows the nucleic acid sequence of the forward PCR primers used in the PCR amplification assay for the recognition sequence ligation of DMD 19-20 to DMD 37-38.

[0321] SEQ ID NO:157 shows the nucleic acid sequence of the reverse PCR primers used in the PCR amplification assay for the recognition sequence used to ligate DMD 19-20 to DMD 37-38.

[0322] SEQ ID NO:158 shows the nucleic acid sequence of the forward PCR primers used in the PCR amplification assay for the recognition sequence ligation of DMD 19-20 to DMD 37-38.

[0323] SEQ ID NO:159 shows the nucleic acid sequence of the reverse PCR primers used in the PCR amplification assay for the recognition sequence ligation of DMD 19-20 to DMD 37-38.

[0324] SEQ ID NO:160 shows the nucleic acid sequence of the probe used in ddPCR assays for the recognition sequence used to ligate DMD 19-20 to DMD 37-38.

[0325] SEQ ID NO:161 shows the nucleic acid sequence of the forward PCR primers used in ddPCR assays for the recognition sequence used to ligate DMD 19-20 to DMD 37-38.

[0326] SEQ ID NO:162 shows the nucleic acid sequence of the reverse PCR primers used in the ddPCR assay for the recognition sequence used to ligate DMD 19-20 to DMD 37-38.

[0327] SEQ ID NO:163 shows the nucleic acid sequence of the probe used in ddPCR assays for the recognition sequence used to ligate DMD 19-20 to DMD 35-36.

[0328] SEQ ID NO:164 shows the nucleic acid sequence of the forward PCR primers used in ddPCR assays for the recognition sequence used to ligate DMD 19-20 to DMD 35-36.

[0329] SEQ ID NO:165 shows the nucleic acid sequence of the reverse PCR primers used in ddPCR assays for ligating recognition sequences from DMD 19-20 to DMD 35-36.

[0330] SEQ ID NO:166 shows the nucleic acid sequence of the probe used in ddPCR assays for the recognition sequence used to ligate DMD 19-20 to DMD 29-30.

[0331] SEQ ID NO:167 shows the nucleic acid sequence of the forward PCR primers used in ddPCR assays for ligating recognition sequences from DMD 19-20 to DMD 29-30.

[0332] SEQ ID NO:168 shows the nucleic acid sequence of the reverse PCR primers used in the ddPCR assay for the recognition sequence used to ligate DMD 19-20 to DMD 29-30.

[0333] SEQ ID NO:169 shows the nucleic acid sequence of the C5-12 promoter sequence.

[0334] SEQ ID NO:170 shows the nucleic acid sequence of the mouse MCK promoter and enhancer sequence.

[0335] SEQ ID NO:171 shows the nucleic acid sequence of the human MCK promoter sequence.

[0336] SEQ ID NO:172 shows the nucleic acid sequence of the wild-type MCK enhancer sequence.

[0337] SEQ ID NO:173 shows the nucleic acid sequence of the modified MCK enhancer sequence.

[0338] SEQ ID NO:174 shows the nucleic acid sequence of the spc 5-12 promoter sequence.

[0339] SEQ ID NO:175 shows the nucleic acid sequence of the MHCK7 promoter sequence.

[0340] SEQ ID NO:176 shows the nucleic acid sequence of the CK8 promoter sequence.

[0341] SEQ ID NO:177 shows the nucleic acid sequence of the SK-CRM4 promoter sequence.

[0342] SEQ ID NO:178 shows the nucleic acid sequence of the SP-301 promoter sequence.

[0343] SEQ ID NO:179 shows the nucleic acid sequence of the SP-817 promoter sequence.

[0344] SEQ ID NO:180 shows the nucleic acid sequence of the SP-905 promoter sequence.

[0345] SEQ ID NO:181 shows the nucleic acid sequence of the muscle hybridization promoter sequence.

[0346] SEQ ID NO:182 shows the amino acid sequence of the rh.74AAV capsid.

[0347] SEQ ID NO:183 shows the amino acid sequence of the AAV9 capsid.

[0348] SEQ ID NO:184 shows the nucleic acid sequence of the forward primer.

[0349] SEQ ID NO:185 shows the nucleic acid sequence of the reverse primer.

[0350] SEQ ID NO:186 shows the nucleic acid sequence of the probe.

[0351] SEQ ID NO:187 shows the nucleic acid sequence of the forward primer.

[0352] SEQ ID NO:188 shows the nucleic acid sequence of the reverse primer.

[0353] SEQ ID NO:189 shows the nucleic acid sequence of the probe.

[0354] SEQ ID NO:190 shows the nucleic acid sequence of the forward primer.

[0355] SEQ ID NO:191 shows the nucleic acid sequence of the reverse primer.

[0356] SEQ ID NO:192 shows the nucleic acid sequence of the probe.

[0357] SEQ ID NO:193 shows the nucleic acid sequence of the reverse primer. Detailed Implementation

[0358] 1.1 References and Definitions

[0359] The patents and scientific literature mentioned herein establish knowledge available to those skilled in the art. Granted U.S. patents, granted applications, published foreign applications, and references, including those from the GenBank database sequence, cited herein are incorporated by reference to the extent that each is specifically and individually indicated for inclusion by reference.

[0360] This invention may be embodied in various forms and should not be construed as limited to the embodiments listed herein. Rather, these embodiments are provided to make this disclosure detailed and complete and to fully convey the scope of the invention to those skilled in the art. For example, features shown with respect to one embodiment may be incorporated into other embodiments, and features shown with respect to a particular embodiment may be omitted from that embodiment. Furthermore, many variations and additions to the embodiments presented herein will be apparent to those skilled in the art without departing from the invention.

[0361] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention.

[0362] All publications, patent applications, patents and other references mentioned in this article are incorporated herein by reference in their entirety.

[0363] As used herein, “a / an” or “the” can refer to one or more. For example, “a” cell can refer to a single cell or multiple cells.

[0364] As used herein, unless otherwise specifically indicated, the word “or” is used in the inclusive sense of “and / or” rather than in the exclusive sense of “any / or”.

[0365] As used herein, the terms “nuclease” and “endonuclease” are used interchangeably to refer to naturally occurring or engineered enzymes that cleave phosphodiester bonds within a polynucleotide chain. Engineered nucleases may include, but are not limited to, engineered large-scale nucleases, zinc finger nucleases, TALENs, compact TALENs, CRISPR-system nucleases, and large-scale TALENs. Furthermore, any engineered nuclease capable of generating overhangs at its cleavage site is conceivable.

[0366] As used herein, the term “cleavage” or “cleavage” refers to the hydrolysis of phosphodiester bonds within the target sequence’s recognition sequence backbone, resulting in a double-strand break within the target sequence, referred to herein as the “cleavage site”.

[0367] As used herein, the term "vast nuclease" refers to a nuclease that binds to double-stranded DNA at a recognition sequence of more than 12 base pairs. In some embodiments, the recognition sequence for the vast nuclease used in this disclosure is 22 base pairs. A vast nuclease may be a nuclease derived from I-CreI (SEQ ID NO:1) and may refer to an engineered variant of I-CreI that has been modified relative to native I-CreI in, for example, in terms of DNA binding specificity, DNA cleavage activity, DNA binding affinity, or dimerizing properties. Methods for generating such modified I-CreI variants are known in the art (e.g., WO2007 / 047859, incorporated herein by reference in its entirety). As used herein, a vast nuclease binds to double-stranded DNA as a heterodimer. A vast nuclease may also be a "single-stranded vast nuclease" in which a pair of DNA-binding domains are linked into a single polypeptide using a peptide linker. The term "homing nuclease" is synonymous with the term "vast nuclease." When expressed in the target cells described herein, the broad range of nucleases disclosed herein are substantially nontoxic, allowing cells to be transfected and maintained at 37°C without the observation of detrimental effects on cell viability or a significant reduction in the broad range of nuclease cleavage activity (when measured using the methods described herein).

[0368] As used herein, the term "single-stranded macronuclease" refers to a polypeptide containing a pair of nuclease subunits linked by a linker. A single-stranded macronuclease has the following organization: N-terminal subunit – linker – C-terminal subunit. The two macronuclease subunits are typically different in amino acid sequence and will bind to different DNA sequences. Therefore, single-stranded macronucleases typically cleave pseudo-palindromic or non-palindromic recognition sequences. A single-stranded macronuclease may be referred to as a "single-stranded heterodimer" or "single-stranded heterodimeric macronuclease," although it is not actually a dimer. For clarity, unless otherwise stated, the term "macronuclease" may refer to either a dimer or a single-stranded macronuclease.

[0369] As used herein, the term "linker" refers to a foreign peptide sequence used to link two nuclease subunits into a single polypeptide. Linkers may have sequences found in natural proteins or may be artificial sequences not found in any natural protein. Linkers may be flexible and lack secondary structure, or may have a tendency to form specific three-dimensional structures under physiological conditions. Linkers may include, but are not limited to, those covered by U.S. Patent Nos. 8,445,251, 9,340,777, 9,434,931, and 10,041,053, each of which is incorporated herein by reference in its entirety. In some embodiments, the adapter may have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO:132, which represents residues 154-195 of any one of SEQ ID NO:36-59.

[0370] As used herein, with respect to proteins, the terms "recombinant" or "engineered" refer to proteins with altered amino acid sequences resulting from the application of genetic engineering techniques to the nucleic acids encoding the protein and the cells or organisms expressing the protein. With respect to nucleic acids, the terms "recombinant" or "engineered" refer to nucleic acid sequences with altered sequences resulting from the application of genetic engineering techniques. Genetic engineering techniques include, but are not limited to, PCR and DNA cloning; transfection, transformation, and other gene transfer techniques; homologous recombination; site-directed mutagenesis; and gene fusion. According to this definition, proteins having the same amino acid sequence as naturally occurring proteins but produced through cloning and expression in a heterologous host are not considered recombinant or engineered.

[0371] As used herein, the term "wildtype" refers to the most common naturally occurring allele (i.e., polynucleotide sequence) in a population of alleles of the same type of gene, wherein the polypeptide encoded by the wild-type allele has its original function. The term "wildtype" also refers to a polypeptide encoded by a wild-type allele. Wild-type alleles (i.e., polynucleotides) and polypeptides are distinguishable from mutant or variant alleles and polypeptides that contain one or more mutations and / or substitutions relative to the wild-type sequence. Given that wild-type alleles or polypeptides can confer a normal phenotype to an organism, in some cases, mutant or variant alleles or polypeptides can confer an altered phenotype. Wild-type nucleases are distinguishable from recombinant or non-naturally occurring nucleases. The term "wildtype" can also refer to cells, organisms, and / or subjects possessing a wild-type allele of a specific gene, or cells, organisms, and / or subjects used for comparative purposes.

[0372] As used herein, the term "genetically modified" refers to a cell or organism in which the genomic DNA sequence has been intentionally modified using recombination techniques. As used herein, the term "genetically modified" includes the term "transgenic".

[0373] As used herein, with respect to recombinant proteins, the term “modification” refers to any insertion, deletion, or substitution of amino acid residues in the recombinant sequence relative to a reference sequence (e.g., wild-type or natural sequence).

[0374] As used herein, the term "recognition sequence" or "recognition site" refers to the DNA sequence that is bound and cleaved by a nuclease. In the case of a macronuclease, the recognition sequence comprises a pair of inverted 9-base-pair "half-sites" separated by 4 base pairs. In the case of a single-stranded macronuclease, the N-terminal domain of the protein contacts the first half-site, and the C-terminal domain of the protein contacts the second half-site. Cleavage by a macronuclease produces a 3' "overhang" of four base pairs. An "overhang" or "sticky end" is a short single-stranded DNA fragment that can be produced by cleaving a double-stranded DNA sequence with an endonuclease. In the case of macronucleases derived from I-CreI and single-stranded macronucleases, the overhang contains 22 base pairs of the recognition sequence (10⁻¹³).

[0375] As used herein, the terms “target site” or “target sequence” refer to a region of cellular chromosomal DNA that contains a nuclease recognition sequence.

[0376] As used herein, the term "DNA binding affinity" or "binding affinity" refers to the tendency of a broad range of nucleases to non-covalently associate with a reference DNA molecule (e.g., a recognition sequence or any sequence). Binding affinity is measured by the dissociation constant Kd. As used herein, a nuclease has an "altered" binding affinity if the percentage change in Kd of the nuclease relative to the reference recognition sequence is statistically significant.

[0377] As used herein, the term "specificity" refers to the ability of a nuclease to recognize and cleave a double-stranded DNA molecule only at a specific base pair sequence, or only at a specific set of recognition sequences. This set of recognition sequences will share certain conserved positions or sequence motifs, but may be degenerate at one or more positions. Highly specific nucleases are capable of cleaving only one or a very small number of recognition sequences. Specificity can be determined by any method known in the art.

[0378] As used herein, the term "dystrophin gene" refers to the gene associated with National Center for Biotechnology Information (NCBI) gene ID 1756 and its naturally occurring variants. The term "dystrophin" refers to the polypeptide encoded by the dystrophin gene. The dystrophin subtype expressed in myocytes and myocyte precursor cells is called the Dp427m dystrophin variant. The amino acid sequence of the full-length wild-type Dp427m dystrophin polypeptide is shown in SEQ ID NO:4. NCBI reference numbers NM_004006.3 and NP_003997.2 show the dystrophin Dp427m mRNA and polypeptide, respectively. In some embodiments described herein, the dystrophin gene is edited with a pair of engineered wide-range nucleases, resulting in the excision of exons 45-55 of the dystrophin gene and subsequent perfect ligation. Removal of exons 45-55 from the wild-type dystrophin gene yields a dystrophin polypeptide containing the amino acid sequence shown in SEQ ID NO:5.

[0379] As used herein, the term "perfect ligation" refers to the joining (i.e., annealing) of all four bases of the 3' overhang at the first cleavage site in the dystrophin gene to all four bases of the complementary 3' overhang at the second cleavage site after cleavage by the engineered wide-range nuclease of the present invention. The disclosed engineered wide-range nuclease-targeted recognition sequences have identical four-base-pair central sequences (e.g., GTAT) such that the first and second cleavage sites will have complementary four-base-pair 3' overhangs. Thus, each base pair of the first 3' overhang pairs with its complementary base pair on the second 3' overhang, and the ligation occurs via DNA ligase. Examples of sequences resulting from such perfect ligation are shown in SEQ ID NO:32 (i.e., perfect ligation of the recognition sequences of DMD 19-20 and DMD 35-36) and SEQ ID NO:34 (i.e., perfect ligation of the recognition sequences of DMD 19-20 and DMD 37-38).

[0380] As used in this article, the term "Becker muscular dystrophy phenotype" refers to a less severe form of muscular dystrophy compared to DMD. Individuals with Becker muscular dystrophy still contain mutations in the dystrophin gene, but compared to individuals with DMD, they express more functional dystrophin in muscle cells (e.g., myoprogenitor cells, skeletal muscle cells, and cardiomyocytes), generally resulting in better clinical outcomes.

[0381] As used herein, the term “homological recombination” or “HR” refers to the natural cellular process in which a homologous DNA sequence is used as a repair template to repair double-stranded DNA breaks (see, for example, Cahill et al., (2006) Front. Biosci. 11:1958-76). The homologous DNA sequence can be an endogenous chromosomal sequence or an exogenous nucleic acid delivered to the cell.

[0382] As used herein, the term “non-homologous end joining” or “NHEJ” refers to the natural cellular process in which double-stranded DNA breaks are repaired by directly joining two non-homologous DNA fragments (see, for example, Cahill et al., (2006)). DNA repair via NHEJ is error-prone and often results in non-template additions or deletions of the DNA sequence at the repair site. In some cases, cleavage at the target recognition sequence leads to NHEJ at the target recognition site. Nuclease-induced cleavage at the target site in the gene coding sequence followed by DNA repair via NHEJ can introduce mutations that disrupt gene function into the coding sequence, such as frameshift mutations. Therefore, engineered large-scale nucleases can be used to efficiently knock out genes in cellular populations.

[0383] As used herein, the term "homologous arm" or "sequence homologous to a flanking sequence of a macronuclease cleavage site" refers to the 5' and 3' flanking sequences of a nucleic acid molecule that facilitate insertion of the nucleic acid molecule into a cleavage site generated by a macronuclease. Generally, the length of a homologous arm can be at least 50 base pairs, preferably at least 100 base pairs, and at most 2000 base pairs or more, and can have at least 90%, preferably at least 95%, or higher sequence homology with its corresponding sequence in the genome. In some embodiments, the homologous arm is about 500 base pairs.

[0384] As used in this paper regarding both amino acid sequences and nucleic acid sequences, the terms "percentage identity," "sequence identity," "percentage similarity," and "sequence similarity" refer to a measure of the similarity between two sequences based on a sequence alignment that maximizes the similarity between the aligned amino acid residues or nucleotides. This similarity varies with the number of identical or similar residues or nucleotides, the total number of residues or nucleotides, and the presence and length of gaps in the sequence alignment. Various algorithms and computer programs can be used to determine sequence similarity using standard parameters. As used herein, sequence similarity was measured using the BLASTp procedure for amino acid sequences and the BLASTn procedure for nucleic acid sequences, both of which are available from the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ) and are described, for example, in: Altschul et al., (1990) J.Mol.Biol.215:403-10; Gish & States (1993) Nature Genet.3:266-72; Madden et al., (1996) Meth.Enzymol.266:131-41; Altschul et al., (1997) Nucleic Acids Res.25:3389-3402; and Zhang et al., (2000) J.Comput.Biol.7:203-14. As used in this paper, the percentage similarity of two amino acid sequences is based on scores from the following parameters of the BLASTp algorithm: word length = 3; gap penalty = -11; gap extension penalty = -1; and score matrix = BLOSUM62. As used in this paper, the percentage similarity of two nucleic acid sequences is based on scores from the following parameters of the BLASTn algorithm: word length = 11; gap penalty = -5; gap extension penalty = -2; match reward = 1; and mismatch penalty = -3.

[0385] As used herein with respect to modifications of two proteins or amino acid sequences, the term "corresponds to" indicates that a specified modification in the first protein is a substitution of the same amino acid residue as a modification in the second protein, and that when the two proteins are subjected to standard sequence alignment (e.g., using the BLASTp procedure), the modified amino acid position in the first protein corresponds to or aligns with the modified amino acid position in the second protein. Therefore, if residues X and Y correspond to each other in sequence alignment, even though X and Y may have different numbers, residue "X" modified to amino acid "A" in the first protein will correspond to residue "Y" modified to amino acid "A" in the second protein.

[0386] As used herein, the terms “recognition half-site,” “recognition sequence half-site,” or simply “half-site” refer to a nucleic acid sequence in a double-stranded DNA molecule that is recognized and bound by a monomer of a homodimer or heterodimer macronuclease, a subunit of a single-stranded macronuclease, or a subunit of a single-stranded macronuclease.

[0387] As used herein, the term "hypervariant region" refers to a local sequence within a macronuclease monomer or subunit containing amino acids with relatively high variability. A hypervariant region may contain about 50-60 consecutive residues, about 53-57 consecutive residues, or preferably about 56 residues. In some embodiments, the residues of the hypervariant region may correspond to positions 24-79 or 215-270 of any of SEQ ID NO:36-59. The hypervariant region may contain one or more residues that contact DNA bases in the recognition sequence and may be modified to alter the base preference of the monomer or subunit. When the macronuclease binds to the double-stranded DNA recognition sequence, the hypervariant region may also contain one or more residues that bind to the DNA backbone. These residues may be modified to alter the binding affinity of the macronuclease to the DNA backbone and the target recognition sequence. In different embodiments of the invention, the hypervariant region may contain 1-20 residues exhibiting variability and may be modified to affect base preference and / or DNA binding affinity. In certain embodiments, the hypervariable region comprises approximately 15-20 residues exhibiting variability and capable of being modified to affect base preference and / or DNA binding affinity. In some embodiments, the variable residues within the hypervariable region correspond to one or more of positions 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any of SEQ ID NO:36-59. In some embodiments, the variable residues within the hypervariable region may also correspond to residues 48, 50, and 71-73 of any of SEQ ID NO:36-59. In other embodiments, the variable residues within the hypervariable region correspond to one or more of positions 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 239, 241, 259, 261, 262, 263, 264, 266, and 268 of SEQ ID NO:36-59. In some embodiments, the variable residues within the hypervariable region may also correspond to residues 239, 241, and 263-265 of any of SEQ ID NO:36-59.

[0388] In the context of dystrophin or mRNA levels, the term "increase" refers to any increase in the expression level of dystrophin or mRNA relative to a reference level or control, including increases in dystrophin or mRNA expression of at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100%, or more. In some embodiments, an increase in dystrophin or mRNA levels refers to an increase in a shortened dystrophin polypeptide or mRNA transcript compared to the wild-type dystrophin polypeptide or gene, for example, a deletion of a portion of the polypeptide encoded by at least one exon (e.g., a portion encoded by exons 45-55) or a deletion of a portion of the mRNA corresponding to exons 45-55.

[0389] As used herein, in the context of dystrophin or mRNA levels, the term “reference level” refers to the level of dystrophin or mRNA measured at a previous time point in control cells, control cell populations, or control subjects, such as control cells, control cell populations, or control subjects (e.g., baseline levels obtained from control cells, control cell populations, or subjects before administration), or a predefined threshold level of dystrophin or mRNA (e.g., a threshold level identified through previous experiments).

[0390] As used herein, “control” or “control cell” refers to a cell that provides a reference point for determining changes in the genotype or phenotype of a genetically modified cell. Control cells may include, for example: (a) wild-type cells, i.e., cells with the same genotype as the starting material used to produce the genetic alteration in the genetically modified cell; (b) cells with the same genotype as the genetically modified cell but transformed with a null construct (i.e., a construct with no known effect on the target trait); or (c) cells that are genetically identical to the genetically modified cell but not exposed to conditions or stimuli that would induce the expression of the altered genotype or phenotype, or further genetic modifications. Control subjects may include, for example: wild-type subjects, i.e., subjects with the same genotype as the initial subject that caused the genetic alteration in the genetically modified subject (e.g., subjects with the same mutation in the dystrophin gene), who have not been exposed to conditions or stimuli that would induce the expression of the altered genotype or phenotype in the subject, or further genetic modifications.

[0391] As used herein, the terms “recombinant DNA construct,” “recombinant construct,” “expression cassette,” “cassette,” “expression construct,” “chimeric construct,” “construct,” and “recombinant DNA fragment” are used interchangeably and refer to single-stranded or double-stranded polynucleotides. A recombinant construct comprises an artificial combination of nucleic acid fragments, including but not limited to regulatory and coding sequences not found together in nature. For example, a recombinant DNA construct may contain regulatory and coding sequences derived from different sources, or from the same source but arranged in a manner different from that found naturally. Such constructs may be used alone or in combination with a vector.

[0392] As used herein, "vector" or "recombinant DNA vector" can be a construct comprising a replication system and a sequence capable of transcribing and translating a polypeptide-coding sequence in a given host cell. If a vector is used, the choice of vector depends on methods well known to those skilled in the art for transforming host cells. Vectors may include, but are not limited to, plasmid vectors and recombinant AAV vectors, or any other vector known in the art suitable for delivering genes to target cells. Genetic elements that must be present on the vector are well known to those skilled in the art for successful transformation, selection, and amplification of host cells containing any isolated nucleotide or nucleic acid sequence of the present invention. In some embodiments, "vector" also refers to a viral vector. Viral vectors may include, but are not limited to, retroviral vectors, lentiviral vectors, adenoviral vectors, and AAV.

[0393] As used herein, the term "operably linked" is intended to refer to a functional connection between two or more elements. For example, an operably linked nucleic acid sequence encoding the nuclease described herein and a regulatory sequence (e.g., a promoter) is a functional connection that allows the expression of the nucleic acid sequence encoding the nuclease. Operatically linked elements can be contiguous or non-contiguous. When used to refer to the connection of two protein-coding regions, an operably linked term means that the coding regions are in the same reading frame.

[0394] As used herein, the term "treatment" or "treated subject" refers to the administration of the engineered large-scale nuclease described herein, or a polynucleotide encoding the engineered large-scale nuclease described herein, or a pair of such engineered large-scale nucleases or polynucleotides, to a subject suffering from DMD to increase the level of dystrophin in the subject. In some embodiments, the expression of a shortened form of dystrophin (e.g., lacking amino acids encoded by multiple exons) is increased. In some embodiments, the expression of a form of dystrophin lacking amino acids encoded by exons 45-55 is increased. In some embodiments, this treatment converts the DMD phenotype to the Becker muscular dystrophy phenotype.

[0395] As used herein, the term “gc / kg” or “gene copies / kilogram” refers to the number of copies of the nucleic acid encoding the engineered macronuclease described herein per kilogram of body weight of a subject to which the nucleic acid encoding the engineered macronuclease described herein is administered.

[0396] As used herein, the term "effective amount" or "therapeutic effective amount" refers to an amount sufficient to achieve beneficial or desired biological and / or clinical outcomes. Therapeutic effective amounts will vary depending on the formulation or composition used, the disease and its severity, and the age, weight, physical condition, and responsiveness of the subject being treated. In certain embodiments, an effective amount of the engineered macronuclease or a pair of engineered macronucleotidases described herein, or the polynucleotide or a pair of polynucleotides encoding therethe, or the pharmaceutical composition disclosed herein, increases the expression level of dystrophin (e.g., a shortened dystrophin lacking the amino acids encoded by exons 45-55) and improves at least one symptom associated with DMD.

[0397] As used herein, the term "lipid nanoparticles" refers to lipid compositions that typically have a spherical structure with an average diameter of 10-1000 nanometers. In some formulations, lipid nanoparticles may comprise at least one cationic lipid, at least one non-cationic lipid, and at least one conjugated lipid. Lipid nanoparticles known in the art suitable for encapsulating nucleic acids (such as mRNA) are intended for use in this invention.

[0398] As used herein, the description of the numerical range of a variable is intended to convey that this disclosure can be practiced with a variable equal to any value within that range. Thus, for an inherently discrete variable, the variable can be equal to any integer value within that numerical range, including the endpoints of the range. Similarly, for an inherently continuous variable, the variable can be equal to any real value within that numerical range, including the endpoints of the range. By way of example and not limitation, if a variable is inherently discrete, a variable described as having values ​​between 0 and 2 can take the values ​​0, 1, or 2, and if a variable is inherently continuous, it can take the values ​​0.0, 0.1, 0.01, 0.001, or any other real value ≥ 0 and ≤ 2.

[0399] 2.1 Principles of the Invention

[0400] This disclosure is partly based on the assumption that certain deletions in the dystrophin gene that cause the DMD phenotype can be compensated for by using endonucleases to strategically delete exons of the dystrophin gene, restoring normal reading frames within the gene. The DMD-Leiden database shows that most mutations leading to DMD are deletions of one or more intact exons, resulting in reading frame shifts. In many cases, reading frames can be restored by eliminating the exon immediately before or after the mutation. As shown in Table 3, 29 different mutations causing Duchenne muscular dystrophy, accounting for approximately 65% ​​of patients, can be compensated for by deleting a single exon near the mutation.

[0401] Table 3:

[0402]

[0403] For example, patients with disease due to the deletion of exon 45 (occurring in approximately 7% of patients) can be treated with a therapeutic agent that deletes exon 46. Therapeutic agents that delete exon 51 or exon 45 can be used to treat 15% and 13% of patients, respectively.

[0404] It is noteworthy that over 50% of DMD-related mutations within the dystrophin gene are contained in exons 45 to 55. Therefore, in a particular embodiment of the invention, exons 45 to 55 of the dystrophin gene are removed to restore the normal reading frame of the gene. As disclosed herein, exon removal is achieved by expressing a pair of engineered large-scale nucleases in muscle cells or muscle precursor cells (e.g., cardiomyocytes or skeletal muscle cells) that produce a pair of cleavage sites in introns upstream of exon 45 and downstream of exon 55, thereby allowing the excision of genomic regions during the process. Following this approach, genetically modified cells (e.g., muscle cells in a treated subject) will be able to produce a quantity of shortened dystrophin from a Beckerian phenotype, similar to the microdystrophin approach, without necessarily expressing the microdystrophin transgene. This shortened dystrophin may be sufficient to permanently salvage the disease, unlike other therapies that require multiple consecutive treatment regimens.

[0405] Therefore, it is conceivable that a single treatment would permanently delete exons from a certain proportion of the subject's cells. In some implementations, these cells would be myoblasts (i.e., myocytes) or other myoprogenitor cells capable of replicating and producing whole-flesh myofibrils expressing functional (or semi-functional) dystrophin. However, if the frequency of exon deletion is low, multiple treatments may be necessary for each patient.

[0406] 2.2 A wide range of nucleases that bind to and cleave the recognition sequence within the dystrophin gene. Identification Sequence

[0407] It is known in the art that site-specific nucleases can be used to induce DNA breaks in the genome of living cells, and these DNA breaks can be repaired by mutagenic NHEJ or lead to permanent modifications of the genome through homologous recombination with transgenic DNA sequences. NHEJ can produce mutations at the cleavage site, resulting in allele inactivation. NHEJ-related mutations may inactivate alleles through mechanisms such as generating early stop codons, frameshift mutations that produce aberrant nonfunctional proteins, or potentially triggering meaningless-mediated mRNA decay. Using nucleases to induce mutations via NHEJ can be used to target specific mutations or sequences present in wild-type alleles. Furthermore, it is known that inducing double-strand breaks at target loci using nucleases stimulates homologous recombination, particularly homologous recombination of transgenic DNA sequences flanked by sequences homologous to the genomic target. In this way, exogenous polynucleotides can be inserted into target loci. Such exogenous polynucleotides can encode any sequence or polypeptide of interest.

[0408] In certain embodiments, the engineered wide-range nucleases of the present invention may be designed to bind and cleave the DMD19-20 recognition sequence (SEQ ID NO:6), the DMD35-36 recognition sequence (SEQ ID NO:10), or the DMD37-38 recognition sequence (SEQ ID NO:12). Exemplary wide-range nucleases binding and cleaving the DMD19-20 recognition sequence are provided in SEQ ID NO:36-44. Exemplary wide-range nucleases binding and cleaving the DMD35-36 recognition sequence are provided in SEQ ID NO:45-52. Exemplary wide-range nucleases binding and cleaving the DMD37-38 recognition sequence are provided in SEQ ID NO:53-59. The sequence of each recognition sequence, along with the four base pairs of 3' overhangs generated when cleaved by the engineered wide-range nucleases described herein, are provided in Table 4 below.

[0409] Table 4: Engineered Wide-Range Nuclease Recognition Sequences

[0410] Identification Sequence SEQ ID NO: 4bp 3' protruding end AAGGATTATGTATTACCTCCCG 6 GTAT TAAGATTGGGTATGAGGGATAG 8 GTAT CTACATGGTGTATCTGACTAAG 10 GTAT CTGGCCGAAGTATAGGAATATG 12 GTAT

[0411] To modify the dystrophin gene according to this disclosure, a pair of engineered large-scale nucleases described herein were used together in the same cell. This engineered large-scale nuclease pair was designed to generate a first cleavage site in an intron upstream of exon 45 and a second cleavage site in an intron downstream of exon 55, such that genomic sequences were removed during the process. Surprisingly, it was observed that the genomic region could be efficiently excised from the dystrophin gene, which is larger than 500,000 bp. Furthermore, large-scale nuclease recognition sequences with complementary four-base-pair 3' overhangs after cleavage were selected, and it was observed that the dystrophin gene could be repaired at high frequency through perfect ligation of the 3' overhangs at the two cleavage sites. Such perfect ligation recognition sequences described herein are provided in Table 5 below.

[0412] Table 5: Identification Sequences of Connections

[0413]

[0414] These recognition sequences were further selected from intron sequences that were normally spliced ​​during post-transcriptional modification of cells. This reduced the likelihood of mutations introducing dystrophin genes and their encoded peptides.

[0415] Exemplary engineered large-scale nucleases

[0416] The engineered wide-range nuclease of the present invention comprises a first subunit containing an HVR1 region and a second subunit containing an HVR2 region. Furthermore, the first subunit binds to a first recognition half-site (e.g., the DMD19 half-site) in the recognition sequence, and the second subunit binds to a second recognition half-site (e.g., the DMD20 half-site) in the recognition sequence.

[0417] In a particular embodiment, the broad-spectrum nuclease used to carry out the invention is a single-stranded broad-spectrum nuclease. The single-stranded broad-spectrum nuclease comprises an N-terminal subunit and a C-terminal subunit (i.e., the first and second subunits discussed above) linked by a linker peptide. Each of the two subunits recognizes and binds to a half-site of the recognition sequence, and the DNA cleavage site is located in the middle of the recognition sequence, near the interface between the two subunits. As discussed, DNA strand breaks are offset by four base pairs, such that the DNA is cleaved by the broad-spectrum nuclease to produce four 3' single-stranded overhang pairs.

[0418] In embodiments where the engineered large-scale nuclease is a single-stranded large-scale nuclease, the first and second subunits can be oriented such that the first subunit containing the HVR1 region and binding to the first half-site is positioned as an N-terminal subunit, and the second subunit containing the HVR2 region and binding to the second half-site is positioned as a C-terminal subunit. In alternative embodiments, the first and second subunits can be oriented such that the first subunit containing the HVR1 region and binding to the first half-site is positioned as a C-terminal subunit, and the second subunit containing the HVR2 region and binding to the second half-site is positioned as an N-terminal subunit.

[0419] Exemplary DMD-based nucleases of the present invention are provided in SEQ ID NO:36-59 and are summarized in Tables 6-8.

[0420] Table 6: Exemplary engineered wide-ranging nucleases that bind to and cleave the DMD 19-20 recognition sequence (SEQ ID NO:6)

[0421]

[0422] "DMD19 subunit %" and "DMD20 subunit %" represent the amino acid sequence identity between the DMD19-binding and DMD20-binding subunit regions of each macronuclease and the DMD19-binding and DMD22-binding subunit regions of the DMD19-20x.13 macronuclease, respectively.

[0423] Table 7: Exemplary engineered wide-range nucleases that bind to and cleave the DMD 35-36 recognition sequence (SEQ ID NO:10)

[0424]

[0425] "DMD35 subunit %" and "DMD36 subunit %" represent the amino acid sequence identity between the DMD35-binding and DMD36-binding subunit regions of each macronuclease and the DMD35-36x.63 macronuclease's DMD35-binding and DMD36-binding subunit regions, respectively.

[0426] Table 8: Exemplary engineered wide-ranging nucleases that bind to and cleave the DMD 37-38 recognition sequence (SEQ ID NO:12)

[0427]

[0428] "DMD37 subunit %" and "DMD38 subunit %" represent the amino acid sequence identity between the DMD37-binding and DMD38-binding subunit regions of each macronuclease and the DMD37-38x.15 macronuclease's DMD37-binding and DMD38-binding subunit regions, respectively.

[0429] In some embodiments of the present invention, an engineered large-scale nuclease binds to and cleaves the recognition sequence containing SEQ ID NO:6 (i.e., the DMD 19-20 recognition sequence) within the dystrophin gene, wherein the engineered large-scale nuclease comprises a first subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises an HVR1 region, and wherein the second subunit binds to a second recognition half-site of the recognition sequence and comprises an HVR2 region. An exemplary DMD 19-20 large-scale nuclease is shown below.

[0430] DMD 19-20x.13 (SEQ ID NO:36)

[0431] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:36. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:36. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:36. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:36. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:36 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:36.

[0432] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:36. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:36. In some embodiments, the first subunit comprises residue 19 corresponding to residue 19 of SEQ ID NO:36. In some embodiments, the first subunit contains E, Q, or K at the residue 80 of SEQ ID NO:36. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:36 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:36.

[0433] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:36. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:36. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:36. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:36. In some embodiments, the HVR2 region comprises residue 241 corresponding to SEQ ID NO:36. In some embodiments, the HVR2 region comprises residue 263 corresponding to SEQ ID NO:36. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:36. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:36 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some implementations, the HVR2 region contains residues 215-270 of SEQ ID NO:36.

[0434] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:36. In some embodiments, the second subunit contains G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:36. In some embodiments, the second subunit contains E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:36. In some embodiments, the second subunit comprises residue 271 corresponding to residue 271 of SEQ ID NO:36. In some embodiments, the second subunit comprises residue 220 corresponding to residue 220 of SEQ ID NO:36. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:36 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:36.

[0435] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:36. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:36. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:50. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:50.

[0436] DMD 19-20x.87 (SEQ ID NO:37)

[0437] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:37. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:37. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:37. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:37. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:37 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:37.

[0438] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:37. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:37. In some embodiments, the first subunit comprises residue 19 corresponding to residue 19 of SEQ ID NO:37. In some embodiments, the first subunit contains E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:37. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:37 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:37.

[0439] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:37. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:37. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:37. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:37. In some embodiments, the HVR2 region comprises residue 239 corresponding to SEQ ID NO:37. In some embodiments, the HVR2 region comprises residue 241 corresponding to SEQ ID NO:37. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:37. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:37 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some implementations, the HVR2 region contains residues 215-270 of SEQ ID NO:37.

[0440] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:37. In some embodiments, the second subunit comprises G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:37. In some embodiments, the second subunit comprises E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:37. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:37. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:37 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:37.

[0441] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:37. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:37. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:51. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:51.

[0442] DMD 19-20L.249 (SEQ ID NO:38)

[0443] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:38. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:38. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:38. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:38. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:38 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:38.

[0444] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:38. In some embodiments, the first subunit contains G, S, or A at residue 19 of SEQ ID NO:38. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:38. In some embodiments, the first subunit contains E, Q, or K at residue 80 of SEQ ID NO:38. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:38. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:38 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:38.

[0445] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:38. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO:38. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:38. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:38. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:38. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:38 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:38.

[0446] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:38. In some embodiments, the second subunit comprises G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:38. In some embodiments, the second subunit comprises E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:38. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:38. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:38 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:38.

[0447] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:38. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:38. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:52. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:52.

[0448] DMD 19-20L.302 (SEQ ID NO:39)

[0449] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:39. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:39. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:39. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:39. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:39 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:39.

[0450] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:39. In some embodiments, the first subunit contains G, S, or A at a residue corresponding to residue 19 of SEQ ID NO:39. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:39. In some embodiments, the first subunit contains E, Q, or K at a residue corresponding to residue 39 of SEQ ID NO:39. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:39. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:39 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:39.

[0451] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:39. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:39. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:39. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:39. In some embodiments, the HVR2 region comprises residue 236 corresponding to SEQ ID NO:39. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:39. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:39 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:39.

[0452] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:39. In some embodiments, the residue at residue 210 of the second subunit corresponding to SEQ ID NO:39 comprises G, S, or A. In some embodiments, the second subunit comprises E, Q, or K at residue 271 of SEQ ID NO:39. In some embodiments, the second subunit comprises residue 271 of SEQ ID NO:39. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:39 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:39.

[0453] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:39. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:39. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:53. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:53.

[0454] DMD 19-20L.329 (SEQ ID NO:40)

[0455] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:40. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:40. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:40. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:40. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:40 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:40.

[0456] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:40. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:40. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:40. In some embodiments, the first subunit contains E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:40. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:40 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:40.

[0457] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid residues corresponding to residues 215-270 of SEQ ID NO:40. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:40. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:40. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:40. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:40. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:40 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:40.

[0458] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:40. In some embodiments, the second subunit contains G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:40. In some embodiments, the second subunit contains E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:40. In some embodiments, the second subunit comprises residue 271 of SEQ ID NO:40. In some embodiments, the second subunit comprises residue 330 of SEQ ID NO:40. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:40 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:40.

[0459] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:40. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:40. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:54. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:54.

[0460] DMD 19-20L.374 (SEQ ID NO:41)

[0461] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:41. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:41. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:41. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:40. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:41 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:41.

[0462] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:41. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:41. In some embodiments, the first subunit comprises residue 19 corresponding to residue 19 of SEQ ID NO:41. In some embodiments, the first subunit contains E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:41. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:41 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:41.

[0463] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:41. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:41. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:41. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:41. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:41. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:41 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:41.

[0464] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:41. In some embodiments, the second subunit comprises G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:41. In some embodiments, the second subunit comprises E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:41. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:41. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:41 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:41.

[0465] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:41. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:41. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:65. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:65. DMD 19-20L.375 (SEQ ID NO:42)

[0466] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:42. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:42. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:42. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 of SEQ ID NO:42. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:42 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:42.

[0467] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:42. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:42. In some embodiments, the first subunit comprises residue 19 corresponding to residue 19 of SEQ ID NO:42. In some embodiments, the first subunit contains E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:42. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:42 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:42.

[0468] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:42. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:42. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:42. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:42. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:42. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:42 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:42.

[0469] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:42. In some embodiments, the second subunit comprises G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:42. In some embodiments, the second subunit comprises E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:42. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:42. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:42 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:42.

[0470] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:42. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:42. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:66. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:66.

[0471] DMD 19-20L.431 (SEQ ID NO:43)

[0472] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:43. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75 and 77 of SEQ ID NO:43. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75 and 77 of SEQ ID NO:43. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:43. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:43 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:43.

[0473] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:43. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:43. In some embodiments, the first subunit comprises residue 19 corresponding to residue 19 of SEQ ID NO:43. In some embodiments, the first subunit contains E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:43. In some embodiments, the first subunit comprises residue 80 corresponding to residue 80 of SEQ ID NO:43. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:43 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:43.

[0474] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:43. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:43. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:43. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:43. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:43. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:43 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:43.

[0475] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:43. In some embodiments, the second subunit contains G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:43. In some embodiments, the second subunit contains E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:43. In some embodiments, the second subunit comprises residue 271 corresponding to residue 271 of SEQ ID NO:43. In some embodiments, the second subunit comprises residue 330 corresponding to residue 330 of SEQ ID NO:43. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:43 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:43.

[0476] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:43. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:43. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:67. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:67.

[0477] DMD 19-20L.458 (SEQ ID NO:44)

[0478] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:44. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:44. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:44. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:44. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:44 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:44.

[0479] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:44. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:44. In some embodiments, the first subunit comprises residue 19 corresponding to residue 19 of SEQ ID NO:44. In some embodiments, the first subunit contains E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:44. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:44 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:44.

[0480] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:44. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:44. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:44. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:44. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:44. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:44 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:44.

[0481] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:44. In some embodiments, the second subunit contains G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:44. In some embodiments, the second subunit contains E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:44. In some embodiments, the second subunit comprises residue 271 corresponding to residue 271 of SEQ ID NO:44. In some embodiments, the second subunit comprises residue 220 corresponding to residue 220 of SEQ ID NO:44. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:44 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:44.

[0482] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:44. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:44. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:68. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:68.

[0483] In some embodiments of the present invention, an engineered large-scale nuclease binds to and cleaves the recognition sequence (i.e., the DMD 35-36 recognition sequence) within the dystrophin gene, wherein the engineered large-scale nuclease comprises a first subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and wherein the second subunit aggregates to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region. An exemplary DMD 35-36 large-scale nuclease is shown below.

[0484] DMD 35-36x.63 (SEQ ID NO:45)

[0485] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:45. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:45. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:45. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:45. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:45 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:45.

[0486] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:45. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:45. In some embodiments, the first subunit comprises residue 19 corresponding to residue 19 of SEQ ID NO:45. In some embodiments, the first subunit contains E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:45. In some embodiments, the first subunit comprises residue 80 corresponding to residue 80 of SEQ ID NO:45. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:45 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:45.

[0487] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:45. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:45. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:45. In some embodiments, the HVR2 region comprises Y, R, K, or D at the residue corresponding to residue 257 of SEQ ID NO:45. In some embodiments, the HVR2 region comprises residue 239 corresponding to residue 239 of SEQ ID NO:45. In some embodiments, the HVR2 region comprises residue 241 corresponding to residue 241 of SEQ ID NO:45. In some embodiments, the HVR2 region comprises residue 250 corresponding to residue 250 of SEQ ID NO:45. In some embodiments, the HVR2 region comprises residue 263 corresponding to residue 263 of SEQ ID NO:45. In some embodiments, the HVR2 region comprises residue 264 corresponding to residue 264 of SEQ ID NO:45. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:45 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:45. In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:45. In some embodiments, the second subunit comprises G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:45. In some embodiments, the second subunit comprises E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:45. In some embodiments, the second subunit comprises residues corresponding to residue 330 of SEQ ID NO:45.In some embodiments, the second subunit comprises residues 98-344 of SEQ ID NO:45 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:45.

[0488] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:45. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:45. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:69. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:69.

[0489] DMD 35-36x.81 (SEQ ID NO:46)

[0490] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence of residues 24-79 of SEQ ID NO:46. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:46. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:46. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 of SEQ ID NO:46. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:46 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:46.

[0491] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153a of SEQ ID NO:46. In some embodiments, the first subunit contains G, S, or A at a residue corresponding to residue 19 of SEQ ID NO:46. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:46. In some embodiments, the first subunit contains E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO:46. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:46. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:46 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:46.

[0492] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:46. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:46. In some embodiments, the HVR2 region includes residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:46. In some embodiments, the HVR2 region includes Y, R, K, or D at the residue corresponding to residue 257 of SEQ ID NO:46. In some embodiments, the HVR2 region includes residue 239 corresponding to residue 239 of SEQ ID NO:46. In some embodiments, the HVR2 region includes residue 241 corresponding to residue 241 of SEQ ID NO:46. In some embodiments, the HVR2 region includes residue 263 corresponding to residue 263 of SEQ ID NO:46. In some embodiments, the HVR2 region includes residue 264 corresponding to residue 264 of SEQ ID NO:46. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:46 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions.

[0493] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:46. In some embodiments, the second subunit comprises G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:46. In some embodiments, the second subunit comprises E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:46. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:46. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:46 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:46.

[0494] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:46. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:46. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:70. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:70.

[0495] DMD 35-36L.195 (SEQ ID NO:47)

[0496] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:47. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:47. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:47. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:47. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:47 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:47.

[0497] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:47. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:47. In some embodiments, the first subunit comprises residue 19 corresponding to residue 19 of SEQ ID NO:47. In some embodiments, the first subunit contains E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:47. In some embodiments, the first subunit comprises residue 80 corresponding to residue 80 of SEQ ID NO:47. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:47 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:47.

[0498] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:47. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:47. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:47. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:47. In some embodiments, the HVR2 region comprises residue 239 corresponding to SEQ ID NO:47. In some embodiments, the HVR2 region comprises residue 241 corresponding to SEQ ID NO:47. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:47. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:47 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some implementations, the HVR2 region contains residues 215-270 of SEQ ID NO:47.

[0499] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:47. In some embodiments, the second subunit comprises G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:47. In some embodiments, the second subunit comprises E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:47. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:47. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:47 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:47.

[0500] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:47. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:47. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:71. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:71.

[0501] DMD 35-36L.282 (SEQ ID NO:48)

[0502] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:48. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:48. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:48. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:48. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:48 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:48.

[0503] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:48. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:48. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:48. In some embodiments, the first subunit contains E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:48. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:48. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:48 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:48.

[0504] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:48. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:48. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:48. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:48. In some embodiments, the HVR2 region comprises residue 239 corresponding to SEQ ID NO:48. In some embodiments, the HVR2 region comprises residue 241 corresponding to SEQ ID NO:48. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:48. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:48 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some implementations, the HVR2 region contains residues 215-270 of SEQ ID NO:48.

[0505] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:48. In some embodiments, the second subunit comprises G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:48. In some embodiments, the second subunit comprises E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:48. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:48. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:48 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:48.

[0506] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:48. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:48. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:72. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:72. DMD 35-36L.349 (SEQ ID NO:49)

[0507] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:49. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:49. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:49. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:49. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:49 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:49.

[0508] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:49. In some embodiments, the first subunit contains G, S, or A at a residue corresponding to residue 19 of SEQ ID NO:49. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:49. In some embodiments, the first subunit contains E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO:49. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:49. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:49 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:49.

[0509] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:49. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:49. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:49. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:49. In some embodiments, the HVR2 region comprises residue 239 corresponding to SEQ ID NO:49. In some embodiments, the HVR2 region comprises residue 241 corresponding to SEQ ID NO:49. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:49. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:49 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some implementations, the HVR2 region contains residues 215-270 of SEQ ID NO:49.

[0510] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:49. In some embodiments, the second subunit comprises G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:49. In some embodiments, the second subunit comprises E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:49. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:49. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:49 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:49.

[0511] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:49. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:49. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:73. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:73.

[0512] DMD 35-36L.376 (SEQ ID NO:50)

[0513] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:50. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:50. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:50. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:50. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:50 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:50.

[0514] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO: 50. In some embodiments, the first subunit contains G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 50. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 50. In some embodiments, the first subunit contains E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 50. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 50. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:50 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:50.

[0515] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:50. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:50. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:50. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:50. In some embodiments, the HVR2 region comprises residue 239 corresponding to SEQ ID NO:50. In some embodiments, the HVR2 region comprises residue 241 corresponding to SEQ ID NO:50. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:50. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:50 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some implementations, the HVR2 region contains residues 215-270 of SEQ ID NO:50.

[0516] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:50. In some embodiments, the second subunit comprises G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:50. In some embodiments, the second subunit comprises E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:50. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:50. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:50 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:50.

[0517] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:50. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:50. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:74. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:74.

[0518] DMD 35-36L.457 (SEQ ID NO:51)

[0519] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:51. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:51. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:51. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:51. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:51 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:51.

[0520] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:51. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:51. In some embodiments, the first subunit comprises residue 19 corresponding to residue 19 of SEQ ID NO:51. In some embodiments, the first subunit contains E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:51. In some embodiments, the first subunit comprises residue 80 corresponding to residue 80 of SEQ ID NO:51. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:51 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:51.

[0521] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:51. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:51. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO: 51. In some embodiments, the HVR2 region comprises Y, R, K, or D at the residue corresponding to residue 257 of SEQ ID NO: 51. In some embodiments, the HVR2 region comprises residue 239 corresponding to residue 239 of SEQ ID NO: 51. In some embodiments, the HVR2 region comprises residue 241 corresponding to residue 241 of SEQ ID NO: 51. In some embodiments, the HVR2 region comprises residue 264 corresponding to residue 264 of SEQ ID NO: 51. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 51 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some implementations, the HVR2 region contains residues 215-270 of SEQ ID NO:51.

[0522] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:51. In some embodiments, the second subunit comprises G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:51. In some embodiments, the second subunit comprises E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:51. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:51. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:51 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:51.

[0523] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:51. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:51. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:75. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:75.

[0524] DMD 35-36L.469 (SEQ ID NO:52)

[0525] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:52. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:52. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:52. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:52. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:52 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:52.

[0526] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:52. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:52. In some embodiments, the first subunit comprises residue 19 corresponding to residue 19 of SEQ ID NO:52. In some embodiments, the first subunit contains E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:52. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:52 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:52.

[0527] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:52. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:52. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:52. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:52. In some embodiments, the HVR2 region comprises residue 239 corresponding to SEQ ID NO:52. In some embodiments, the HVR2 region comprises residue 241 corresponding to SEQ ID NO:52. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:52. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:52 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some implementations, the HVR2 region contains residues 215-270 of SEQ ID NO:52.

[0528] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:52. In some embodiments, the second subunit contains G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:52. In some embodiments, the second subunit contains E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:52. In some embodiments, the second subunit comprises residue 271 corresponding to residue 271 of SEQ ID NO:52. In some embodiments, the second subunit comprises residue 330 corresponding to residue 330 of SEQ ID NO:52. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:52 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:52.

[0529] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:52. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:52. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:76. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:76.

[0530] In some embodiments of the present invention, an engineered large-scale nuclease binds to and cleaves the recognition sequence containing SEQ ID NO:12 (i.e., the DMD 37-38 recognition sequence) within the dystrophin gene, wherein the engineered large-scale nuclease comprises a first subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and wherein the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region. An exemplary DMD 37-38 large-scale nuclease is shown below.

[0531] DMD 37-38x.15 (SEQ ID NO:53)

[0532] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:53. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:53. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:53. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:53. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:53 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:53.

[0533] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:53. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:53. In some embodiments, the first subunit comprises residue 19 corresponding to residue 19 of SEQ ID NO:53. In some embodiments, the first subunit contains E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:53. In some embodiments, the first subunit comprises residue 80 corresponding to residue 80 of SEQ ID NO:53. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:53 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:53.

[0534] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:53. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:53. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:53. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:53. In some embodiments, the HVR2 region comprises residue 239 corresponding to SEQ ID NO:53. In some embodiments, the HVR2 region comprises residue 241 corresponding to SEQ ID NO:53. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:53. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:53 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some implementations, the HVR2 region contains residues 215-270 of SEQ ID NO:53.

[0535] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:53. In some embodiments, the second subunit contains G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:53. In some embodiments, the second subunit contains E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:53. In some embodiments, the second subunit comprises residue 271 corresponding to residue 271 of SEQ ID NO:53. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:53 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:53.

[0536] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds to the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:53. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:53. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:77. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:77.

[0537] DMD 37-38x.66 (SEQ ID NO:54)

[0538] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:54. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:54. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:54. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:54. In some embodiments, the HVR1 region contains residue 66 corresponding to SEQ ID NO:54. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:54 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:54.

[0539] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:54. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:54. In some embodiments, the first subunit comprises residue 19 corresponding to residue 19 of SEQ ID NO:54. In some embodiments, the first subunit contains E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:54. In some embodiments, the first subunit comprises residue 80 corresponding to residue 80 of SEQ ID NO:54. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:54 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:54.

[0540] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:54. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:54. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:54. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:54. In some embodiments, the HVR2 region comprises residue 241 corresponding to SEQ ID NO:54. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:54. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:54 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:54.

[0541] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:54. In some embodiments, the second subunit comprises G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:54. In some embodiments, the second subunit comprises E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:54. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:54. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:54 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:54.

[0542] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:54. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:54. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:78. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:78.

[0543] DMD 37-38x.79 (SEQ ID NO:55)

[0544] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:55. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:55. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:55. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:55. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:55 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:55.

[0545] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:55. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:55. In some embodiments, the first subunit comprises residue 19 corresponding to residue 19 of SEQ ID NO:55. In some embodiments, the first subunit contains E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:55. In some embodiments, the first subunit comprises residue 80 corresponding to residue 80 of SEQ ID NO:55. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:55 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:55.

[0546] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:55. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:55. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO: 55. In some embodiments, the HVR2 region comprises Y, R, K, or D at the residue corresponding to residue 257 of SEQ ID NO: 55. In some embodiments, the HVR2 region comprises residue 239 corresponding to residue 239 of SEQ ID NO: 55. In some embodiments, the HVR2 region comprises residue 241 corresponding to residue 241 of SEQ ID NO: 55. In some embodiments, the HVR2 region comprises residue 255 corresponding to residue 255 of SEQ ID NO: 55. In some embodiments, the HVR2 region comprises residue 264 corresponding to residue 264 of SEQ ID NO: 55. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:55 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions.

[0547] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:55. In some embodiments, the second subunit contains G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:55. In some embodiments, the second subunit contains E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:55. In some embodiments, the second subunit comprises residue 271 corresponding to residue 271 of SEQ ID NO:55. In some embodiments, the second subunit comprises residue 330 corresponding to residue 330 of SEQ ID NO:55. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:55 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:55.

[0548] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:55. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:55. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:79. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:79.

[0549] DMD 37-38L.166 (SEQ ID NO:56)

[0550] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO:56. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:56. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:56. In some embodiments, the HVR1 region contains Y, R, K, or D at residue 66 corresponding to SEQ ID NO:56. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:56 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region contains residues 24-79 of SEQ ID NO:56.

[0551] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:56. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:56. In some embodiments, the first subunit comprises residue 19 corresponding to residue 19 of SEQ ID NO:56. In some embodiments, the first subunit contains E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:56. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:56 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:56.

[0552] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:56. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:56. In some embodiments, the HVR2 region comprises residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 corresponding to SEQ ID NO:56. In some embodiments, the HVR2 region comprises Y, R, K, or D at residue 257 corresponding to SEQ ID NO:56. In some embodiments, the HVR2 region comprises residue 263 corresponding to SEQ ID NO:56. In some embodiments, the HVR2 region comprises residue 264 corresponding to SEQ ID NO:56. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:56 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:56.

[0553] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 198-344 of SEQ ID NO:56. In some embodiments, the second subunit comprises G, S, or A at the residue corresponding to residue 210 of SEQ ID NO:56. In some embodiments, the second subunit comprises E, Q, or K at the residue corresponding to residue 271 of SEQ ID NO:56. In some embodiments, the second subunit comprises residue 271 corresponding to residue 271 of SEQ ID NO:56. In some embodiments, the second subunit comprises residue 330 corresponding to residue 330 of SEQ ID NO:56. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:56 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:56.

[0554] In some embodiments, the engineered large-scale nuclease is a single-stranded large-scale nuclease comprising a linker, wherein the linker covalently binds the first subunit and the second subunit. In some embodiments, the engineered large-scale nuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with SEQ ID NO:56. In some embodiments, the engineered large-scale nuclease comprises the amino acid sequence of SEQ ID NO:56. In some embodiments, the engineered large-scale nuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with the nucleic acid sequence shown in SEQ ID NO:80. In some embodiments, the engineered large-scale nuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:80.

[0555] DMD 37-38L.478 (SEQ ID NO:57)

[0556] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 24-79 of SEQ ID NO:57. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:57. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO:57. In some embodiments, the HVR1 region contains Y, R, K, or D at the residue corresponding to residue 66 of SEQ ID NO:57. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:57 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions.

[0557] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with residues 7-153 of SEQ ID NO:57. In some embodiments, the first subunit contains G, S, or A at the residue corresponding to residue 19 of SEQ ID NO:57. In some embodiments, the first subunit comprises residue 19 corresponding to residue 19 of SEQ ID NO:57. In some embodiments, the first subunit contains E, Q, or K at the residue corresponding to residue 80 of SEQ ID NO:57. In some embodiments, the first subunit comprises residue 80 corresponding to residue 80 of SEQ ID NO:57. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:57 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:57.

[0558] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO:57. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266 and 268 of SEQ ID NO:57. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO:57. In some embodiments, the HVR2 region comprises Y, R, K, or D at the residue corresponding to residue 257 of SEQ ID NO:57. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO:57. In some embodiments, the HVR2 region compris...

Claims

1. A polynucleotide comprising a nucleic acid sequence encoding an engineered macronuclease, said engineered macronuclease binding to and cleaving nucleic acid at a site in the dystrophin gene comprising a recognition sequence consisting of the nucleic acid sequence of SEQ ID NO: 6, wherein said engineered macronuclease comprises the amino acid sequence of SEQ ID NO:

43.

2. The polynucleotide of claim 1, wherein the polynucleotide comprises a promoter operatively linked to the nucleic acid sequence encoding the engineered wide-ranging nuclease.

3. The polynucleotide of claim 2, wherein the promoter is a muscle cell-specific promoter.

4. The polynucleotide of claim 1, wherein the polynucleotide is mRNA.

5. A recombinant DNA construct comprising a polynucleotide containing a nucleic acid sequence encoding an engineered wide-range nuclease, said engineered wide-range nuclease binding to and cleaving nucleic acid at a site in the dystrophin gene containing a recognition sequence consisting of the nucleic acid sequence of SEQ ID NO: 6, wherein said engineered wide-range nuclease consists of the amino acid sequence of SEQ ID NO:

43.

6. The recombinant DNA construct of claim 5, wherein the polynucleotide comprises a promoter operatively linked to the nucleic acid sequence encoding the engineered wide-ranging nuclease.

7. The recombinant DNA construct according to claim 6, wherein the promoter is a muscle cell-specific promoter.

8. A recombinant virus comprising a polynucleotide containing a nucleic acid sequence encoding an engineered macronuclease, said engineered macronuclease binding to and cleaving nucleic acid at a site in the dystrophin gene containing a recognition sequence consisting of the nucleic acid sequence of SEQ ID NO: 6, wherein said engineered macronuclease consists of the amino acid sequence of SEQ ID NO:

43.

9. The recombinant virus according to claim 8, wherein the recombinant virus is a recombinant AAV.

10. The recombinant virus of claim 9, wherein the recombinant AAV has a capsid protein comprising the amino acid sequence of SEQ ID NO: 182 or a capsid comprising the amino acid sequence of SEQ ID NO:

183.

11. The recombinant virus of claim 8, wherein the polynucleotide comprises a promoter operatively linked to the nucleic acid sequence encoding the engineered wide-ranging nuclease.

12. The recombinant virus according to claim 11, wherein the promoter is a muscle cell-specific promoter.

13. The recombinant virus of claim 9, wherein the polynucleotide comprises a promoter operatively linked to the nucleic acid sequence encoding the engineered wide-ranging nuclease.

14. The recombinant virus according to claim 13, wherein the promoter is a muscle cell-specific promoter.

15. The recombinant virus of claim 10, wherein the polynucleotide comprises a promoter operatively linked to the nucleic acid sequence encoding the engineered wide-ranging nuclease.

16. The recombinant virus of claim 15, wherein the promoter is a muscle cell-specific promoter.

17. A polynucleotide comprising a nucleic acid sequence encoding an engineered macronuclease, said engineered macronuclease binding to and cleaving nucleic acid at a site in a dystrophin gene comprising a recognition sequence consisting of the nucleic acid sequence of SEQ ID NO: 10, wherein said engineered macronuclease comprises the amino acid sequence of SEQ ID NO:

51.

18. The polynucleotide of claim 17, wherein the polynucleotide comprises a promoter operatively linked to the nucleic acid sequence encoding the engineered wide-ranging nuclease.

19. The polynucleotide of claim 18, wherein the promoter is a muscle cell-specific promoter.

20. The polynucleotide of claim 17, wherein the polynucleotide is mRNA.

21. A recombinant DNA construct comprising a polynucleotide containing a nucleic acid sequence encoding an engineered wide-range nuclease, said engineered wide-range nuclease binding to and cleaving nucleic acid at a site in the dystrophin gene containing a recognition sequence consisting of the nucleic acid sequence of SEQ ID NO: 10, wherein said engineered wide-range nuclease consists of the amino acid sequence of SEQ ID NO:

51.

22. The recombinant DNA construct of claim 21, wherein the polynucleotide comprises a promoter operatively linked to the nucleic acid sequence encoding the engineered wide-ranging nuclease.

23. The recombinant DNA construct of claim 22, wherein the promoter is a muscle cell-specific promoter.

24. A recombinant virus comprising a polynucleotide containing a nucleic acid sequence encoding an engineered macronuclease, said engineered macronuclease binding to and cleaving nucleic acid at a site in the dystrophin gene containing a recognition sequence consisting of the nucleic acid sequence of SEQ ID NO: 10, wherein said engineered macronuclease consists of the amino acid sequence of SEQ ID NO:

51.

25. The recombinant virus of claim 24, wherein the recombinant virus is a recombinant AAV.

26. The recombinant virus of claim 25, wherein the recombinant AAV has a capsid protein comprising the amino acid sequence of SEQ ID NO: 182 or a capsid comprising the amino acid sequence of SEQ ID NO:

183.

27. The recombinant virus of claim 24, wherein the polynucleotide comprises a promoter operatively linked to the nucleic acid sequence encoding the engineered wide-ranging nuclease.

28. The recombinant virus of claim 27, wherein the promoter is a muscle cell-specific promoter.

29. The recombinant virus of claim 25, wherein the polynucleotide comprises a promoter operatively linked to the nucleic acid sequence encoding the engineered wide-ranging nuclease.

30. The recombinant virus of claim 29, wherein the promoter is a muscle cell-specific promoter.

31. The recombinant virus of claim 26, wherein the polynucleotide comprises a promoter operatively linked to the nucleic acid sequence encoding the engineered wide-ranging nuclease.

32. The recombinant virus according to claim 31, wherein the promoter is a muscle cell-specific promoter.

Images