Recombinant carotenoid-producing yarrowia lipolytica strain, method for constructing same, and use thereof

Abstract

This invention discloses a thermophilic recombinant *Yersinia lipolytica* strain producing carotenoids, its construction method, and its applications. The recombinant strain exogenously expresses thermophilic precursor fatty acid desaturase (FAD3) and isocitrate dehydrogenase (IDH2) mutants from *Rhodotorula rubrum*, achieving efficient synthesis at 30°C. Secondly, the metabolic pathway of the recombinant strain is optimized based on a metabolic flux push-pull strategy, overexpressing isopentenyl pyrophosphate isomerase (IDI), farnesyl pyrophosphate synthase (ERG20), phytene dehydrogenase (CarB), and bifunctional phytene synthase (CarRP) to increase precursor throughput. Finally, multiple copies of the genes for astaxanthin synthase (crtS) and cytochrome P450 reductase (crtR) from *Rhodotorula rubrum* are performed to further enhance the carotenoid production capacity of *Yersinia lipolytica*. The thermophilic *Yersinia lipolytica* construction method of this invention is simple, can achieve more efficient carotenoid synthesis at higher temperatures, significantly reduces fermentation costs, and has potential for industrial production.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and fermentation engineering, and in particular to a thermophilic recombinant lipophilic Yersinia strain that produces carotenoids, its construction method, and its application. Background Technology

[0002] Yersinia lipolyticis is generally considered a safe microorganism, offering high safety assurance in applications in the food and pharmaceutical fields, unlike some bacteria that raise concerns about endotoxins and other safety issues. Furthermore, its strong respiratory and metabolic capabilities allow it to grow to very high cell densities in simple culture media, easily scaling up from shake flasks to large-scale bioreactors. Therefore, the combined characteristics of Yersinia lipolyticis make this strain a promising candidate for producing compounds such as carotenoids. Recent studies have demonstrated that Yersinia lipolyticis is particularly well-suited for oil production, achieving oil content exceeding 50% of its dry cell weight, making it an ideal chassis cell for producing fat-soluble compounds such as carotenoids. In addition, this strain exhibits rapid growth, strong stress resistance, and simple cultivation, making it suitable for industrialization; its mature molecular manipulation platform and well-developed genetic tools further enhance its promising future.

[0003] Carotenoids are an important class of natural pigments with strong antioxidant capabilities, playing a vital role in food, medicine, cosmetics, and agriculture. Rhodotorula rubra is a natural yeast strain that produces carotenoids in nature. Its main product, astaxanthin, is derived from multiple carotenoids through conversion, making its carotenoid synthesis-related enzymes an ideal source for exogenous carotenoid synthesis. Current technology allows for the genetic modification of Yersinia lipolytica to obtain recombinant Yersinia lipolytica strains that produce carotenoids and other terpenes. However, due to the pyrophilic nature of terpene production, the optimal temperature for recombinant strains producing carotenoids and other terpenes remains between 18℃ and 25℃, or even lower. This consumes a large amount of energy for cooling during fermentation, significantly increasing costs in industrial applications. Furthermore, the yield of recombinant microorganisms producing carotenoids needs further improvement due to the lack of more suitable metabolic module combinations. Additionally, with the increase in introduced genes, the number of screening markers available for recombinant strain selection decreases, greatly limiting genetic modification of recombinant strains, and a method for reusing screening markers is lacking. Summary of the Invention

[0004] One object of the present invention is to provide a thermophilic recombinant lipophilic carotenoid-producing Yersinia lipolyticis strain and a method for constructing the same;

[0005] Another object of the present invention is to provide the application of the above-mentioned recombinant Yersinia lipolytica strain in the fermentation production of carotenoids.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A recombinant Yersinia lipolytica strain expressed geraniol-geraniol diphosphate synthase (crtE), phytoene synthase (crtYB), phytoene desaturase (crtI), astaxanthin synthase (crtS), cytochrome P450 reductase (crtR), and HMG-CoA reductase (tHMGR) from Rhodotorula rubrum strain, and further overexpressed thermophilic fatty acid desaturase (FAD3) and isocitrate dehydrogenase (IDH2) mutants from Rhodotorula rubrum;

[0008] The gerany-gerany diphosphate synthase (crtE) gene and the phytoene synthase (crtYB) gene were introduced into the IntE_1 site of the *Yersinia lipolytica* Po1f genome; the HMG-CoA reductase (tHMGR) gene and the phytoene desaturase (crtI) gene were introduced into the IntB site of the recombinant strain genome; the astaxanthin synthase (crtS) gene and the cytochrome P450 reductase (crtR) gene were introduced into the IntC_1 site of the recombinant strain genome; and the fatty acid desaturase (FAD3) gene and the isocitrate dehydrogenase (IDH2) mutant gene were introduced into the IntF_2 site of the recombinant strain genome.

[0009] More preferably, a recombinant Yersinia lipolytica strain also expresses endogenous isopentenyl pyrophosphate isomerase (IDI) and farnesyl pyrophosphate synthase (ERG20) from Yersinia lipolytica, enhancing the precursors of carotenoids and strengthening the synthesis of carotenoids.

[0010] The isopentenyl pyrophosphate isomerase (IDI) gene and farnesyl pyrophosphate synthase (ERG20) gene were introduced into the IntC_3 site of the Yersinia lipolytica Po1f genome.

[0011] More preferably, a recombinant Yersinia lipolytica strain also expresses phytoene dehydrogenase (CarB) and bifunctional phytoene synthase / lycopene cyclase (CarRP) from Mucor.

[0012] The plant olefin dehydrogenase (CarB) gene and the bifunctional plant olefin synthase / lycopene cyclase (CarRP) gene were integrated into the IntA_1 site of the recombinant strain.

[0013] More preferably, a recombinant Yersinia lipophila strain is provided, wherein the strain also uses 26S rDNA as an integration site for multiple copy expression of astaxanthin synthase and cytochrome P450 reductase genes.

[0014] A recombinant Yersinia lipolytica strain, Yil-C1, expresses geraniol-geraniol diphosphate synthase (crtE), phytoene synthase (crtYB), phytoene desaturase (crtI), astaxanthin synthase (crtS), cytochrome P450 reductase (crtR) from Rhodotorula rubra, and HMG-CoA reductase (tHMGR) from Saccharomyces cerevisiae in its host strain. This recombinant strain achieves the synthesis of β-carotene, lycopene, and astaxanthin.

[0015] A recombinant Yersinia lipolytica strain, Yil-C2, expresses geraniol-geraniol diphosphate synthase (crtE), phytoene synthase (crtYB), phytoene desaturase (crtI), astaxanthin synthase (crtS), cytochrome P450 reductase (crtR), and HMG-CoA reductase (tHMGR) from Rhodotorula brevicornu. It further expresses isopentenyl pyrophosphate isomerase (IDI) and farnesyl pyrophosphate synthase (ERG20) endogenous in Yersinia lipolytica, thereby enhancing the precursors of carotenoids and strengthening carotenoid synthesis.

[0016] A recombinant *Yersinia lipolytica* strain, Yil-C3, expresses in its host strain geraniol-geraniol diphosphate synthase (crtE), phytoene synthase (crtYB), phytoene desaturase (crtI), astaxanthin synthase (crtS), cytochrome P450 reductase (crtR), HMG-CoA reductase (tHMGR) from *Saccharomyces cerevisiae*, and isopentenyl pyrophosphate isomerase (IDI) and farnesyl pyrophosphate synthase (ERG20) endogenous from *Yersinia lipolytica*. The recombinant strain further expresses phytoene dehydrogenase (CarB) and a bifunctional phytoene synthase / lycopene cyclase (CarRP) from *Mucor*.

[0017] A recombinant Yersinia lipolytica strain, Yil-C4, further increased the copy number of astaxanthin synthase (crtS) and cytochrome P450 reductase (crtR) by using 26S rDNA as the integration site, based on the Yil-C3 strain, thereby enhancing the synthesis of carotenoids.

[0018] A recombinant Yersinia lipolytica strain, Yil-C5, was developed by expressing a thermophilic fatty acid desaturase (FAD3) and isocitrate dehydrogenase (IDH2) mutant from Rhodopsinia rubra, which increased the production temperature of carotenoids and greatly reduced fermentation costs.

[0019] More preferably, a thermophilic recombinant *Yersinia lipolytica* strain producing carotenoids is obtained by expressing, in a host bacterium, geraniol diphosphate synthase (crtE), phytoene synthase (crtYB), phytoene desaturase (crtI), astaxanthin synthase (crtS), cytochrome P450 reductase (crtR), HMG-CoA reductase (tHMGR) from *Saccharomyces cerevisiae*, endogenous isopentenyl pyrophosphate isomerase (IDI) and farnesyl pyrophosphate synthase (ERG20) from *Yersinia lipolytica*, phytoene dehydrogenase (CarB) and bifunctional phytoene synthase (CarRP) from *Mucor*, and thermophilic fatty acid desaturase (FAD3) and isocitrate dehydrogenase (IDH2) from *Saccharomyces cerevisiae*; wherein the host bacterium is a genetically modified *Yersinia lipolytica* strain Po1f.

[0020] In a preferred embodiment, the nucleotide sequences of the gerany-gerany diphosphate synthase (crtE), phytoene synthase (crtYB), phytoene desaturase (crtI), astaxanthin synthase (crtS), cytochrome P450 reductase (crtR), HMG-CoA reductase (tHMGR) from *Saccharomyces cerevisiae*, isopentenyl pyrophosphate isomerase (IDI) and farnesyl pyrophosphate synthase (ERG20) from *Yersinia lipolytica*, phytoene dehydrogenase (CarB) and bifunctional phytoene synthase (CarRP) from *Mucor*, and the thermophilic fatty acid desaturase (FAD3) and isocitrate dehydrogenase (IDH2) mutants from *Rhodotorula rubra* are shown in SEQ ID NO: 1-12, respectively.

[0021] The method for constructing the above-mentioned recombinant Yersinia lipophila strain includes the following steps:

[0022] Using the Easyclone toolkit, a free expression plasmid containing Cre recombinase from *Yersinia lipophila* was constructed to achieve the recovery of the selection marker. Expression plasmids pcfb-4778-crtE-crtYB, pcfb-4586-tHMGR-crtI, pcfb-4781-crtS-crtR, pcfb-4786-IDI-ERG20, and pcfb-5935 were constructed using pcfb-4778, pcfb-4586, pcfb-4781, pcfb-4786, pcfb-5935, and pcfb-5791 as vector plasmids, respectively. The recombinant plasmids -CarB-CaRP and pcfb-5791-FAD3-IDH2 were integrated into the po1f genome at the IntE_1, IntB, IntC_1, IntC_3, IntA_1, and IntF_2 sites, respectively. Using 26S rDNA as the integration site, multi-copy plasmids of astaxanthin synthase (crtS) and cytochrome P450 reductase (crtR) were constructed and transformed to obtain the recombinant Yersinia lipolytica strain.

[0023] Application of the above-mentioned Yersinia lipolyticis strain in the fermentation production of carotenoids.

[0024] The fermentation temperature is 18–30°C, and the fermentation time is 72–168 h. More preferably, the fermentation temperature is 28–30°C.

[0025] The application of the above-mentioned *Yarrowia lipolytica* strain in the fermentation production of carotenoids at 30°C. As a preferred embodiment, the recombinant *Yarrowia lipolytica* strain is subjected to seed culture and fermentation culture to synthesize carotenoids.

[0026] As a preferred embodiment, one or more of Mg2+, Mn2+, jasmonic acid, and hydrogen peroxide are added during the fermentation culture of the recombinant Yersinia lipolytica strain.

[0027] In a preferred embodiment, Mg2+ and Mn2+ are added in the early stage of fermentation culture of the recombinant Yersinia lipolytica strain, jasmonic acid is added in the middle stage, and hydrogen peroxide is added in the later stage.

[0028] The initial stage of fermentation is 0-10 hours after the start of fermentation, the middle stage is 48-72 hours after the start of fermentation, and the later stage is 96-120 hours after the start of fermentation.

[0029] More preferably, the Mg 2+ The added concentration was 0.02-0.2 mmol / L, Mn 2+The concentration of added [substance name] is 0.02-0.2 mmol / L, the concentration of added jasmonic acid is 0.1-1 g / L, and the concentration of added hydrogen peroxide is 2-20 mmol / L.

[0030] More preferably, add 0.1 mmol / L mg 2+ Ions, 0.1 mmol / L Mn 2+ Ions, 0.5 g / L jasmonic acid, 10 mmol / L hydrogen peroxide.

[0031] In a preferred embodiment, the fermentation culture uses glucose as the carbon source.

[0032] More preferably, the fermentation medium consists of 20 g / L glucose, 10 g / L yeast extract, and 20 g / L tryptone.

[0033] Beneficial effects:

[0034] The recombinant *Yersinia lipolytica* strain constructed in this invention enhances the fermentation temperature under high-temperature conditions by introducing exogenous thermophilic elements, thereby reducing fermentation costs and achieving efficient high-temperature synthesis of carotenoids from natural products in *Yersinia lipolytica*. Furthermore, this invention utilizes exogenous additives—metal ions, jasmonic acid, and hydrogen peroxide—to further enhance the carotenoid production capacity of *Yersinia lipolytica*. The *Yil-C5* strain achieved a carotenoid yield of 3820.4 mg / L in a 5L fed-batch fermenter, laying the foundation for further industrial-scale production. Attached Figure Description

[0035] Figure 1 High-performance liquid chromatography (HPLC) chromatogram of carotenoid detection in Yli-1 recombinant strain;

[0036] Figure 2 ; Figures showing the results of shake-flask fermentation of recombinant strains at different temperatures;

[0037] Figure 3 Comparative fermentation of recombinant bacteria Yli-1, Yli-2, Yli-3, and Yli-4 at 30℃ after introduction into a thermophilic element;

[0038] Figure 4 Recombinant strain Yli-5 was exogenously supplemented with mg at 30℃ 2+ ,Mn 2+ Shake-flask fermentation with jasmonic acid and hydrogen peroxide;

[0039] Figure 5 A 5-L scale small-scale fermentation of recombinant strain Yil-C5 for the production of carotenoids at 30℃;

[0040] Figure 6 Image of plasmid pcfb-4778-crtE-crtYB;

[0041] Figure 7 Image of plasmid pcfb-4586-tHMGR-crtI;

[0042] Figure 8 Image of plasmid pcfb-4781-crtS-crtR;

[0043] Figure 9 Plasmid 26S rDNA-crtS-crtR map;

[0044] Figure 10 Image of plasmid pcfb-4786-IDI-ERG20;

[0045] Figure 11 Image of plasmid pcfb-5791-fad3-idh2;

[0046] Figure 12 Plasmid cre-Leu map. Detailed Implementation

[0047] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0048] The original strain used in the examples was Yersinia lipophila Po1f, which can be purchased from commercial sources.

[0049] The pcfb-4778, pcfb-4586, pcfb-4781, pcfb-4786, pcfb-5935, and pcfb-5791 vector plasmids used in the examples were obtained from the EasyCloneYALI Kits purchased from addgene.

[0050] In this embodiment, the extraction and quantitative analysis steps of carotenoids are as follows:

[0051] 1. Extraction of carotenoids

[0052] (1) Take 1 mL of the mixed fermentation broth and centrifuge at 12000 rpm for 5 min (wash twice with pure water).

[0053] (2) After draining the water, resuspend the contents in 2 mL of dimethyl sulfoxide (DMSO) (preheated at 60°C) and shake evenly on a vortex mixer. Then place the container in a 55°C water bath for 15 min.

[0054] (3) Add 4 mL of anhydrous ethanol.

[0055] (4) Centrifuge the sample at 12,000 rpm for 5 min. Transfer the supernatant to a new centrifuge tube and store it away from light.

[0056] 2. Quantitative analysis of carotenoids: High performance liquid chromatography was used to detect the concentration of astaxanthin.

[0057] The liquid chromatograph used in this study was an Agilent Technologies 1200 Infinity series.

[0058] The chromatographic column was an Acclaim™ 120 C30 column; the UV absorption wavelength was 450 nm; the mobile phase was methanol and methyl tert-butyl ether; the flow rate was controlled at 1.0 mL / min; and the column temperature was 25 °C.

[0059] Example 1: Amplification of Gene Elements and Preparation of Target Plasmids

[0060] Based on the nucleotide sequences of astaxanthin synthase CrtS and P450 reductase CrtR from Xanthophyllomyces dendrorhous provided on NCBI, the gene sequences were obtained through codon optimization. The optimized gene sequences resulted in better compatibility between the exogenous gene and the chassis of Yersinia lipolytica. The gene sequences are shown in SEQ ID No: 5-6.

[0061] Based on the coding gene sequences of plant olefin dehydrogenase (CarB) and bifunctional plant olefin synthase / lycopene cyclase (CarRP) from *Rhizopus lipolyticus* provided on NCBI, the gene sequences were obtained through codon optimization. The optimized gene codons resulted in better compatibility between the exogenous gene and the chassis of *Yarrowia lipolyticus*. The gene sequences are shown in SEQ ID No: 9-10.

[0062] Based on the HMG-CoA reductase (tHMGR) from Saccharomyces cerevisiae provided on NCBI, PCR amplification was performed using the Saccharomyces cerevisiae genome as a template. The gene sequence is shown in SEQ ID No: 4.

[0063] The mesophilic fatty acid desaturase (FAD3) and isocitrate dehydrogenase (IDH2) mutants from *Rhodotorula rubra* were obtained by sequencing the *Rhodotorula rubra* genome and further codon optimization. The gene sequences are shown in SEQ ID No: 11-12.

[0064] Based on the isopentenyl pyrophosphate isomerase (IDI) and farnesyl pyrophosphate synthase (ERG20) from *Yersinia lipolytica* provided on NCBI, PCR amplification was performed using the *Yersinia lipolytica* genome as a template. The gene sequences are shown in SEQ ID No: 7-8.

[0065] Geraniol geraniol diphosphate synthase (crtE), phytoene synthase (crtYB), and phytoene desaturase (crtI) derived from Rhodotorula rubra strain were obtained through codon optimization. The optimized gene codons resulted in better compatibility between the exogenous genes and the chassis of Yersinia lipolytica. The gene sequences are shown in SEQ ID No: 1-3.

[0066] Construction of recombinant plasmids

[0067] Recombinant plasmid pcfb-4778-crtE-crtYB containing the gerany-gerany-bisphosphate synthase gene (crtE) and the phytoene synthase gene (crtYB) from *X. denrorhous* strain were constructed using the Easyclone toolkit with pcfb-4778 as the vector plasmid. The nucleotide sequence of the gerany-gerany-bisphosphate synthase gene crtE from *X. denrorhous*, provided on NCBI, and the nucleotide sequence of the phytoene synthase gene crtYB, after codon optimization, were commissioned to GenScript (Nanjing) Co., Ltd. for codon optimization and synthesis.

[0068] Recombinant plasmids pcfb-4586-tHMGR-crtI were constructed using the Easyclone toolkit with pcfb-4586 as the vector plasmid. The recombinant plasmid pcfb-4586-tHMGR-crtI was constructed using the gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase from Yersinia lipolytica, as shown in SEQ ID No: 4, based on the gene sequence of 3-hydroxy-3-methylglutaryl-CoA reductase from Yersinia lipolytica provided on NCBI. The nucleotide sequence of the gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase from Yersinia lipolytica was amplified by PCR using the Yersinia lipolytica genome as a template. The nucleotide sequence of the gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase from Yersinia lipolytica was codon optimized and synthesized by GenScript (Nanjing) Co., Ltd.

[0069] Recombinant plasmid pcfb-4781-crtS-crtR containing the astaxanthin synthase gene (crtS) and cytochrome P450 reductase gene (crtR) from *Rhodotorula rubra* was constructed using the Easyclone toolkit with pcfb-4781 as the vector plasmid. The nucleotide sequences of the astaxanthin synthase gene (crtS) and cytochrome P450 reductase gene (crtR) from *X. denrorhous*, provided on NCBI, were optimized for codons, and then synthesized by GenScript (Nanjing) Co., Ltd.

[0070] Recombinant plasmid pcfb-4786-IDI-ERG20 containing endogenous isopentenyl pyrophosphate isomerase (IDI) and farnesyl pyrophosphate synthase (ERG20) from *Yarrowia lipolytica* was constructed using the Easyclone toolkit with pcfb-4786 as the vector plasmid. PCR amplification was performed using the *Yarrowia lipolytica* genome as a template, based on the nucleotide sequences of the endogenous isopentenyl pyrophosphate isomerase (IDI) and farnesyl pyrophosphate synthase (ERG20) genes provided by NCBI.

[0071] Recombinant plasmid pcfb-5935-CarB-CaRP was constructed using the Easyclone toolkit with pcfb-5935 as the vector plasmid. This plasmid contains phytoene dehydrogenase (CarB) and bifunctional phytoene synthase / lycopene cyclase (CarRP) from *Mucor*. The nucleotide sequences of phytoene dehydrogenase (CarB) and bifunctional phytoene synthase / lycopene cyclase (CarRP) from *Mucor* were optimized using NCBI data, and then codon optimization and synthesis were performed by GenScript (Nanjing) Co., Ltd.

[0072] Recombinant plasmid pcfb-5791-FAD3-IDH2 containing mesophilic fatty acid desaturase (FAD3) and isocitrate dehydrogenase (IDH2) mutants from *Rhodotorula rubrum* was constructed using the Easyclone toolkit with pcfb-5791 as the vector plasmid. The mesophilic fatty acid desaturase (FAD3) and isocitrate dehydrogenase (IDH2) mutants from *Rhodotorula rubrum* were derived from *Rhodotorula rubrum* genome sequencing. Further codon optimization was performed, and the codons were then optimized and synthesized by GenScript (Nanjing) Co., Ltd.

[0073] The plasmid construction method of the Easyclone toolkit is as follows:

[0074] First, the TEF-GPD bidirectional promoter gene to be used was amplified by overlap extension PCR. The gene fragment was amplified with Uhot enzyme. Then, the circular vector plasmid was digested with AsiSI enzyme, and then sticky ends were extracted with Nb.BsmI. The gene fragment was then processed using USER... TM The enzyme ligated the vector, target gene, and bidirectional promoter, and the circular recombinant vector was transformed into E. coli DH5α competent cells. Positive recombinant plasmids were obtained by ampicillin-resistant plate screening and colony PCR and sequencing verification.

[0075] The PCR amplification system for the target gene is as follows:

[0076] system 50μL distilled water 32μL 5×buffer 10μL upstream primer 2.5μL Downstream primer 2.5μL dNTP Mix 1μL template 1μL U hot enzyme 1μL

[0077] PCR amplification procedure for the target gene:

[0078] 98℃2min, 98℃10s, a℃30s, 72℃bmin, 72℃5min, 10℃∞.

[0079] The AsiSI enzyme digestion system is as follows:

[0080] system 200μL template 1μL 10×buffer 20μL AsiSI enzyme 5μL distilled water Add to 200μL

[0081] The Nb.BsmI digestion system is as follows:

[0082] system 50μL Template 40μL Nb.BsmI enzyme 1μL 10×buffer 5μL distilled water Add to 50μL

[0083] Use USER TM The enzyme was cloned in one step, and the reaction system is shown in the table below:

[0084] Enzyme digestion vector 1μL Gene 1 1μL Gene 2 1μL bidirectional promoter 1μL Cutsmart 0.5μL <![CDATA[USER TM enzymes 0.5μL

[0085] The reaction conditions for AsiSI enzyme are 37℃ for 1 h. The reaction conditions for Nb.BsmI enzyme are 65℃ for 1 h.

[0086] USER TM The detailed steps for one-step enzyme cloning are as follows: First, incubate the system at 37℃ for 25 min, then at 25℃ for 10 min, then add 95 μL of DH5α competent cells and incubate on ice for 10 min. After heat shock at 42℃ for 90 s, incubate on ice for 2 min, add 100 μL of SOC medium, incubate at 37℃ for 30 min, and then plate.

[0087] Construction of 26S rDNA plasmids for multiple copies of astaxanthin synthase (crtS) and cytochrome P450 reductase (crtR):

[0088] A gene fragment carrying ampicillin resistance was amplified from the BB2-AB plasmid using primers BB2-AB-F and BB2-AB-R. The BB2-AB plasmid is disclosed in patent CN 119120242 A. A fragment carrying the uracil gene was then amplified from the pcfb-4778 plasmid using primers Tip2 and tURA3-R-26s. The upstream and downstream sequences of 26S rDNA were amplified from the *Yarrowia lipolytica* po1f genome using primers 26sDW-F, 26sFP-R, and 26sUP-R, 26sFP-F, serving as integration sites. A gene fragment carrying the target gene crtS-crtR was then amplified from the pcfb-4781-crtS-crtR plasmid using primers crtS-R and crtR. Finally, one-step cloning was performed using the ClonExpress MultiS One Step Cloning Kit from Nanjing Novizan Biotechnology Co., Ltd. The expression cassette and vector were linked, and the circular recombinant vector was transformed into *E. coli* DH5α competent cells. Positive recombinant plasmids, 26S rDNA-crtS-crtR, were obtained through ampicillin-resistant plate selection and colony PCR and sequencing verification. The plasmid structure is shown below. Figure 5 As shown, the specific primer sequences are listed in the table below:

[0089] Primer name Sequence (5'-3') BB2-AB-F taatagggaacgtgagctgggtttagaccgtCGCGTCAGGTGGCACTTTTC BB2-AB-R tatacccagatcctacgatcgatttgcGGAGACCGCGAAAAAACCCC Tlip2 tcatggacgtttggtcttgacttctgttcggaatcaacctcaagg tURA3-R-26s ctattttgccgacttcccttaggccactagtggatctgata 26sDW-F atatcagatccactagtggcctaagggaagtcggcaaaatag 26sFP-R acggtctaaacccagctc 26sUP-R ttgcgtaagcgttgcacgtatctacattattctatcaactagaggct 26sFP-F gcaaatcgatcgtaggatct crtS-R tcattccacaggcttgacttggag crtR tcaagaccaaacgtccatgagca

[0090] The multi-fragment one-step cloning system is as follows:

[0091] system 20μL Exnase MuLtiS enzyme 2μL 5×CE buffer 4μL Linearized carrier cμL gene fragments dμL distilled water Add to 20μL

[0092] The amount of linearized vector (c) and inserted fragment (d) used can be calculated using the following formula:

[0093] The optimal dosage of the fragment (c) = [0.04 × number of fragment base pairs] ng / Y ng / uL. (Y is the concentration)

[0094] The optimal carrier dosage (d) = [0.02 × number of fragment base pairs] ng / X ng / uL. (X is the concentration)

[0095] The method for constructing a free plasmid containing cre recombinase for screening marker elimination is as follows:

[0096] Using the constructed 113-TEF-GPD (see CN114806914 A) as a template, the vector for the desired plasmid was amplified using primers 113-F and 113-R. Then, using primers cre-F, cre-R and Leu-F, Lue-R, respectively, overlap extension PCR was used to amplify the CRE recombinase expression cassette and the selection marker leucine expression cassette. Both the CRE recombinase and leucine expression genes were obtained from NCBI. After codon optimization, the CRE recombinase gene sequence is shown in SEQ 13, and the leucine expression gene sequence is shown in SEQ 14. Codon optimization and synthesis were performed by GenScript (Nanjing) Co., Ltd. One-step cloning was performed using the ClonExpress MuLtiS One Step Cloning Kit from Nanjing Novizan Biotechnology Co., Ltd. The two expression cassettes and the vector were ligated, and the circular recombinant vector was transformed into *E. coli* DH5α competent cells. Positive recombinant plasmid cre-leu was obtained through ampicillin-resistant plate selection and colony PCR and sequencing verification. The plasmid structure is shown in [image missing]. Figure 5 The specific primer sequences are shown in the table below:

[0097]

[0098] The multi-fragment one-step cloning system is as follows:

[0099] system 20μL Exnase MuLtiS enzyme 2μL 5×CE buffer 4μL Linearized carrier eμL gene fragments fμL distilled water Add to 20μL

[0100] The amount of linearized vector (g) and inserted fragment (h) used can be calculated using the following formula:

[0101] The optimal dosage of the fragment (e) = [0.04 × number of fragment base pairs] ng / Y ng / uL. (Y is the concentration)

[0102] The optimal carrier dosage (f) = [0.02 × number of fragment base pairs] ng / X ng / uL. (X is the concentration)

[0103] Example 2 Construction of recombinant bacteria

[0104] Construction of recombinant bacteria Yil-C1, Yil-C2, Yil-C3, Yil-C4, and Yil-C5

[0105] The pcfb-4778-crtE-crtYB gene expression cassette, linearized, was transformed and introduced into the IntE_1 site of the *Yersinia lipolytica* Po1f genome. Positive transformants were obtained through screening on uracil-deficient plates (purchased from Coolaber, catalog number PM2273). The positive transformants successfully infused with the crtE and crtYB genes were converted into competent cells and transformed with the circular cre-Leu plasmid to eliminate the uracil gene between the two Loxp sites, allowing for the reuse of the uracil-deficient selection marker. Positive transformants were obtained through screening on leucine-deficient plates (purchased from Coolaber, catalog number PM2203), and the transformants were passaged twice to achieve the loss of the cre-Leu plasmid. Then, the linearized pcfb-4586-tHMGR-crtI plasmid was integrated into the lost IntB site of the recombinant genome, and yellow positive transformants were obtained again through screening on uracil-deficient plates. The linearized plasmid pcfb-4781-crtS-crtR was then integrated into the IntC_1 site of the recombinant strain that had been introduced with the crtE, crtYB, crtI, and tHMGR genes. The positive recombinant strain capable of producing β-carotene, lycopene, and astaxanthin was obtained by screening with norsinolate and named Yil-C1.

[0106] The Yil-C1 strain was prepared into competent cells. First, the circular cre-Leu plasmid was introduced to eliminate the selection marker. Then, the linearized pcfb-4786-IDI-ERG20 plasmid was introduced and integrated into the IntC_3 site of the genome. Positive transformants were obtained by norsinolate selection and named Yil-C2.

[0107] The Yil-C2 strain was made into competent cells, and the linearized pcfb-5935-CarB-CaRP gene expression cassette was integrated into the IntA_1 site of the Yil-C2 strain genome. Positive transformants were obtained by screening with hygromycin plates and named Yil-C3.

[0108] The Yil-C3 strain was prepared into competent cells. First, a circular cre-Leu plasmid was introduced to eliminate the selection marker. Then, the linearized 26SrDNA-crtS-crtR gene expression cassette was integrated into the multiple cloning site 26SrDNA of the Yil-C3 strain. Positive transformants were obtained by screening with uracil-deficient plates and named Yil-C4.

[0109] The Yil-C4 strain was prepared into competent cells. First, a circular cre-Leu plasmid was introduced to eliminate the selection marker. The linearized pcfb-5791-FAD3-IDH2 gene expression cassette was integrated into the IntF_2 site of the Yil-C4 strain genome. Positive transformants were obtained through uracil-deficient plate selection and named Yil-C5.

[0110] The specific methods for preparing and transforming competent cells of Yersinia lipophila are as follows:

[0111] Engineered *Yarrowia lipolytica* Po1f cells were cultured overnight in YPD liquid medium (containing 2% peptone, 1% yeast extract, and 2% glucose) until an OD600 of 0.8–1.0 was reached. Cells were then centrifuged at 4000 rpm for 4 min, the supernatant was discarded, and the cells were resuspended in solution 1 of the Zymogen Frozen EZ Yeast Transformation Kit II from Zymo Research Corporation. After centrifugation at 4000 rpm for 4 min, the supernatant was discarded, and 100 μL of solution 2 was added to prepare competent cells. Cells were aliquoted into 1.5 mL EP tubes and stored at -80°C. The gene expression cassette was introduced into the *Yarrowia lipolytica* competent cells using solution 3 of the Zymogen Frozen EZ Yeast Transformation Kit II from Zymo Research Corporation for homologous recombination.

[0112] Example 3: Shake-flask fermentation of recombinant strains at different temperatures

[0113] Carotenoids were produced at different temperatures using the recombinant strains Yli-C1, Yli-C2, Yli-C3, Yli-C4, and Yli-C5 from Example 2, respectively.

[0114] The specific method is as follows: The bacterial strain was taken from the preservation tube and inoculated into a YPD test tube at a 1% inoculum rate. The culture was then incubated at 30℃ for 24 hours to obtain the seed culture. The seed culture was then inoculated into 50 ml of fermentation medium at a 1% inoculum rate and cultured at 25℃ with shaking at 200 rpm for 7 days. The fermentation medium contained 20 g / L glucose, 10 g / L yeast extract, and 20 g / L trypsin.

[0115] 1. Extraction of carotenoids

[0116] (1) Take 1 mL of the mixed fermentation broth and centrifuge at 12000 rpm for 5 min (wash twice with pure water).

[0117] (2) After draining the water, resuspend the contents in 2 mL of dimethyl sulfoxide (DMSO) (preheated at 60°C) and shake evenly on a vortex mixer. Then place the container in a 55°C water bath for 15 min.

[0118] (3) Add 4 mL of anhydrous ethanol.

[0119] (4) Centrifuge the sample at 12,000 rpm for 5 min. Transfer the supernatant to a new centrifuge tube and store it away from light.

[0120] 2. Quantitative analysis of carotenoids: High performance liquid chromatography was used to detect the concentration of astaxanthin.

[0121] The liquid chromatograph used in this study was an Agilent Technologies 1200 Infinity series.

[0122] The chromatographic column was: Acclaim™ 120 C30 column; the ultraviolet absorption wavelength was 450 nm; the mobile phase was methanol and methyl tert-butyl ether; the flow rate was controlled at 1.0 mL / min; and the column temperature was 25 °C. (1) Take 1 mL of the mixed fermentation broth and centrifuge at 12000 rpm for 3 min (wash twice with pure water).

[0123] Figure 1 The image shows the HPLC analysis of carotenoids produced by the recombinant strain Yli-C1. The main carotenoids produced by this recombinant strain are lycopene, β-carotene, and astaxanthin. Comparison of fermentation at different temperatures revealed that recombinant strains Yli-C1, Yli-C2, Yli-C3, and Yli-C4 exhibited higher carotenoid yields at lower temperatures, with extremely low yields at 30℃. The Yli-C4 recombinant strain, infused with mutant genes for the thermophilic fatty acid desaturase (FAD3) and isocitrate dehydrogenase (IDH2) from *Rhodopseudomonas aeruginosa*, achieved highly efficient carotenoid synthesis at 30℃. After 7 days of fermentation, the recombinant strain Yli-5 showed the highest carotenoid yield, reaching 124.2 mg / L, or 124.2 mg of carotenoids per liter of fermentation broth.

[0124] Example 4: Verification of the effect of thermophilic components

[0125] Competent cells were prepared from strains Yil-C1, Yil-C2, Yil-C3, and Yil-C4. The linearized pcfb-5791-FAD3-IDH2 gene expression cassette was integrated into the IntF_2 site of the genome of each of these four strains. Positive transformants were obtained through uracil-deficient plate selection and named Yli-C1', Yli-C2', Yli-C3', and Yli-C4', respectively. These transformants were then fermented at 30°C for 7 days. Figure 3 As shown, the four recombinant strains Yil-C1, Yil-C2, Yil-C3, and Yil-C4 all exhibited stronger carotenoid synthesis capabilities at 30℃ after the introduction of the thermophilic element, and the yield of carotenoids was greatly increased.

[0126] Example 5: Recombinant strain Yli-5 was exogenously supplemented with mg at 30℃ 2+ ,Mn 2+ Shake-flask fermentation of jasmonic acid and hydrogen peroxide

[0127] The recombinant strain Yli-C5 from Example 2 was supplemented with 0.1 mmol / L mg of the solution. 2+ Ions, 0.1 mmol / L LMn 2+ Carotenoids are produced at 30°C using ions, 0.5 g / L jasmonic acid, and 10 mmol / L hydrogen peroxide.

[0128] The specific method is as follows: The strain was taken from the preservation tube and inoculated into a YPD test tube at a 1% inoculum rate. The culture was then incubated at 30℃ for 24 hours to obtain the seed culture. The seed culture was then inoculated into 50 ml of fermentation medium at a 1% inoculum rate and cultured at 25℃ with shaking at 200 rpm for 7 days. The fermentation medium contained 20 g / L glucose, 10 g / L yeast extract, and 20 g / L trypsin. During fermentation, the following operations were performed: For the first group, mg of [unspecified substance] was added at 0 h of fermentation. 2+ The second group had Mn added during fermentation for 0 hours. 2+ The third group had jasmonic acid added after 48 hours of fermentation, and the fourth group had hydrogen peroxide added after 120 hours of fermentation.

[0129] The results showed that the addition of magnesium ions promoted the growth of recombinant strain Yli-C5 at 30℃, increasing biomass by 14.6%, which in turn increased carotenoid production by 16.7%, reaching 145.7 mg / L. The addition of manganese ions not only promoted the growth of recombinant strain Yli-C5 at 30℃ but also promoted its carotenoid synthesis. After the addition of manganese ions, the biomass of recombinant strain Yli-C5 was 13.1% higher than the control, and the carotenoid production and content were also 27% and 13% higher, respectively. The addition of jasmonic acid and hydrogen peroxide both stimulated carotenoid synthesis, increasing carotenoid production by 5.1% and 18.3%, respectively, compared to the control.

[0130] Example 6: Small-scale 5-L fermentation of recombinant strain Yil-C5 for the production of carotenoids at 30°C

[0131] ① Seed culture:

[0132] a. Primary seed culture: Take 1% of the recombinant strain Yli-C5 bacterial culture from the cryopreservation tube and inoculate it into YPD test tubes. Incubate at 30°C and 200 rpm for 24 hours to obtain the primary seed culture. The YPD culture medium contains 2% peptone, 1% yeast extract and 2% glucose.

[0133] b. Secondary seed culture: Take the primary seed culture and inoculate it into a new seed culture medium at an inoculation rate of 10%, and culture it at a constant temperature under the same conditions as a to obtain the seed culture for fermentation culture.

[0134] ② Batch feeding fermentation

[0135] The seed culture obtained from seed culture was inoculated into a 5L fermenter containing YPD medium. The recombinant strain Yli-C5 underwent fed-batch fermentation in the 5L fermenter at 30℃ for 500 rpm, with dissolved oxygen maintained at 40%. The initial glucose concentration in the fermenter was 40 g / L. When the glucose was nearly depleted, glucose was added continuously to maintain the glucose concentration below 10 g / L. Samples were taken every 12 hours to determine cell dry weight and extract carotenoids from the fermentation broth, and the carotenoid content was determined. At the start of fermentation, 0.1 mmol / L of mg²⁺ and Mn²⁺ were added, followed by 0.5 g / L jasmonic acid at 48 h, and 10 mmol / L hydrogen peroxide at 120 h. The biomass reached 62.5 g / L, the carotenoid yield reached 3820.4 mg / L, and the carotenoid content was 61.1 mg / g. Figure 5 ).

[0136] This invention first successfully constructed a recombinant *Yersinia lipolytica* strain capable of simultaneously producing lycopene, β-carotene, and astaxanthin using the Easyclone toolkit and cre-Loxp technology. By introducing exogenous thermophilic elements, the fermentation temperature of the strain under high-temperature conditions was enhanced, reducing fermentation costs. Then, by introducing exogenous strong genes to increase the precursor synthesis module and multiple cloning integration sites to increase gene copy number, the ability of *Yersinia lipolytica* to produce carotenoids was improved. Fermentation optimization under different conditions was conducted on the engineered strain to enhance the metabolic flux of product synthesis. Finally, batch fed-batch fermentation was performed in a 5L fermenter to comprehensively evaluate the production capacity of the strain. By detecting the biomass and carotenoid production of the recombinant strain in the fermenter, it is expected that the yield of carotenoids can be further increased in larger-volume fermenters, laying the foundation for subsequent industrialization.

Claims

1. A recombinant Yersinia lipophila strain, characterized in that, The strain expressed geraniol-geraniol diphosphate synthase (crtE), phytoene synthase (crtYB), phytoene desaturase (crtI), astaxanthin synthase (crtS), cytochrome P450 reductase (crtR), and HMG-CoA reductase (tHMGR) from *Saccharomyces cerevisiae*, and further overexpressed thermophilic fatty acid desaturase (FAD3) and isocitrate dehydrogenase (IDH2) mutants from *Rhodotorula rubra*. The nucleotide sequences of the gerany-gerany diphosphate synthase (crtE) are shown in SEQ ID NO: 1, the nucleotide sequences of the phytoene synthase (crtYB) are shown in SEQ ID NO: 2, the nucleotide sequences of the phytoene desaturase (crtI) are shown in SEQ ID NO: 3, the nucleotide sequences of the HMG-CoA reductase (tHMGR) are shown in SEQ ID NO: 4, the nucleotide sequences of the astaxanthin synthase (crtS) are shown in SEQ ID NO: 5, the nucleotide sequences of the cytochrome P450 reductase (crtR) are shown in SEQ ID NO: 6, the nucleotide sequences of the fatty acid desaturase (FAD3) are shown in SEQ ID NO: 11, and the nucleotide sequences of the isocitrate dehydrogenase (IDH2) mutant are shown in SEQ ID NO:

12.

2. The recombinant Yersinia lipolyticis strain according to claim 1, characterized in that, The strain also expresses isopentenyl pyrophosphate isomerase (IDI) and farnesyl pyrophosphate synthase (ERG20) from endogenous Yersinia lipolytica. The nucleotide sequence of isopentenyl pyrophosphate isomerase (IDI) is shown in SEQ ID NO: 7, and the nucleotide sequence of farnesyl pyrophosphate synthase (ERG20) is shown in SEQ ID NO:

8.

3. The recombinant Yersinia lipolyticis strain according to claim 2, characterized in that, The strain also expresses phytoene dehydrogenase (CarB) and bifunctional phytoene synthase / lycopene cyclase (CarRP) from Mucor. The nucleotide sequence of phytoene dehydrogenase (CarB) is shown in SEQ ID NO: 9, and the nucleotide sequence of bifunctional phytoene synthase / lycopene cyclase (CarRP) is shown in SEQ ID NO:

10.

4. The recombinant Yersinia lipolyticis strain according to claim 3, characterized in that, The strain also used 26S rDNA as an integration site to express multiple copies of the astaxanthin synthase and cytochrome P450 reductase genes.

5. The method for constructing the recombinant Yersinia lipophila strain according to any one of claims 1-4, characterized in that, include: Recombinant plasmids pcfb-4778-crtE-crtYB, pcfb-4586-tHMGR-crtI, pcfb-4781-crtS-crtR, pcfb-4786-IDI-ERG20, pcfb-5935-CarB-CaRP, and pcfb-5791-FAD3-IDH2 were constructed using pcfb-4778, pcfb-4586, pcfb-4781, pcfb-4786-tHMGR-crtI, pcfb-4781-crtS-crtR, pcfb-4786-IDI-ERG20, pcfb-5935-CarB-CaRP, and pcfb-5791-FAD3-IDH2 as vector plasmids, respectively. These recombinant plasmids were then integrated into the po1f genome at the IntE_1, IntB, IntC_1, IntC_3, and IntA_1 sites, respectively, to obtain the *Yersinia lipolytica* strain.

6. The use of the recombinant Yersinia lipolyticis strain according to any one of claims 1-4 in the fermentation production of carotenoids.

7. The application according to claim 6, characterized in that, The recombinant Yersinia lipophila strain was subjected to seed culture and fermentation culture to synthesize carotenoids. The fermentation culture temperature was 18~30℃ and the fermentation time was 72~168h.

8. The application according to claim 7, characterized in that, The fermentation culture is added with Mg 2+ , Mn 2+ in the early stage of fermentation culture, jasmonic acid in the middle stage, and hydrogen peroxide in the later stage.

9. The application according to claim 8, characterized in that, The Mg 2+ The added concentration was 0.02-0.2 mmol / L, Mn 2+ The concentrations of added substances are 0.02-0.2 mmol / L, the concentrations of added jasmonic acid are 0.1-1 g / L, and the concentrations of added hydrogen peroxide are 2-20 mmol / L.

Images