Adeno-associated virus vector for treating yolk-like macular degeneration

Abstract

The invention relates to an adeno-associated virus vector for treating yolk-like macular degeneration. Aspects of the present disclosure relate to methods and compositions useful for the treatment of yolk-like macular dystrophy, such as yolk-like macular degeneration.

Description

[0001] This application is a divisional application of a Chinese patent application with an application date of August 30, 2019, an application number of 201980067514.X, and an invention title of "Adeno-associated virus vector for treating vitelliform macular degeneration".

[0002] Cross-reference to related applications

[0003] This application claims the benefit of the filing dates of U.S. Provisional Application No. 62 / 726,184, filed on August 31, 2018, U.S. Provisional Application No. 62 / 749,622, filed on October 23, 2018, and U.S. Provisional Application No. 62 / 754,530, filed on November 1, 2018, the entire contents of each of which are incorporated herein by reference.

[0004] Government support

[0005] This invention was made with government support under Grant No. EY021721 awarded by the National Institutes of Health. The government has certain rights in this invention. Background art

[0006] Mutations in the BEST1 gene (also known as VMD2) cause several forms of retinal degeneration, including Best vitelliform macular dystrophy, also known as vitelliform macular degeneration (Best Disease, which may also be referred to as Best macular dystrophy, vitelline dystrophy, and vitelliform macular dystrophy). Bestrophinopathy is caused by more than 200 different mutations in the human BEST1 gene, which encodes a protein (bestrophin or BEST1) that functions as a calcium-dependent chloride channel associated with the basolateral membrane of the retinal pigment epithelium. In bestrophinopathy, defective fluid transport across the RPE impairs the interaction between the RPE and photoreceptor cells. This impairment leads to detachment of the retina from its supporting layer and the accumulation of oxidized proteolipids (lipofuscin) in the RPE and subretinal space. Eventually, photoreceptors in the macular region, which is primarily responsible for central vision, become inactive. In humans, BEST1 mutations are typically autosomal dominant, meaning that a single defective copy causes the disease regardless of the presence of a normal (wild-type) gene inherited from the other parent. However, autosomal recessive bestrophinopathy (ARB) has also been reported.

[0007] As a rare disease, vitelliform macular degeneration is a slowly progressive macular dystrophy that typically begins in childhood and sometimes in late adolescence. Affected individuals initially have normal vision, followed by a decline in central visual acuity and metamorphopsia. Individuals retain normal peripheral vision and dark adaptation. A yolk-like mass forms on the macula in the individual. The mass eventually ruptures and spreads across the macula, leading to a decline in central vision. Vitelliform macular degeneration can be diagnosed based on family history or ophthalmological examinations (e.g., fundus findings or electrooculogram (EOG)).

[0008] Inherited retinal degeneration (IRD) encompasses a large group of blinding disorders with molecular heterogeneity and pathophysiological differences. Genetic defects typically act primarily on rod or cone photoreceptors (PRs), or both, and specific defects can involve phototransduction, ciliary transport, morphogenesis, neurotransmission, or others. Less commonly, primary defects involving the retinal pigment epithelium (RPE) have received increasing attention due to promising clinical trials.

[0009] The most common IRD caused by primary RPE defects is caused by mutations in BEST1, which encodes a transmembrane protein associated with the basolateral part of the RPE. BEST1 (Bestrophin) is a multifunctional channel protein responsible for mediating transepithelial ion transport, regulating intracellular calcium signaling and RPE cell volume, and regulating the homeostatic environment in the subretinal space. In eukaryotic cells, BEST1 forms a stable pentamer through four transmembrane helices, cytoplasmic N- and C-termini, and a continuous central pore sensitive to calcium-dependent control of chloride permeability.

[0010] In humans, BEST1 mutations lead to a variety of widespread IRDs, collectively grouped as vitelliform macular dystrophy, which typically involves specific macular lesions. Despite the presence of panretinal electrophysiological defects in the EOG, retinal regions distant from the lesions tend to show very normal, reflecting abnormalities in the standing potential of the eye. Naturally occurring bi-allelic mutations in the canine BEST1 gene (cBEST1) result in canine IRD with significant phenotypic similarities to both the dominant and recessive forms of human vitelliform macular dystrophy, including a marked preference of subretinal lesions for the fovea-like area of the dog.

[0011] Proper anatomical juxtaposition and continuous interaction between the apical microvilli (MVs) of the RPE and the outer segments (OSs) of the PRs are thought to be crucial for normal vision. Both the ion composition and volume regulation of the subretinal space are essential for maintaining the precise molecular proximity of this complex and the homeostasis of the RPE-PR interface. In vitro and ex vivo studies have long shown that genetic mutations, metabolic perturbations, and light stimulation alter the ion composition of the subretinal space and the physiological responses of the RPE and / or PRs. More recently, in vivo studies of the microanatomy of the outer retina in health and disease and its response to light have become increasingly informative with modern retinal imaging modalities.

[0012] Mutations in the BEST1 gene cause retinal detachment and photoreceptor (PR) cell degeneration due to a primary channelopathy in adjacent retinal pigment epithelial (RPE) cells. The pathophysiology of the interaction between RPE and PR cells before the formation of retinal detachment remains poorly understood. SUMMARY OF THE INVENTION

[0013] Some aspects of the present disclosure relate to compositions for treating vitelliform macular dystrophy (e.g., Best vitelliform macular dystrophy) in a subject (e.g., in a human). Some aspects of the present disclosure are designed to inhibit the expression of endogenous BEST1 mRNA (e.g., both mutant and normal copies). In some embodiments, RNA interference is used to inhibit expression. In some embodiments, endogenous BEST1 mRNA is simultaneously replaced with normal BEST1 mRNA to produce only normal protein. In some embodiments, adeno-associated virus (AAV) is used to deliver a copy of the BEST1 gene without introns plus a short hairpin RNA (shRNA) gene, which results in the production of small interfering RNA (siRNA).

[0014] In some embodiments, one or both alleles of the BEST1 gene in a subject (e.g., a human) are silenced by administering a short hairpin RNA (shRNA) molecule to the subject (e.g., to a subject with vitelliform macular degeneration, e.g., to a human with vitelliform macular degeneration). In some embodiments, a replacement BEST1 coding sequence is also administered to the subject to provide a protein of functional bestrophin, e.g., to restore photoreceptor function in the subject. In some embodiments, the replacement BEST1 coding sequence has one or more nucleotide substitutions relative to one or more endogenous gene alleles, which renders the replacement gene resistant to the action of interfering RNA. In some embodiments, the replacement BEST1 coding sequence is a human BEST1 coding sequence (e.g., wild-type human BEST1 coding sequence) that contains one or more (e.g., 1, 2, 3, 4, 5, or more) substitutions to render the gene resistant to shRNA-mediated degradation. In some embodiments, the replacement BEST1 coding sequence contains one or more silent mutations (base changes in the third position of the codon) in the target site to render the gene "off-target" for shRNA-mediated degradation.

[0015] In some aspects, the present disclosure provides short hairpin RNAs (shRNAs) that include a sense strand containing the nucleotide sequence CGUCAAAGCUUCACAGUGU (SEQ ID NO:2), an antisense strand containing the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO:3), and a loop. In some embodiments, the loop contains the nucleotide sequence UUCAAGAGA (SEQ ID NO:7).

[0016] In some aspects, the present disclosure provides short hairpin RNAs (shRNAs) that include a sense strand containing the nucleotide sequence GCUGCUAUAUGGCGAGUUCUU (SEQ ID NO:6), an antisense strand containing the nucleotide sequence AAGAACUCGCCAUAUAGCAGC (SEQ ID NO:5), and a loop. In some embodiments, the loop contains the nucleotide sequence CUCGAG (SEQ ID NO:8).

[0017] In some embodiments, the present disclosure provides short hairpin RNAs (shRNAs) that include an antisense strand containing the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO:3).

[0018] In some aspects, the present disclosure provides vectors that include a genetic sequence encoding the shRNAs described in the previous paragraphs.

[0019] In some aspects, the present disclosure provides vectors that further include a recombinant functional (e.g., wild-type) BEST1 coding sequence that does not include a sequence targeted by the shRNA. In some aspects, the vector further includes a recombinant functional BEST1 coding sequence that has been codon-optimized for expression in human cells.

[0020] In some aspects, the present disclosure provides vectors that include a recombinant BEST1 coding sequence that includes a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO:9. In some aspects, the present disclosure provides vectors that include a recombinant BEST1 coding sequence that includes a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO:10.

[0021] In some aspects, the present disclosure provides vectors that are plasmid or viral vectors. In some aspects, the viral vector is a recombinant adeno-associated virus (rAAV) vector. In some aspects, the rAAV vector is self-complementary.

[0022] In some aspects, the present disclosure provides rAAV viral particles, which are AAV serotype 2 viral particles.

[0023] In some aspects, the present disclosure provides a composition comprising a vector or rAAV particles and a pharmaceutically acceptable carrier.

[0024] In some aspects, the present disclosure provides a method of modulating BEST1 expression in a subject, the method comprising administering to the subject (e.g., a human subject) a composition comprising a vector or rAAV particles and a pharmaceutically acceptable carrier. In some aspects, the present disclosure provides a method of treating vitelliform macular dystrophy (e.g., vitelliform macular degeneration and ARB) in a subject, the method comprising administering the composition.

[0025] In some embodiments, a vector encoding a functional BEST1 sequence is provided to supplement or correct (e.g., at least partially supplement or correct) cellular BEST1 function without knocking down endogenous BEST1 gene expression. In some embodiments, the BEST1 sequence is codon-optimized.

[0026] In some embodiments, a vector encoding a functional BEST1 sequence is provided to supplement or correct (e.g., at least partially supplement or correct) cellular BEST1 function, and an shRNA sequence is provided to knock down endogenous BEST1 gene expression. In some embodiments, endogenous Best1 expression is knocked down using shRNA. In some embodiments, the BEST1 sequence is codon-optimized. In some embodiments, the BEST1 sequence is modified to be resistant to shRNA. In some embodiments, the BEST1 and shRNA sequences are encoded on the same AAV vector.

[0027] In some aspects, the present disclosure provides a composition for treating vitelliform macular degeneration and a composition for manufacturing a medicament for treating vitelliform macular degeneration. In some aspects, the present disclosure provides a composition comprising a vector or rAAV particles (wherein the vector encodes a functional BEST1 sequence) for treating ARB and a composition for manufacturing a medicament for treating ARB.

[0028] These and other aspects are described in the following figures, examples, and appended claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The following figures form a part of this specification and are included to further illustrate certain aspects of the present disclosure, which can be better understood by referring to one or more of these figures in combination with the detailed description of the specific embodiments given herein. It should be understood that the data shown in the figures in no way limit the scope of the present disclosure.

[0030] Figures 1A to 1D Shows the full retinal pathology of RPE apical microvilli projections associated with BEST1 mutations in dogs. Figure 1A and 1B Shows confocal images illustrating the molecular pathology of cBest (R25* / R25*; 89 weeks) compared to wild type ( Figure 1A )(42 weeks)( Figure 1B ). Retinal cryosections were immunolabeled with anti-EZRIN and human cone arrestin and combined with peanut agglutinin lectin and DAPI labeling. Figure 1C Shows representative micrographs of 6-week-old canine wild type and cBest mutant (R25* / P463fs) retinas immunolabeled with anti-BEST1 and anti-SLC16A1. White arrows point to a subset of cone-MVs. Figure 1D Shows the quantification of cone-MV numbers on the retina between cBest mutants and age-matched control eyes. The y-axis represents the mean number of cone-MVs per square millimeter for each color-coded retinal region examined. Abbreviations: H&E, hematoxylin & eosin staining; PRL, photoreceptor IS / OS layer; i, inferior; N, nasal; S, superior; T, temporal.

[0031] Figures 2A to 2F Shows the changes in light-mediated outer retinal structures in wild type and cBest (R25* / P463fs) mutants. Figure 2A Shows cross-sectional imaging along the horizontal meridian through the central region (fovea-like region) of the center in 15-week-old normal (WT) dogs and 11-week-old cBest (R25* / P463fs) in less and more light adaptation (LA) conditions. Thin white arrows indicate the superior temporal position of the OCT. Figure 2B Shows the longitudinal reflectivity profile (LRP) (mean 85 single LRP) at 3° nasal from the fovea-like region (T, temporal retina) and the nasal edge of the optic nerve head (N, nasal retina) in WT dogs (12 eyes, 15 to 17 weeks old) compared to cBest-treated dogs (6 eyes, 11 weeks old) in less and more LA conditions. Arrows indicate the IS / OS and RPE / T peaks; single and double arrows mark additional hyporeflective layers in cBest. Figure 2C Shows the distance between the IS / OS and RPE / T peaks in WT and cBest eyes under two LA conditions. Symbols with error bars represent the mean distance (±2SD) at two positions for each group of eyes. Figure 2DSchematic description of dark adaptation and light adaptation protocols. Animals were dark adapted (D / A) overnight and imaged by OCT. Then, five levels of increased light exposure (L1 to L5) were used. Figure 2D Also shown are magnified views of OCT scans in cBest with overlapping LRP after overnight dark adaptation (left) and after maximum light exposure (right). Figure 2E Results are shown using a simplified protocol involving only L4 and L5 exposures in different subgroups of cBest eyes (n = 3; colored traces). Figure 2F Shown is the spatial topographic map of the distance from the IS / OS to the RPE / T in average WT compared to two representative cBest eyes [group; EM356 - OS: 297 - week - old cmr1 / cmr3 (R25* / P463fs); LH30 - OD: 12 - week - old cmr3 (P463fs / P463fs)].

[0032] Figures 3A to 3D Shown is that enhanced BEST1 gene therapy in cBest mutants results in the continuous reversal of foveal macular lesions and the restoration of the RPE - PR interface structure. Figure 3A Shown is the natural history of subretinal detachment recorded by in - vivo imaging in the right eye of a cBest dog (EM356 - OD; R25* / P463fs) at three time points. The inset shows autofluorescence and OCT images. Figure 3B Shown is in Figure 3A Fundus images taken before (at 52 weeks of age) and after subretinal injection of AAV2 - cBEST1 (1.5×10 10 vg / mL) in the eyes shown. The subretinal bleb area is indicated by a dashed circle. Images taken at 43 and 245 weeks after injection document the continuous reversal of the central lesion and the fully re - attached retina within the treated area. The middle and right insets show autofluorescence and OCT images. Figure 3C and 3D Shown is the restoration of the RPE - photoreceptor interface structure after AAV - hBEST1 treatment in the cBest (R25* / R25*) model compared to controls. The bleb boundary is marked by a dashed circle; the positions of the corresponding OCT scans piercing the subretinal lesion before injection or passing through the matching location mapped after injection are marked by horizontal lines; the retinotomy site is indicated by an arrow.

[0033] Figures 4A to 4F Shown is the reversal of micro - detachments over the retinal area after subretinal gene therapy in cBest mutant dogs [cmr1 (R25* / R25*), cmr1 / cmr3 (R25* / P463fs) or cmr3 (P463fs / P463fs)] injected subretinally with BSS or AAV - hBEST1.Figure 4A Figure showing the topographic maps of the IS / OS-RPE / T distances in subretinally injected cBest mutant dogs [cmr1(R25* / R25*), cmr1 / cmr3(R25* / P463fs), or cmr3(P463fs / P463fs)] with BSS or AAV-hBEST1. The treatment boundaries are based on fundus photographs of the blebs taken at the time of injection (dashed lines) and, if visible, on the demarcation evident at the time of imaging (dashed lines). All eyes are shown as equivalent right eyes with the optic nerve and large blood vessels (black), the retinal pigment epithelium border (white), and the fovea-like region (white ellipse) superimposed for easy comparison. Figure 4B Figure showing the differences in IS / OS-RPE / T distances from WT at the upper and lower retinal positions within the treated bleb (Tx; solid symbols) and untreated outer bleb (control; open symbols) regions in cBest eyes. The dashed lines demarcate the 95th percentile of normal variability. Topographic maps of the IS / OS-RPE / T distances are shown before treatment (left) and after treatment (right). Figure 4C and 4E Grayscale map depicting the differences between each cBest eye and the mean WT control. White represents severe retinal detachment. Figure 4D and 4F Respectively show the measurements of the co-localization differences in IS / OS-RPE / T distances between WT and cBest before (PreTx) and after (Tx) treatment for the eyes shown in Figure 4C and 4E .

[0034] Figures 5A to 5G Figure showing the retinal localization phenotypes in two human subjects with ARB. Figure 5A Figure showing RPE health across the entire retina in two ARB patients P1 and P2 imaged using short-wavelength reduced-illuminance autofluorescence imaging (SW-RAFI) with the native RPE fluorophore lipofuscin. White arrows show the positions of the peripheral contour and OCT scans; the rectangle shows the target regions shown in other figures; and the black arrow demarcates the disease-to-healthy transition in the nasal mid-peripheral retina. Figure 5B Figure showing the peripheral light sensitivity of rods (upper) in dark-adapted eyes and cones (lower) in light-adapted eyes measured across the entire horizontal meridian. The gray area represents normal sensitivity except for the physiological blind spot corresponding to the optic nerve head (ONH). Figure 5C Figure showing a retinal cross-section with OCT across the fovea along the horizontal meridian. Figure 5D and 5Eshows details of outer retinal layer lamination in a patient at two target regions in the parapapillary retina ( Figure 5D ) and the intermediate peripheral nasal retina ( Figure 5E ) compared to a normal patient. Colors indicate interfaces adjacent to the tips of the COS and adjacent to the tips of the ROS and the apical processes of the RPE, and the bricks indicate interfaces adjacent to the RPE and Bruch's membrane. Figure 5F and 5G show the dark adaptation kinetics measured at the parapapillary site in P1 ( Figure 5F ) and at the nasal intermediate peripheral site in P2 ( Figure 5G ). Time zero refers to the end of the adapting light.

[0035] Figures 6A to 6D shows the RPE-PR interdigitation zone in a CNGB3-related achromatopsia (ACHM3) canine model. Figure 6A and 6B show representative fluorescence microscopy images of 6-week-old CNGB3-D262N-mutant ( Figure 6A ) and CNGB3-null ( Figure 6B ; CNGB3 - / - ) retinas, indicating that the normal expression of BEST1 is restricted to the basolateral plasma membrane of RPE cells and SLC16A1 (a marker labeling the apical processes of the RPE). Arrows point to a subset of cone-related RPE apical microvilli (c-MV). Figure 6A and 6B also show co-labeling of anti-CNGB3 and anti-EZRIN, with age-matched wild-type retinas shown for reference. Figure 6C and 6D show immunohistochemical evaluation of the RPE-PR interface in CNGB3 mutant retinas from 85-week-old ( Figure 6C ) and 57-week-old ( Figure 6D ) affected dogs. The apical surface of the RPE and its microvillar extensions are immunolabeled with EZRIN, and a subset of c-MV is indicated by arrows. Abbreviations: ACHM3, achromatopsia type 3; cCNGB3, canine CNGB3 gene; c-MV, cone-related RPE apical microvilli; CNGB3, cyclic nucleotide-gated channel beta 3 protein; hCAR, human cone arrestin; SLC16A1, solute carrier family 16 member 1.

[0036] Figure 7 shows the recovery of light-mediated microdissection. Two cBest-affected (R25* / P463fs) eyes [43 (right) and 52 (left) weeks old] were dark adapted overnight and imaged similar to the results shown in Figure 2A .

[0037] Figures 8A to 8B Shows the ultrathick ONL at the retinal region with micropeeling in the cBest eye and its correction under gene therapy. Figure 8A Shows the untreated cBest eye (shown as an IS / OS-RPE / T thickness map in Figures 2A to 2F and Figures 4A to 4F ) exhibiting an ultrathick ONL corresponding to a large area of retinal micropeeling, and a local thinning of the ONL above and adjacent to the fovea-like region in some eyes over severe lesions. Figure 8B Shows the treated cBest eye (shown as an IS / OS-RPE / T thickness map in Figures 4A to 4F ) exhibiting a normal ONL thickness in the AAV-treated area surrounded by ultrathick, normal, or thinned ONL in the untreated area. OD, right eye; OS, left eye.

[0038] Figures 9A to 9F Shows the evolution of focal macular lesions in cBest-affected (R25* / P463fs) dogs (EM356-OS). Figure 9A Shows the progression of the discrete separation of the photoreceptor layer from the underlying RPE into a large subretinal macroscopic peeling (vitelliform lesion), and Figure 9B shows the corresponding OCT scan at 23 weeks of age. Figure 9C Shows the initial signs of the accumulation of hyperautofluorescent material within the subretinal lesion observed after 8 weeks (31 weeks; early pseudopurulent lesion). Figure 9D Shows that at 66 weeks of age, a typical pseudopurulent appearance was recorded, followed by vitelline rupture-like lesions and the dispersion of autofluorescent material at 172 and 297 weeks of age (inset, close-up). Figure 9E and 9F Shows that the significant thinning of the ONL becomes apparent by OCT scan. The dark line demarcates the position of the corresponding SD-OCT scan.

[0039] Figure 10 Shows retinal protection after AAV-hBEST1 treatment in three cBest models [cmr1(R25* / R25*), cmr1 / cmr3(R25* / P463fs), and cmr3(P463fs / P463fs)] compared to wild-type controls and untreated cBest eyes.

[0040] Figures 11A to 11D Shows the dose-response effect of BEST1 transgene expression on RPE cytoskeleton rescue in the cBest (R25* / P463fs) retina. Figure 11AShows a cross-sectional overview from the surgical bleb region (left), through the adjacent penumbra region (middle), and towards a continuous range outside the injection region (right). Figure 11B Shows a significant extension of the RPE apical projection within the treated region with enhanced BEST1; Figure 11C Shows the presence of residual microvilli and rod-MV in the bleb penumbra associated with the punctate distribution of BEST1 (weak signal within individual RPE cells) and RPE-PR microdissection; Figure 11D Shows the formation of subretinal lesions outside the treated region in the absence of both BEST1 expression and RPE apical protrusions.

[0041] Figures 12A to 12B Shows the interocular symmetry of rod and cone function in patients P1 ( Figure 12A ) and P2 ( Figure 12B ) with ARB. Rod sensitivity loss (RSL) and cone sensitivity loss (CSL) plots for both eyes of two patients with ARB.

[0042] Figure 13 Shows a diagram of the 6262bp plasmid pTR-VMD2-hBest human bestrophin.

[0043] Figure 14 Shows a diagram of the 6222bp plasmid pTR-VMD2-cBest canine bestrophin.

[0044] Figure 15 Shows a diagram of the 6209bp plasmid pTR-SB-VMD2-HBest1-shRNA05, which contains resistant Best1.

[0045] Figure 16 Shows a diagram of the 6145bp plasmid pTR-SB-VMD2-DTBest1-shRNA744, which contains off-target Best1.

[0046] Figure 17 Shows that the VMD2 promoter functions well in cell culture. HEK293T cells were transfected with plasmids expressing GFP or Best1 using the chicken beta actin (CBA) promoter or the VMD2 promoter. Protein lysates were separated on polyacrylamide gels, and the expression of bestrophin (Best1) was detected by Western blotting and normalized to the expression of beta-tubulin to show equal gel loading.

[0047] Figures 18A to 18B Shows that Best1-specific siRNA is functional. Western blot (Figure 18A ) The band intensities shown and quantified as bar graphs in Figure 18B ) indicate that transfection of HEK293T stably expressing BEST1 resulted in a 75% reduction in bestrophin (Best1) protein.

[0048] Figures 19A to 19B Shown is that Best1 shRNA is active: HEK293T - BEST1 cells were transfected with 4 μg of the indicated plasmid.

[0049] Figure 20 Shown is off - target of Best1. Silent mutations (base changes at the third position of the codon) were used to remove the siRNA target site from Best1 mRNA. The disclosed example is directed to shRNA744. SEQ ID NO: 15 to 17 correspond to the sequences from top to bottom: wild - type BEST1 target site; (complementary sequence) shRNA744 target site and off - target DTBEST1 siRNA target site. Detailed Description

[0050] Some aspects of the present application provide methods and compositions useful for treating vitelliform macular degeneration in a subject (e.g., in a human subject suffering from vitelliform macular degeneration).

[0051] In some embodiments, the present disclosure provides methods and compositions for delivering a functional bestrophin protein to a subject having one or more mutant BEST1 genes. In some embodiments, a recombinant BEST1 gene (e.g., a coding sequence, e.g., cDNA or open reading frame) is provided in a viral vector (e.g., an rAAV vector). In some embodiments, the expression of one or both alleles of the endogenous BEST1 gene is also knocked down. For example, in some embodiments, siRNA (e.g., shRNA) is delivered to the subject together with the recombinant BEST1 gene. In some embodiments, the viral vector (e.g., an rAAV vector) encodes both the recombinant BEST1 gene and one or more siRNAs targeting the endogenous BEST1 gene. In some embodiments, the recombinant BEST1 gene is modified to include one or more nucleotide substitutions to render it resistant to targeting by one or more siRNAs. In some embodiments, the recombinant BEST1 gene is codon - optimized (e.g., for expression in a subject (e.g., in a human subject)).

[0052] In some embodiments, the present disclosure provides short hairpin RNAs (shRNAs) that include a sense strand having the nucleotide sequence CGUCAAAGCUUCACAGUGU (SEQ ID NO:2), an antisense strand having the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO:3), and a loop. In some embodiments, the loop includes the nucleotide sequence UUCAAGAGA (SEQ ID NO:7).

[0053] In other embodiments, the present disclosure provides short hairpin RNAs (shRNAs) that include a sense strand having the nucleotide sequence GCUGCUAUAUGGCGAGUUCUU (SEQ ID NO:6), an antisense strand having the nucleotide sequence AAGAACUCGCCAUAUAGCAGC (SEQ ID NO:5), and a loop. In some embodiments, the loop includes the nucleotide sequence CUCGAG (SEQ ID NO:8).

[0054] In some embodiments, the present disclosure provides short hairpin RNAs (shRNAs) that include an antisense strand having the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO:3).

[0055] In some embodiments, a vector can be used to deliver the shRNA as an shRNA driven by a promoter (e.g., the human H1 RNA promoter). In some embodiments, the vector is a plasmid. In some embodiments, the vector is a viral vector, such as an adeno-associated virus (AAV) vector. In some embodiments, the vector is a double-stranded or self-complementary AAV vector. In some embodiments, the vector sequence encoding the shRNA includes a BEST1 sequence.

[0056] Thus, in some embodiments, the shRNA can be encoded by a nucleic acid having the sequence CCGTCAAAGCTTCACAGTGT TTCAAGAGA ACACTGTGAAGCTTTGACG (SEQ ID NO:18) on a DNA vector (e.g., a viral vector), where the loop sequence is underlined. In some embodiments, different loop sequences replace the loop sequence shown in SEQ ID NO:7.

[0057] Additionally, in some embodiments, the shRNA can be encoded by a nucleic acid having GCTGCTATATGGCGAGTTCTT CTCGAGThe nucleic acid of the AAGAACTCGCCATATAGCAGC (SEQ ID NO:19) sequence is encoded on a DNA vector (e.g., a viral vector), where the loop sequence is underlined. In some embodiments, different loop sequences replace the loop sequence shown in SEQ ID NO:8.

[0058] In some embodiments, the same vector contains a coding sequence that encodes a normal (e.g., wild-type) Best1 protein but is resistant to the action of the shRNA expressed by the vector.

[0059] In some embodiments, the BEST1 coding sequence comprises a sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to SEQ ID NO:9.

[0060] In some embodiments, the BEST1 coding sequence comprises a sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to SEQ ID NO:10. In some embodiments, the BEST1 coding sequence comprises a sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to SEQ ID NO:11.

[0061] In some embodiments, the BEST1 coding sequence comprises a sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to SEQ ID NO:15.

[0062] The 1757-bp wild-type BEST1 sequence is defined as follows (SEQ ID NO:9):

[0063]

[0064] In some embodiments, the BEST1 coding sequence comprises short off-target sequences corresponding to regions of the wild-type BEST1 gene. Exemplary off-target sequences that can be used with the vector sequence encoding the shRNA744 sequence are defined as follows (SEQ ID NO:10): CTACTGTACGGAGAATTTCT

[0065] Other nucleotide substitutions can be made to make the BEST1 sequence off-target. For example, in some embodiments, the off-target sequences are at different positions on the BEST1 coding sequence and correspond to different regions of the wild-type BEST1 gene. Exemplary off-target sequences that can be used with the vector sequence encoding the shRNA05 sequence are defined below (SEQ ID NO:11): CCAGCAAGCTGCACAGCGT.

[0066] In some embodiments, an shRNA (e.g., shRNA05) encoded by a nucleic acid comprising the sequence of SEQ ID NO:1 (and / or its complementary sequence) is transcribed in a host cell treated with the vector (e.g., in a subject, e.g., in a human subject). In some embodiments, two or more different shRNAs (e.g., having different start and / or stop sites, e.g., differing from shRNA05 by one or two additional or fewer nucleotides) are transcribed in the host cell.

[0067] In some embodiments, the BEST1 coding sequence is driven by a promoter (e.g., the human rhodopsin proximal promoter). In some embodiments, the promoter comprises a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the following SEQ ID NO:12.

[0068] In some embodiments, the promoter driving shRNA expression comprises a sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the following SEQ ID NO:13. In some embodiments, the promoter driving shRNA expression comprises a sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the following SEQ ID NO:14.

[0069] The sequences of exemplary promoters are as follows:

[0070] VMD2 promoter, 623bp fragment (SEQ ID NO:12)

[0071]

[0072] H1 promoter (SEQ ID NO:13)

[0073]

[0074] U6 promoter (SEQ ID NO:14)

[0075]

[0076] In some embodiments, the BEST1 coding sequence is in a vector such as an AAV vector or a plasmid.

[0077] In some embodiments, the vectors described herein comprise a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the off-target BEST1 sequence SEQ ID NO:10.

[0078] In some embodiments, vectors encoding a functional BEST1 sequence are provided to supplement or correct (e.g., at least partially supplement or correct) cellular BEST1 function without knocking down endogenous BEST1 gene expression. In some embodiments, the BEST1 sequence is codon-optimized.

[0079] In some embodiments, vectors encoding a functional BEST1 sequence and an shRNA sequence are provided to supplement or correct (e.g., at least partially supplement or correct) cellular BEST1 function and to knock down endogenous BEST1 gene expression. In some embodiments, endogenous Best1 expression is knocked down using shRNA. In some embodiments, the BEST1 sequence is codon-optimized. In some embodiments, the BEST1 sequence is modified to be resistant to shRNA. In some embodiments, the BEST1 and shRNA sequences are encoded on the same AAV vector.

[0080] In some embodiments, the present disclosure provides methods of modulating BEST1 expression in a subject, the methods comprising administering to the subject (e.g., a human subject) a composition comprising a vector or rAAV particle and a pharmaceutically acceptable carrier. In some aspects, the present disclosure provides methods of treating vitelliform macular dystrophy (e.g., vitelliform macular degeneration and ARB) in a subject, the methods comprising administering a composition.

[0081] In some embodiments, the present disclosure provides compositions for treating vitelliform macular degeneration and compositions for making a medicament for treating vitelliform macular degeneration. In some aspects, the present disclosure provides compositions comprising a vector or rAAV particle for treating ARB (wherein the vector encodes a functional BEST1 sequence) and compositions for making a medicament for treating ARB.

[0082] Some aspects of the present disclosure relate to recombinant adeno-associated virus (rAAV) particles for delivering rAAV vectors (e.g., encoding shRNA and / or alternative BEST1) as described herein to a variety of tissues, organs, and / or cells. In some embodiments, the rAAV particles comprise a capsid protein as described herein, such as an AAV2 capsid protein. In some embodiments, the vector contained within the rAAV particle encodes a RNA of interest (e.g., an shRNA comprising the sequence of SEQ ID NO:1) and comprises an alternative BEST1 coding sequence (e.g., comprising the sequence of SEQ ID NO:10).

[0083] The recombinant AAV (rAAV) vector contained within the rAAV particle can comprise at least (a) one or more heterologous nucleic acid regions (e.g., encoding shRNA and / or Best1 protein) and (b) one or more regions comprising inverted terminal repeat (ITR) sequences (e.g., wild-type ITR sequences or engineered ITR sequences) (or transgenes) flanking the one or more heterologous nucleic acid regions. In some embodiments, the heterologous nucleic acid region encodes a RNA of interest (e.g., an shRNA comprising the sequence of SEQ ID NO:3) and comprises an alternative BEST1 coding sequence (e.g., comprising the sequence of SEQ ID NO:10). In some embodiments, the size of the rAAV vector is from 4 kb to 5 kb (e.g., from 4.2 to 4.7 kb). The rAAV vector can be encapsidated by a viral capsid (e.g., an AAV2 capsid). In some embodiments, the rAAV vector is single-stranded. In some embodiments, the rAAV vector is double-stranded. In some embodiments, the double-stranded rAAV vector can be, for example, a self-complementary vector that comprises another vector region complementary to a region of the vector, thereby causing the formation of double-strandedness of the vector.

[0084] As disclosed herein, analysis of the Best1 structure with targeted mutations indicates that the loss of apical microvilli of the retinal pigment epithelium and the resulting microdetachment of the retina represent the earliest features of canine vitelliform macular dystrophy. Retinal light exposure enlarges the microdetachment, and dark adaptation reduces the microdetachment. Subretinal adeno-associated virus-based gene therapy corrected both the vitelliform lesion and the light-modulated microdetachment.

[0085] Molecular pathological studies in a canine BEST1 disease model revealed pan-retinal abnormalities associated with defects in ensheathment of RPE microvilli at the RPE-PR interface and insoluble photoreceptor inter-stromal related to cone PR. In vivo imaging demonstrated pan-retinal RPE-PR microdetachment, which contracted with dark adaptation and extended after exposure to moderate-intensity light. Subretinal BEST1 gene augmentation therapy using adeno-associated virus 2 not only reversed clinically detectable subretinal lesions but also diffuse microdetachment. Immunohistochemical analysis showed correction of structural alterations at the RPE-PR interface in areas with BEST1 transgene expression. Successful therapeutic effects were demonstrated in three different canine BEST1 genotypes, where vector titers ranged from 0.1×10 11 to 5×10 11 vector genomes / ml. Patients with biallelic BEST1 mutations exhibited large areas of retinal lamination defects, severe loss of PR sensitivity, and slowed retinoid cycling. Human translation of canine BEST1 gene therapy successfully reversed macrodetachment and microdetachment by restoring cellular architecture at the RPE-PR interface, with the prospect of leading to improved visual function and preventing disease progression in patients with vitelliform macular dystrophy.

[0086] As further disclosed herein, it was found that adeno-associated virus (AAV) 2-mediated BEST1 gene augmentation corrected this major subclinical defect as well as the disease.

[0087] The rAAV particle can be any AAV serotype, including any derivative or pseudotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 2 / 1, 2 / 5, 2 / 8, or 2 / 9). As used herein, the serotype of the rAAV particle refers to the serotype of the capsid protein. In some embodiments, the rAAV particle is AAV2. Some non-limiting examples of derivatives and pseudotypes include rAAV2 / 1, rAAV2 / 5, rAAV2 / 8, rAAV2 / 9, AAV2-AAV3 hybrid, AAVrh.10, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y731F), AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShH10, AAV2(Y->F), AAV8(Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45. Such AAV serotypes and derivatives / pseudotypes, and methods for generating such derivatives / pseudotypes, are known in the art (see, e.g., Mol Ther. 2012 Apr;20(4):699-708. doi:10.1038 / mt.2011.287. Epub Jan 24, 2012. The AAV vector toolkit: poised at the clinical crossroads. Asokan A1, Schaffer DV, Samulski RJ.). In some embodiments, the rAAV particle is a pseudotyped rAAV particle that comprises: (a) a nucleic acid vector containing ITRs from one serotype (e.g., AAV2), and (b) a capsid containing capsid proteins derived from another serotype (e.g., AAV5). Methods for generating and using pseudotyped rAAV vectors are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671, 2001; Halbert et al., J. Virol., 74:1524-1532, 2000; Zolotukhin et al., Methods, 28:158-167, 2002; and Auricchio et al., Hum. Molec. Genet., 10:3075-3081, 2001).

[0088] Methods for generating rAAV particles and rAAV vectors are also known in the art and are commercially available (see, e.g., Zolotukhin et al. Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28 (2002) 158-167; and U.S. Patent Publications No. US2007 / 0015238 and US2012 / 0322861, which are incorporated herein by reference; and plasmids and kits available from ATCC and Cell Biolabs, Inc.). For example, a plasmid containing an rAAV vector can be combined with one or more helper plasmids (e.g., containing the rep gene (e.g., encoding Rep78, Rep68, Rep52, and Rep40) and the cap gene (e.g., encoding VP1, VP2, and VP3, including the modified VP3 region as described herein)) and transfected into a production cell line such that rAAV particles can be packaged and subsequently purified.

[0089] In some embodiments, one or more helper plasmids include a first helper plasmid comprising a rep gene and a cap gene (e.g., encoding an rAAV capsid protein as described herein) and a second helper plasmid comprising an E1a gene, an E1b gene, an E4 gene, an E2a gene, and a VA gene. In some embodiments, the rep gene is a rep gene derived from AAV2, and the cap gene is derived from AAV2 and may include modifications to the gene to produce a modified capsid protein as described herein. Helper plasmids and methods of preparing such plasmids are known in the art and are commercially available (see, e.g., the pDM, pDG, pDP1rs, pDP2rs, pDP3rs, pDP4rs, pDP5rs, pDP6rs, pDG(R484E / R585E), and pDP8.ape plasmids from PlasmidFactory, Bielefeld, Germany; other products and services, which are available from Vector Biolabs, Philadelphia, PA; Cellbiolabs, San Diego, CA; Agilent Technologies, Santa Clara, Ca; and Addgene, Cambridge, MA; pxx6; Grimm et al. (1998), Novel Tools for Production and Purification of Recombinant Adenoassociated Virus Vectors, Human Gene Therapy, Vol. 9, 2745-2760; Kern, A. et al. (2003), Identification of a Heparin-Binding Motif on Adeno-Associated Virus Type 2 Capsids, Journal of Virology, Vol. 77, 11072-11081; Grimm et al. (2003), Helper Virus-Free, Optically Controllable, and Two-Plasmid-Based Production of Adeno-associated Virus Vectors of Serotypes 1 to 6, Molecular Therapy, Vol. 7, 839-850; Kronenberg et al.(2005), A Conformational Change in the Adeno-Associated Virus Type 2 Capsid Leads to the Exposure of Hidden VP1 N Termini, Journal of Virology, Vol. 79, 5296 - 5303; and Moullier, P. and Snyder, R. O. (2008), International efforts for recombinant adeno-associated viral vector reference standards, Molecular Therapy, Vol. 16, 1185 - 1188).

[0090] Next, an exemplary and non-limiting method for generating rAAV particles is described. One or more helper plasmids are generated or obtained, which contain the rep and cap ORFs of the desired AAV serotype and the adenovirus VA, E2A (DBP), and E4 genes under the transcriptional control of their native promoters. The cap ORF may also contain one or more modifications to produce modified capsid proteins as described herein. HEK293 cells (available from Figure 13 , 14 , 15 or 16) are transfected by CaPO4-mediated transfection, lipids or polymer molecules such as polyethyleneimine (PEI) with one or more helper plasmids and a plasmid containing the heterologous nucleic acid vector described herein (e.g., a plasmid containing a heterologous nucleic acid containing the wild-type or mutant cBEST1 or hBEST1 gene as shown in ). Then the HEK293 cells are incubated for at least 60 hours to allow rAAV particle production. Alternatively, in another example, a Sf9-based stable production cell line is infected with a single recombinant baculovirus containing the nucleic acid vector. As another alternative, in another example, HEK293 or BHK cell lines are infected with HSV containing the nucleic acid vector and optionally one or more helper HSVs containing the rep and cap ORFs described herein and the adenovirus VA, E2A (DBP), and E4 genes under the transcriptional control of their native promoters. Then the HEK293, BHK, or Sf9 cells are incubated for at least 60 hours to allow rAAV particle production. Then the rAAV particles can be purified using any method known in the art or described herein, such as by iodixanol step gradient, CsCl gradient, chromatography, or polyethylene glycol (PEG) precipitation.

[0091] The present disclosure also contemplates host cells comprising shRNA, vectors, or rAAV particles as described herein. Such host cells include mammalian host cells, with human host cells being preferred and may be isolated, e.g., in cell or tissue culture. In some embodiments, the host cell is an eye cell.

[0092] In some aspects, the present disclosure provides formulations of one or more of the rAAV-based compositions disclosed herein in a pharmaceutically acceptable solution for administration to cells or animals, either alone or in combination with one or more other treatment modalities, and particularly for the treatment of human cells, tissues, and diseases affecting humans.

[0093] Accordingly, in some embodiments, there are provided compositions comprising shRNA, vectors, or rAAV particles as described herein and optionally a pharmaceutically acceptable carrier. In some embodiments, the compositions described herein can be administered to a subject in need of treatment. In some embodiments, the subject has or is suspected of having one or more conditions, diseases, or disorders of the brain and / or eye (e.g., vitelliform macular degeneration). In some embodiments, the subject has or is suspected of having one or more of the conditions, diseases, and disorders disclosed herein (e.g., vitelliform macular degeneration). In some embodiments, the subject has one or more endogenous mutant BEST1 alleles (e.g., associated with or causing a disease or disorder of the eye or retina). In some embodiments, the subject has at least one autosomal dominant mutant BEST1 allele (e.g., which causes vitelliform macular degeneration). In some embodiments, the subject is human. In some embodiments, the subject is a non-human primate. Some non-limiting examples of non-human primate subjects include macaques (e.g., cynomolgus or rhesus macaques), marmosets, tamarins, spider monkeys, owl monkeys, vervet monkeys, squirrel monkeys, baboons, gorillas, chimpanzees, and orangutans. Other exemplary subjects include domestic animals such as dogs and cats; livestock such as horses, cows, pigs, sheep, goats, and chickens; and other animals such as mice, rats, guinea pigs, and hamsters.

[0094] In some embodiments, the dose of rAAV particles administered to a cell or subject can be from about 10 6 to 10 14 particles / mL or 10 3 to 10 15 particles / mL, or any value between any of these ranges, e.g., about 10 6 、10 7 、10 8 、10 9 、10 10 、10 11 、1012 or 10 13 or 10 14 particles / mL. In one embodiment, rAAV particles are administered at a dose higher than 10 13 particles / mL. In some embodiments, the dose of rAAV particles administered to a subject can be from about 10 6 to 10 14 vector genomes (vg) / mL, or 10 3 to 10 15 vg / mL, or any value between any of these ranges, e.g., from about 10 6 to 10 7 to 10 8 to 10 9 to 10 10 to 10 11 to 10 12 to 10 13 or 10 14 vg / mL. In one embodiment, rAAV particles are administered at a dose higher than 10 13 vg / mL. Depending on what may be required to effect treatment of the particular disease or disorder being treated, the rAAV particles can be administered as a single dose or divided into two or more doses. In some embodiments, 0.0001 mL to 10 mL (e.g., 0.0001 mL, 0.001 mL, 0.01 mL, 0.1 mL, 1 mL, 10 mL) are delivered to the subject in one dose.

[0095] In some embodiments, the rAAV particle titer is from 1×10 10 to 5×10 13 vg / ml. In some embodiments, the rAAV particle titer can be about 1×10 10 to 2.5×10 10 to 5×10 10 to 1×10 11 to 2.5×10 11 to 5×10 11 to 1×10 12 to 2.5×10 12 to 5×10 12 to 1×10 13 to 2.5×10 13 to 5×10 13 vg / mL. In some embodiments, the particle titer is less than 1×10 10 vg / mL. In some embodiments, the rAAV particle titer is greater than 1×10 15 vg / mL. In some embodiments, the rAAV particle titer is greater than 5×10 13vg / mL. In some specific embodiments, the rAAV particle titer is about 2×10 11 or 2.5×10 11 . In some embodiments, the rAAV particles are administered by the methods further described herein (e.g., subretinally or intravitreally).

[0096] Depending on what is required for the treatment of the particular disease or disorder being treated, the rAAV particles can be administered as a single dose or divided into two or more administrations. In some embodiments, 1 to 500 microliters of the composition described herein (e.g., which contains rAAV particles) is administered to one or both eyes of a subject. For example, in some embodiments, about 1, about 10, about 50, about 100, about 200, about 300, about 400, or about 500 microliters can be administered to each eye. However, it should be understood that smaller or larger volumes can be administered in some embodiments.

[0097] If desired, the rAAV particles or nucleic acid carriers can also be administered in combination with other agents such as proteins or polypeptides or multiple pharmaceutically active agents, including one or more systemic or topical administrations of therapeutic polypeptides, bioactive fragments, or variants thereof. In fact, there are few limitations on the other components that can also be included, as long as the additional agent does not cause significant adverse effects when in contact with the target cells or host tissue. Thus, in certain cases, the rAAV particles can be delivered together with a variety of other agents as needed. Such compositions can be purified from host cells or other biological sources, or alternatively, can be chemically synthesized as described herein.

[0098] In other aspects, the present disclosure provides a formulation of one or more plasmids encoding shRNAs as disclosed herein in a pharmaceutically acceptable solution for administration to cells or animals, either alone or in combination with one or more other treatment modalities, and particularly for the treatment of human cells, tissues, and diseases affecting humans. The present disclosure also provides methods of administering plasmids encoding shRNAs as disclosed herein. Exemplary methods include methods of administering plasmids to mammals (e.g., humans).

[0099] In some embodiments, the disclosed plasmid formulations for administration to a mammal (e.g., a human) comprise a DNA plasmid vector in phosphate buffered saline (PBS). The concentration of the vector can be from 1 mg / ml to 3 mg / ml. In certain embodiments, the concentration is about 2 mg / ml. In other embodiments, the concentration is about 1.6 mg / ml, about 1.7 mg / ml, about 1.75 mg / ml, about 1.8 mg / ml, about 1.85 mg / ml, about 1.9 mg / ml, about 1.95 mg / ml, about 2.05 mg / ml, about 2.1 mg / ml, or about 2.15 mg / ml.

[0100] The formulation of pharmaceutically acceptable excipients and carrier solutions is well known to those skilled in the art, and the development of suitable dosing and treatment regimens for using the specific compositions described herein in a variety of treatment regimens, including, for example, oral, parenteral, intravenous, intranasal, intra-articular, and intramuscular administrations and formulations, is also well known to those skilled in the art.

[0101] Generally speaking, these formulations can contain at least about 0.1% of the therapeutic agent (e.g., rAAV particles or plasmids) or more, but the percentage of one or more active ingredients can of course vary and can conveniently be from about 1% or 2% to about 70% or 80% or more of the weight or volume of the total formulation. Naturally, the amount of one or more therapeutic agents (e.g., rAAV particles) in each therapeutically useful composition can be prepared in a manner that will result in a suitable dose in any given unit dose of the compound. Those skilled in the art of preparing such pharmaceutical formulations will consider, for example, solubility, bioavailability, biological half-life, route of administration, product shelf-life, and other pharmacological considerations, and thus a variety of dosages and treatment regimens can be desirable.

[0102] In certain cases, it is desirable to deliver the shRNA, vector, or rAAV particles as described herein in a properly formulated pharmaceutical composition subcutaneously, intravitreally, intravitreally, parenterally, subcutaneously, intravenously, intracerebroventricularly, intramuscularly, intrathecally, orally, intraperitoneally, by oral or nasal inhalation, or by direct injection directly into one or more cells, tissues, or organs via direct injection.

[0103] Pharmaceutical forms suitable for injectable use (e.g., comprising shRNA, vectors, or rAAV particles as described herein) include sterile aqueous solutions or dispersions. In some embodiments, the form is sterile and fluid to the extent that easy injectability exists. In some embodiments, the form is stable under the conditions of manufacture and storage, and is preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium that comprises, for example, water, saline, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and / or vegetable oils. Suitable fluidity can be maintained, for example, by the use of coatings such as lecithin, by maintaining the desired particle size in the case of dispersions, and by the use of surfactants.

[0104] The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the shRNA, vector, or rAAV particle described herein is administered. Such pharmaceutical carriers can be sterile liquids such as water and oils, including those of petroleum origin such as mineral oil; vegetable oils such as peanut oil, soybean oil, and sesame oil; animal oils; or oils of synthetic origin. Aqueous solutions of saline as well as glucose and glycerol can also be used as liquid carriers.

[0105] The compositions of the present disclosure can be delivered to the eye by a variety of routes. It can be delivered intravitreally, by surface application to the eye, or by intravitreal injection into, for example, the vitreous (intravitreal injection) or the subretinal (subretinal injection) interphotoreceptor space. In some embodiments, it is delivered to rod photoreceptor cells. Alternatively, it can be delivered locally by insertion or injection into the tissues surrounding the eye. It can be delivered systemically by the oral route or by subcutaneous, intravenous, or intramuscular injection. Alternatively, it can be delivered by catheter or by an implant, where such an implant is made of porous, non-porous, or gel materials (including membranes such as silicone rubber membranes or fibers, biodegradable polymers, or proteinaceous materials). It can be administered prior to the onset of a disease condition to prevent its occurrence, for example, during surgery on the eye, or immediately after the onset of a pathological condition or during an acute or chronic disease condition.

[0106] For administration of injectable aqueous solutions, if desired, the solution can be appropriately buffered and first made isotonic with sufficient saline or glucose in a liquid diluent. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, intravitreal, subcutaneous, and intraperitoneal administration. In this regard, those skilled in the art will know the sterile aqueous media that can be used in accordance with the present disclosure. For example, one dose can be dissolved in 1 ml of isotonic NaCl solution and then added to 1000 ml of subcutaneous perfusion fluid or injected at the proposed infusion site (see, e.g., "Remington's Pharmaceutical Sciences", 15th Edition, pages 1035 - 1038 and 1570 - 1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. In any case, the person responsible for administration decides the appropriate dosage for an individual subject. In addition, for human administration, the preparation should meet the sterility, pyrogenicity, and general safety and purity standards required, for example, by the FDA Office of Biological Standards.

[0107] Sterile injectable solutions can be prepared by incorporating the required amount of shRNA, vector, or rAAV particles as described herein into a suitable solvent (which optionally has several other ingredients listed above) and then filtering to sterilize. Generally, dispersions are prepared by introducing the various sterilized active ingredients into a sterile carrier that contains a basic dispersion medium and the other ingredients required from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze - drying techniques, which yield a powder of the active ingredient plus any additional desired ingredients from their pre - sterile - filtered solutions.

[0108] The amount of the composition (e.g., comprising shRNA, vector, or rAAV particles as described herein) and the time of administration of such a composition will be within the purview of those skilled in the art who will benefit from this teaching. However, it is likely that administration of a therapeutically effective amount of the disclosed composition can be achieved by a single administration, such as a single injection of a sufficient number of rAAV particles to provide a therapeutic benefit to a patient receiving such treatment. Alternatively, in some cases, it may be desirable to provide multiple or continuous administrations of the composition over a relatively short or relatively extended period of time, which can be decided by the medical personnel overseeing the administration of such a composition.

[0109] In some embodiments, rod cells remain structurally intact and / or viable after silencing the expression of the BEST1 gene in the cells. In some embodiments, rod cells in which the expression of the BEST1 gene is silenced may have shortened outer segments that normally contain BEST1. In some embodiments, the length of the outer segment may be maintained or restored (e.g., partially or fully) using an exogenously added (hardened) BEST1 gene whose expression is resistant to silencing using the compositions described in this application.

[0110] "Treating" a disease as the term is used herein means reducing the frequency or severity of at least one sign or symptom of a disease or disorder (e.g., vitelliform macular degeneration) experienced by a subject. The above compositions are generally administered to a subject in an effective amount (i.e., an amount capable of producing a desired result). The desired result will depend on the active agent being administered. For example, an effective amount of rAAV particles can be the amount of particles capable of transferring a heterologous nucleic acid to a host organ, tissue, or cell.

[0111] The toxicity and potency of the compositions used in the methods of the present disclosure can be determined by standard pharmaceutical methods using cells in culture or experimental animals to determine the LD50 (the dose that will kill 50% of that population). The dose ratio between toxicity and potency is the therapeutic index, and it can be expressed as the ratio LD50 / ED50. Those compositions that exhibit a large therapeutic index are preferred. Although those that exhibit toxic side effects can be used, care should be taken to design a delivery system that minimizes the potential damage of such side effects. The doses of the compositions described herein are generally in the range that includes the ED50 and have little or no toxicity. The dose can vary within this range depending on the dosage form employed and the route of administration used.

[0112] Without further elaboration, it is believed that one of ordinary skill in the art can make the fullest use of the present disclosure based on the above description. Accordingly, the following specific embodiments should be construed as merely illustrative and in no way limit the remainder of the present disclosure in any way. All publications cited herein are incorporated by reference for the purposes or subject matter cited herein.

[0113] Examples

[0114] Example 1

[0115] Early panretinal pathology at the RPE-PR interface.

[0116] To understand the pathophysiology underlying the impaired RPE-PR interaction, the cBest retina with clinically apparent disease was evaluated. Key features of the RPE apical membrane responsible for direct interaction with PR OS were examined by immunohistochemistry (IHC) against EZRIN, a membrane-cytoskeleton linker protein necessary for formation of the RPE apical MV, and in combination with human cone arrestin (hCAR) and peanut agglutinin lectin (PNA) labeling to distinguish the cone PR matrix-specific interface. Confocal microscopy and analysis of 3D reconstructed images from wild-type (WT) retinas revealed a complex sheet-like structure of two inherently constitutive cone- and rod-associated MVs in the RPE apical membrane. Cone-MVs (also known as the RPE apical cone sheath) were more prominent than rod-MVs and formed a highly organized wrapping that bound individual cone outer segments (COS) to the RPE apical surface ( Figure 1A ). In the subretinal space, this intercellular complex was further enclosed by an equally complex cone-specific insoluble extracellular matrix sheath (cone-IPM) detected by selective binding of PNA lectin ( Figure 1A ). However, in diseased cBest retinas, such complex extracellular compartmentalization of COS was lost, and the lack of microvillar ensheathment was accompanied by lipid lipofuscin granule overload and hypertrophy of RPE cells with impaired insoluble cone IPM ( Figure 1B ). These observations were confirmed in three different cBEST1 genotypes (R25* / R25*, P463fs / P463fs, and R25* / P463fs) examined in both the retinal pigmented and non-pigmented parts of 22 eyes after disease onset (45 to 270 weeks of age).

[0117] To evaluate the possibility that cone-MV structural abnormalities are secondary to cone dysfunction and disease, the RPE-COS interaction was examined in different canine IRD models: primary cone photoreceptor channelopathy, CNGB3-related achromatopsia. The RPE-COS complex was first examined at 6 weeks of age; CNGB3 mutant retinas with missense or locus deletion mutations did not show obvious irregularities at the RPE-PR interface, and the correct localization of RPE apical markers was associated with specific anti-BEST1 labeling ( Figure 6A and 6B ). Double immunostaining demonstrated the specific distribution of EZRIN along cone-MVs that interdigitated with hCAR-positive but CNGB3-negative COS. Due to CNGB3 channel subunit dysfunction in aging (57 and 85 weeks of age) mutant retinas that underwent progressive cone PR degeneration, microvillar ensheathment of the RPE apical domain was found to remain mostly intact ( Figure 6C and 6D ).

[0118] The findings in CNGB3 mutant retinas suggest that structural alterations in cBest associated with cone-MV ensheathment are not secondary to cone defects but are specific to the RPE channelopathy triggered by BEST1 mutations. These experiments focused on a 6-week time point just prior to the onset of clinical disease in dogs and near the end of postnatal retinal differentiation ( Figure 1C and 1D In contrast to age-matched WT controls, the lack of specific basolateral BEST1 immunolabeling in cBest RPE was associated with a rather smooth apical surface and apparently hypoplastic (vestigial) apical microvilli ( Figure 1C , arrows). The spatial density of cone-MVs and the lengths of cone-MVs and rod-MVs were quantified on deconvoluted 3D Z-stack projections at four retinal locations ( Figure 1D ). Significant differences in the mean number of cone-MVs were found between cBest and WT in every retinal area examined (P<0.0001). Although the number of cone photoreceptors was comparable to controls, cone-MVs in cBest were much fewer and sparsely distributed, and consistently appeared shorter and much more elaborate than those in controls regardless of topographic location. In control (WT) eyes, the mean length of cone-MVs in the superior temporal quadrant of the epipylegs was 17.4 (±0.25) μm and 12.3 (±0.23) μm in the inferior non-epiped retina, while the lengths of rod-MVs in the epipylegs and non-epiped parts of the retina were 6.7 (±0.11) μm and 5.3 (±0.27) μm, respectively. However, in cBest, the mean length of the rare cone-MV extensions identified was significantly reduced (6.0±0.31 and 6.5±0.74 μm in the central epipylegs and inferior non-epiped parts, respectively). Quantitative assessment of tiny rod-MVs in cBest exceeds the limits of optical resolution.

[0119] cBEST1-mutant eyes have whole-retinal microdetachments that extend with light exposure.

[0120] To determine the in vivo relevance of early RPE-PR interface abnormalities detected by IHC, non-destructive imaging using optical coherence tomography (OCT) was evaluated in young cBest eyes, long before lesions could be detected by ophthalmoscopy. Qualitatively, the central retina of all evaluated eyes showed an additional low-scattering layer in the outer retina located distal to the outer nuclear layer (ONL), which was not detectable in WT eyes ( Figure 2A, arrows and double arrows). Unexpectedly, the low-scattering layer can vary with repeated recordings in one eye during a single experiment. Further analysis revealed that due to interventional autofluorescence imaging with bright short-wavelength light, when the retina is exposed to greater retinal irradiance, the width of the low-scattering layer is greater in scans obtained at the end of the imaging process ( Figure 2A , double arrows, more LA). Before performing autofluorescence imaging, the width of the low-scattering layer is smaller in scans obtained early in the imaging process ( Figure 2A , arrows, less LA).

[0121] Quantitative studies were performed by obtaining longitudinal reflectance spectra and measuring at both nasal and temporal retinal locations. WT eyes (n = 12, 15 to 17 weeks old) showed outer retinal hyperscattering peaks at the outer plexiform layer (OPL) and external limiting membrane (ELM), which defined the interventional low-scattering layer as the ONL ( Figure 2B ). The distal end of the ELM is a hyperscattering peak corresponding to the junction between the inner and outer segments (IS / OS) of photoreceptors, which is the main peak originating near the RPE-retroreflective pigment layer interface (RPE / T) and an intervening small hyperscattering peak corresponding to the tip of the photoreceptor OS, which is usually difficult to resolve ( Figure 2B ). In cBest eyes (n = 6, 11 weeks old), an abnormal low-scattering layer could be detected with less light exposure ( Figure 2B , arrows). As the light exposure increased, the low-scattering layer became deeper and more prominent ( Figure 2B , double arrows); both nasal and temporal retinal locations showed the same effect. The distance between the IS / OS and RPE / T peaks was measured ( Figure 2A and 2B , arrows). In WT eyes, the distance was 41.3 (±4.5) μm, while in cBest eyes, this distance in the nasal and temporal retinal regions was significantly greater at 46.8 (±6.7) μm and 45.2 (±6.8) μm (less light exposure) and 55.8 (±10.5) μm and 53.5 (±6.3) μm (more light exposure) (P < 0.001) ( Figure 2C ).

[0122] Two types of experiments were performed to better understand the thickness of the low-scattering layer as a function of light exposure. In the main experiment (WT, n = 12, 15 to 17 weeks old; cBest, n = 3, 13 weeks old), the eyes were dark-adapted overnight and then imaged continuously in the dark over a 2-hour period, and five increasingly intense intervening brief 488-nm light exposures ranging from very dim light to moderate light generated by a standard clinical ophthalmic device were performed ( Figure 2D ). In the shorter experimental protocol, only the two highest light exposures were used in different eyes (cBest, n = 3, 13 weeks old). After overnight dark adaptation, the IS / OS-RPE / T distance in WT eyes was 40.0 (±4.5) μm, while in cBest it was 47.1 (±4.8) μm( Figure 2E ); the difference was statistically significant (P < 0.001). Increasingly bright light exposure led to a monotonic increase in the IS / OS-RPE / T distance in cBest eyes, reaching an apparent plateau of 59.4 (±8.7) μm( Figure 2E ). In WT eyes, the effect of light exposure was negligible or small, and the IS / OS-RPE / T distance reached a plateau of 40.9 (±4.3) μm. Thus, within minutes of an age before any detectable ophthalmoscopic findings, exposure to light showed up to 18.4 (±8.7) μm of acute retinal microdetachment in cBest eyes. The light-mediated microdetachment disappeared within a time span of less than 24 hours( Figure 7 ).

[0123] When preparing for local gene therapy, the retinal localization distribution of light-driven microdetachment was evaluated in fully light-adapted cBest and WT eyes( Figure 2F ). The mean IS / OS-RPE / T distance in WT eyes (n = 4, 104 weeks old) was relatively uniform across the entire upper and lower retinal regions, where a distinct boundary corresponded to the transition between the tapetum lucidum and the pigment (non-tapetal) retina. The larger distances in the tapetal retina of WT eyes were likely due to differences in the major contributors to the high-scattering peak (tapetum lucidum in the tapetal retina versus pigmented RPE). In 297-week-old cBest eyes (R25* / P463fs), there was relatively diffuse panretinal microdetachment in addition to a very obvious retinal detachment in the fovea-like region( Figure 2F , demarcated by a darker color). In younger 12-week-old cBest eyes (P463fs / P463fs), although ophthalmoscopic abnormalities were not obvious, there were still distinct bands of greater microdetachment along the visual streak and around the optic nerve head. The difference maps between mutant eyes and the average WT demonstrated the spatial distribution of the degree of microdetachmentFigure 2F , right).

[0124] To assess potential adverse consequences on photoreceptors, the ONL thickness was morphometrically mapped into retinal regions with micropeelings ( Figure 8A and 8B ). Micropeeling did not result in thinning of the ONL as expected from photoreceptor degeneration. Instead, the ONL in cBest tended to be uniformly thicker than in WT; the super-thick regions generally included the central-upper RPE-retina but could also extend into the lower non-RPE retina ( Figure 8A ). Importantly, when examined microscopically, the super-thick regions of the ONL had a comparable number of PR nuclei to controls. This suggests an extension of the nuclear spacing as a possible cause of the super-thick ONL observed by imaging.

[0125] Natural history of canine vitelliform macular dystrophy.

[0126] As a prerequisite for evaluating gene therapy outcomes, the natural history of cBest was determined in a group of 18 dogs [12 males (M) and 6 females (F); age range 6 to 297 weeks] (Table 1). cBest dogs were continuously monitored by ophthalmoscopy and non-invasive imaging to detect the earliest disease onset and understand disease progression. Based on systematic in vivo imaging, the first disease sign, a subtle focal retinal elevation in the canine fovea-like region, was detected as early as 11 weeks of age (mean 15 weeks of age) ( Figure 9A ). This discrete separation of the photoreceptor layer from the underlying RPE progressed at 23 weeks of age to form a larger subretinal macroscopic peeling (vitelliform lesion), which was evident on fundus and corresponding OCT scans ( Figure 9B ). This discrete RPE-PR peeling on cross-sectional imaging (but not evident on fundus imaging) was found to be consistent in the cBest eyes examined (n = 34), regardless of genotype. From the subclinical stage, the disease progressed to form a macroscopic peeling (vitelliform stage) confined to the canine fovea and surrounded by micropeelings ( Figure 3A , left panel). The primary lesion gradually evolved into a characteristic bullous peeling presentation within the central region encompassing the fovea-like area ( Figure 3A , middle and right panels and Figures 9B to 9D ). A distinct hyperautofluorescence present was evident in the lower part of the lesion ( Figure 3A , middle inset; pseudoabscess stage). The late disease stage involved partial reabsorption and dispersion of the hyperautofluorescent material within the central lesion, which was associated with a significant thinning of the ONL ( Figure 9E and 9F ).

[0127] In each case of subsequent serial imaging (Table 1), although the rate of progression was variable, cBest bidirectionally manifested and almost always exhibited significant symmetry ( Figure 3A and Figures 9A to 9F ). Visualized severe retinal detachment examined by ophthalmoscopy in both eyes remained confined to the central retina or became more extensive, with extra-central lesions scattered everywhere, still strongly biased towards the central cone-rich region and associated with a super-thick ONL.

[0128] Table 1. Summary of AAV-BEST1-treated eyes and control eyes used in this study.

[0129]

[0130]

[0131]

[0132] Keywords: BSS, balanced salt solution; cBEST1, canine transgene; hBEST1, human transgene; Inj., injection; OD, right eye; OS, left eye; OU, bilateral; p.i., post-injection; UnTx, untreated; vg, vector genome; WT, wild type. cBEST1 mutations: R25* / R25*, p.Arg25Ter - homozygous; P463fs / P463fs, p.Pro463fs - homozygous; R25* / P463fs, p.Arg25Ter / p.Pro463fs - compound heterozygous.

[0133] Subretinal BEST1 gene augmentation therapy stably corrects the disease.

[0134] To evaluate the proof-of-concept of AAV2-mediated subretinal gene augmentation therapy, 22 cBest eyes were injected at weeks 27 to 69 with canine (cBEST1) or human (hBEST1) transgenes driven by the human VMD2 promoter [vector titers ranging from 0.1 to 5×10 11 vector genomes (vg) / ml or balanced salt solution (BSS) control] (Table 1). Diagrams of exemplary AAV vectors containing the hBEST1 and cBEST1 heterologous nucleic acids used to prepare the disclosed rAAV particles are shown in Figure 13 and 14Shown in. Unilateral injection of AAV (leaving the contralateral eye uninjected) or injection of AAV into one eye and control (BSS) injection into the contralateral eye was performed on cBest dogs with focal or multifocal retinal detachment showing different stages; bilateral injection of AAV targeting the superotemporal quadrant was performed on three cases showing multifocal disease, and the retinal area outside the surgical bleb was used as an internal control (Table 1).

[0135] Compound heterozygous (R25* / P463fs) dogs showing advanced central retinal detachment in the right eye (EM356-OD) showed representative results ( Figure 3A ), the right eye received subretinal injection of cBEST1 at 52 weeks of age ( Figure 3B , left panel), while the contralateral eye (EM356-OS) was not injected ( Figures 9A to 9F ). Both eyes were monitored clinically and by in vivo imaging. Disease reversal was first evident at 4 weeks post-injection (p.i.) in the injected eye and persisted long-term, as illustrated at p.i. weeks 43 and 245 ( Figure 3B ). In this and other cases with advanced disease (n = 13 eyes) showing a large accumulation of autofluorescent material within the subretinal macrodetachment, supra-autofluorescent signals could still be detected months after AAV injection but gradually declined over time ( Figure 3B , inset). Based on non-invasive imaging, both focal lesions and extra-central lesions within the AAV-BEST1-treated area regressed at 4 to 12 weeks p.i., and local retinal reattachment remained stable thereafter (Table 1). There was no evidence of an inflammatory response in any of the AAV-treated eyes, and longitudinal in vivo evaluation did not reveal any adverse effects on the RPE or neural retina.

[0136] AAV-mediated treatment with hBEST1 also resulted in lesion reversal and long-term disease correction (n = 13 eyes). Representative in vivo imaging results and IHC evaluations from cBest dogs (R25* / R25*) ( Figure 3C and 3D ) showed that the early bilateral lesions present before treatment disappeared after treatment of the study eye (EMC3-OS) with AAV-hBEST1 (2×10 11 vg / mL) ( Figure 3D ), while the lesions in the contralateral control eye (EMC3-OD) injected with BSS continued to expand ( Figure 3C ). Based on funduscopy, in the illustrated examples and in all other cases, transient retinal detachment associated with vector or BSS delivery resolved within 24 to 48 hours p.i.; however, retinal lesions injected with BSS reappeared as early as 1 week p.i. and progressed along the natural disease course ( Figure 3C)。This is in stark contrast to the AAV-treated eyes, in which early as well as later stage lesions regress within the first 6 weeks after hBEST1 gene therapy, and the treated area remains disease-free thereafter. Figure 3D )。Ophthalmic examinations and IHC evaluations using RPE- and PR-specific markers showed no adverse effects on the retina up to 207 weeks p.i. (Figs. 3, 10, and 11). Of particular importance, evaluation of retinal protection at p.i. revealed a significant restoration of the retinal architecture at the RPE-PR interface, including the extension of cone-MVs and the rescue of the actin cytoskeleton, corresponding to the vector-treated bleb regions with canine or human BEST1 transgenes. Figure 3C and 3D , bottom panels, and Figure 10 and 11). No differences between genders were observed in terms of clinical manifestations or response to AAV-BEST1 treatment.

[0137] Compared to wild-type controls and cBest untreated eyes, the retina was protected in three cBest models [cmr1 (R25* / R25*), cmr1 / cmr3 (R25* / P463fs), and cmr3 (P463fs / P463fs)] after AAV-hBEST1 treatment. cBest eyes were injected with AAV-hBEST1 (2×10 11 vg / mL) at 27 weeks of age (cmr1), 45 weeks of age (cmr1 / cmr3), or 63 weeks of age (cmr3), and evaluated by IHC at 103 weeks, 51 weeks, or 207 weeks p.i., respectively. Figure 10 )。No obvious abnormalities were detected within the treated area up to 207 weeks p.i. Note that the apical extensions of the RPE project into the subretinal space (EZRIN) in all treated eyes. Untreated cBest controls (far right panel) show a lack of RPE apical microvilli, RPE hypertrophy (EZRIN, RPE65), accumulation of lipofuscin granules within the RPE monolayer, and autofluorescent deposits in the subretinal space.

[0138] Representative confocal micrographs are shown in Figure 11A depicting the cBest (R25* / P463fs) retina double-labeled with BEST1 (RPE, darker color) and SLC16A1 (RPE, lighter color) at 79 weeks after AAV-hBEST1 injection (2.5×10 11 vg / mL). Shown in Figures 11B to 11D is a continuous range from the surgically created bleb region Figure 11B ), through the adjacent penumbra region Figure 11C ), and toward the outside of the injection area Figure 11D) Cross-sectional overview. As highlighted in the magnified image, a direct correlation was observed between the degree of restoration of the RPE-PR interface structure and BEST1 transgene expression. A significant extension of the RPE apical projection within the treated area with enhanced BEST1 was observed ( Figure 11B ); residual microvilli [c-MV (brighter arrow) and rod-MV (darker arrow)] were present in the bubble penumbra associated with the punctate distribution of BEST1 (weak red signal within individual RPE cells) and RPE-PR micropeeling ( Figure 11C ); outside the treated area, subretinal lesion formation was observed in the absence of both BEST1 expression and RPE apical protrusions ( Figure 11D ). Fan-shaped and schematic RPE apical surfaces, as well as numerous intracellular deposits, appeared as granular aggregates within the cBest mutant RPE ( Figure 11A , top panel, uninjected; Figure 11D , close-up). In the peeled area, cell debris (asterisk) mixed into the subretinal space corresponded to Müller glial cells and reflected retinal remodeling in response to stress. [Scale bars are 100 μm (top) and 10 μm ( Figures 11A to 11D )].

[0139] Correction of light-regulated micropeeling with gene therapy.

[0140] To understand the consequences of BEST1 gene augmentation therapy on retinal regions with subretinal detachments undetectable by ophthalmoscopy, morphometric measurements of the IS / OS-RPE / T distance were made both inside and outside the subretinal blebs, where representative results of control subretinal BSS injection in cBest (R25* / P463fs) dogs at 69 weeks of age showed uniform micropeeling covering all imaged retina at 87 weeks of age ( Figure 4A ). The mean degree of micropeeling in the upper retina (subtracting the IS / OS-RPE / T distance of mutant dogs injected with BSS from co-localization measurements in WT eyes) was 11.6 μm and in the lower retina was 16.7 μm ( Figure 4B ), consistent with eyes not injected with cBest. On the other hand, subretinal AAV gene therapy led to a significant reduction in the IS / OS-RPE / T distance in the treated area. EMC3-OS, EML4-OS, and LH21-OS demonstrated the results for three genotypes treated with gene therapy using the human BEST1 transgene, where the titer was approximately 2×10 11 vg / mL ( Figure 4A and Table 1). In each case, the IS / OS-RPE / T distance was significantly reduced in the treated blebs. Notably, severe subretinal detachments (darker color) were detectable only outside the treated area ( Figure 4A)。Quantitative measurements showed complete improvement of microdetachment, where the IS / OS-RPE / T distance was restored to WT levels in both the superior and inferior retinal regions treated with subretinal gene therapy ( Figure 4B , solid symbols), but not in the retinal regions distant from the treatment bubble ( Figure 4B , unfilled symbols).

[0141] Typically, the area of efficacy of subretinal gene therapy extends beyond the bubble formed during surgery to include the penumbra region. In cBest dogs with successful gene therapy, there was also a penumbra region, but it was shown to be qualitatively larger than those typically encountered previously ( Figure 4A ). In some of the most extreme embodiments, pretreatment maps of total retinal microdetachment were found to be necessary to demonstrate the extent of penumbra extension. For example, EML9-OD at 29 weeks of age showed the most obvious total retinal microdetachment along the visual hyperscan and included several regions with severe retinal detachment ( Figure 4C ). Gene therapy was performed at week 69. At week 87, the microdetachment and most of the severe retinal detachment disappeared over the entire imaged retina ( Figure 4C ), and quantitative measurements showed normal or thinner IS / OS-RPE / T distances at superior and inferior retinal locations ( Figure 4D ). Importantly, the IS / OS-RPE / T distance showed significant improvement at the retinal locations corresponding to the bubble formed at the time of injection and in the nasal retinal control region of the same eye. This obvious example of penumbra extension can be explained by the greater diffusion of the vector through the microdetachment in the cBest eye, resulting in RPE transduction at sites significantly farther from the initial bubble. A more typical example with a defined penumbra extension is illustrated for comparison. EML13-OS at 37 weeks of age showed total retinal microdetachment that was particularly prominent in the temporal retina and along the visual hyperscan; there were also several severe retinal detachments along the visual hyperscan ( Figure 4E ). Gene therapy was performed at week 45. At 81 weeks of age, both the superior and inferior retinas temporal to the optic nerve were free of microdetachment and macroscopic detachment, while the untreated nasal retina retained microdetachment and formed a large amount of macroscopic detachment ( Figure 4E ). Quantitative results confirmed the therapeutic effect ( Figure 4F ), which did not reach the nasal retina, unlike EML9-OD.

[0142] To understand the potential consequences of gene therapy on retinal degeneration, the ONL thickness was mapped on the treated eyes ( Figure 8B)。The treated retinal areas showing disappearance of microdetachment also tend to correspond to normal ONL thickness, while the untreated areas with persistent microdetachment tend to show either ultra-thick or normal ONL, or thinned ONL in some areas ( Figure 8B )。In summary, AAV-mediated gene augmentation therapy in canine vitelliform macular dystrophy showed promotion of the continuous reversal of severe retinal detachment, re-establishment of tight contact between the RPE and PR, and restoration of ONL thickness to normal values.

[0143] Autosomal recessive vitelliform macular dystrophy in humans: Structure and function.

[0144] To facilitate the clinical translation of successful gene therapy in BEST1 mutant dogs, several studies were conducted to better understand the human pathophysiology of autosomal recessive vitelliform macular dystrophy (ARB) and to gain insight into the distribution of the pan-retinal disease beyond the severe lesions detectable by ophthalmoscopy as previously described. Data from two patients are presented ( Figures 5A to 5G ):P1 is a 39-year-old female with a best-corrected visual acuity of 20 / 100, carrying biallelic BEST1 mutations (c.341T>C / c.400C>G), while P2 is a 36-year-old male with an acuity of 20 / 60, also carrying biallelic mutations in BEST1 (c.95T>C / c.102C>T). In both patients, the mutant alleles were segregated from clinically unaffected parents. Ultra-wide imaging of RPE health using the native autofluorescence of the lipofuscin granules they contain showed extensive and substantial abnormalities, including areas of relatively high or low autofluorescence and local heterogeneity. Notably, there was a distinct transition zone ( Figure 5A , arrow) in the nasal mid-peripheral retina, which demarcated the relatively healthier nasal peripheral retina.

[0145] Rod and cone functions were sampled at high density along the horizontal meridian to better understand the topographic map of visual loss and its correspondence with retinal structural abnormalities. Both patients showed a severe (>3log) loss of rod-mediated sensitivity in long-term dark-adapted eyes; relative preservation of rod function was present in the temporal fields (nasal retina) of both patients and in the peripupillary region of one patient ( Figure 5B , upper panel). Unexpectedly, cone-mediated function showed only moderate loss (<1log) or normal or near-normal results in light-adapted eyes ( Figure 5B , lower panel). Sampling of rod and cone functions across the visual field confirmed and extended these findings and showed strong inter-eye symmetry ( Figure 12A and 12B)。Rod sensitivity loss (RSL) and cone sensitivity loss (CSL) graphs of both eyes of two ARB patients. A large, symmetric central area of severe RSL is surrounded by relatively preserved function in the temporal field. Across the entire visual field, cone function is affected relatively less and CSL is relatively uniform. In the temporal field, the physiological blind spot is shown as a black square at 12°.

[0146] Cross-sectional imaging with OCT was performed to evaluate retinal laminar abnormalities ([[]] along the horizontal meridian through the fovea. Figure 5C )。There was no consistent history of light exposure during OCT imaging. Both patients showed significant loss of the outer nuclear layer (ONL) and abnormal levels of photoreceptor inner segment / outer segment (IS / OS) across most of the central retina. Additionally, P2 showed intraretinal cystic spaces and detachment of the central retina from the retinal pigment epithelium (RPE), most likely due to the accumulation of subretinal fluid. Retinal lamination was relatively normalized in the peripupillary area ([[]] Figure 5C , dark rectangle) and outside the nasal midperipheral transition ([[]] Figure 5C , light rectangle). Analysis of two target areas showed that an abnormally thinned ONL was detectable in both patients, and low peak signals were detectable in the IS / OS and cone outer segment tip (COST) [[[]] Figure 5D and 5E ). In P1, the distances from the external limiting membrane (ELM) to the IS / OS and from the IS / OS to the COST were comparable to normal. A low-scattering layer was present distal to the COST, and the RPE was shown to be hypertrophic ([[]] Figure 5D , middle panel). In P2, the distance from the ELM to the IS / OS was shown to be shorter than normal, while the distance from the IS / OS to the COST was comparable to normal. The distance from the COST to the retinal outer segment tip / RPE (ROST / RPE) was shown to be greater than normal, with an indistinct low-scattering layer in the middle; the RPE was shown to be comparable to normal in thickness ([[]] Figure 5D , right panel). Analysis of the outer retina in the nasal midperipheral area in P1 showed that the distances from the ELM to the IS / OS, from the IS / OS to the COST, and from the COST to the ROST / RPE were greater than normal, and the RPE thickness was comparable to normal ([[]] Figure 5E , middle panel). P2 was characterized by an intermediate between P1 and normal ([[]] Figure 5E , right panel).

[0147] To understand the effect of structural abnormalities at the outer retina and RPE levels on retinoid transfer kinetics between these cell layers, dark adaptation tests were performed. At the peripupillary location shown in [[[]] Figure 5D , the dark adaptation threshold of P1 was rod-mediated but elevated by 1.3 log units ([[]] Figure 5F)。By 22.5 minutes after light exposure, the P1 results remained cone-mediated on the plateau, while the normal ones were within 1 log unit of the final dark adaptation threshold. By 50 minutes, the P1 rod results were still elevated by 1 log, while the normal recovery was complete( Figure 5F )。At the Figure 5E intermediate peripheral nasal retinal location shown, compared to normal, the dark adaptation threshold of P2 was rod-mediated and elevated by approximately 0.5 log unit( Figure 5G )。By 14.5 minutes after light exposure, it was first shown that rod function was only slower than the cone-rod break in normal by 11 minutes. The rod recovery rate was similar to normal( Figure 5G )。In summary, the rod dark adaptation kinetics at the paracentral location of P1 showed a very slow time course, while the rod function dark adaptation kinetics at the intermediate peripheral location of P2 was closer to normal( Figure 5F and 5G )。

[0148] The RPE has a key role in maintaining the metabolic activity environment of the subretinal space. Due to the dynamic relationship with adjacent retinal layers, mutations in RPE-specific genes usually have an adverse effect on adjacent sensory neurons, leading to visual function loss and PR degeneration. Mutations in BEST1 are known to disrupt trans-epithelial ion and fluid transport in response to abnormal levels of intracellular calcium. It is also thought that abnormal RPE calcium signaling leads to dysfunction of other pathways by altering the expression and interaction of Ca 2+ -sensitive proteins. Based on the findings in cBest, one such protein is EZRIN, which is a membrane-cytoskeleton linker necessary for the formation and correct maturation of the RPE apical MV. It has been demonstrated that the activation of the EZRIN membrane-F-actin cross-linking function occurs directly in response to Ca 2+ transients, and it was shown that Ezrin-KO mice had a significant reduction in the processing of RPE MV. The marked hypoplasia of the RPE apical MV found in BEST1 mutant RPE is consistent with these findings. In addition, comparative IHC assessments conducted with other IRD models showed that these major structural changes related to microvillar ensheathment were specific to the primary RPE channelopathy triggered by BEST1 mutations and not secondary to cone dysfunction and degeneration.

[0149] The structural components of the apical protrusions of the RPE are very different from those of the non-motile intestinal microvilli. The presence of contractile proteins (such as myosin) and molecules normally found at cell attachment sites in the apical microvilli of the RPE indicates that the RPE actively adheres to the neural retina and exerts tension on it. The lack of proper microvillar ensheathment at the RPE-PR interface in cBest, and thus the absence of the physical and electrostatic support of these projections for the PR OS, is expected to weaken the adhesion force and lead to the detachment of the RPE-PR complex throughout the retina. In the early stages of the disease, the microdetachment of the PR layer from the underlying RPE found in cBest would be consistent with this process. In addition, the presence of contractile elements in the apical projections of the RPE and the fact that they have evolved from cells that undergo pigment migration suggest that the MV can actively contract while interdigitating with the PR OS and are destined to facilitate the diurnal phagocytic activity. A single RPE cell can accommodate approximately 30 to 50 PRs, depending on the retinal location and packing density; the elaborate microvillar network allows each RPE cell to handle such a high metabolic load per day. Insights from proteomic analysis support this argument. There are enriched fractions of retinoid-processing proteins expressed along the apical MV of the RPE, as well as many channel proteins and transporter proteins (e.g., Na + / K +ATPase), which is extremely important for the efficient transport of water, ions, and metabolites between the RPE and PR OS. Considering the topographical differences in RPE cell size and the density and length of MVs quantified in this study, MV extensions expand the functional surface of individual RPE cells by 20 to 30 times in the central retina, which is consistent with earlier estimates. This number is even higher (about 50 times) for small RPE cells in the macular region, which adapt to a higher shedding POS turnover rate when facing the most densely packed PR. A sharp reduction in such total apical surface area in BEST1 mutant RPE would lead to a long-term delay in metabolite processing and prevent the RPE's ability to maintain an appropriate cell volume and both chemical composition and physiological pH levels in the subretinal space. Since these factors are crucial for retinal adhesion, any limitation in the RPE transport system will alter the hydrostatic balance and result in a reduced osmotic property of the RPE-PR complex and subsequent detachment from the neural retina. In fact, the primary serous detachment in human and canine vitelliform macular dystrophy is first demonstrated in the fovea (the central region with the highest metabolic activity). The absence of highly extended RPE apical protrusions, which tightly wrap the COS around the ellipsoid in a structurally intact retina, would explain the preference of this cone-rich structure for its primary detachment in vitelliform macular dystrophy. There is an almost complete dependence on frictional interactions with MVs. This is consistent with the observations in cBest, which documented the formation of focal pre-vitelliform lesions in the fovea-like region of the canine central region and the susceptibility of other central cone-rich regions (such as visual ultra-high-speed scanning) to subretinal detachment.

[0150] After exposure to dim and moderate light intensities, the major extension of micropeeling in cBest was an unexpected finding. It is known that light exposure in normal eyes alters the molecular composition of the subretinal space. There is also evidence that measurable structural changes occur in the normal outer retina under light exposure, such as outer segment length, hydration of the subretinal space, increased actin staining along the apical MV of the RPE, and changes in outer segment phototropism. However, all normal changes were significantly less than those measured in cBest. For example, compared with the approximately 18 μm extension of the subretinal space driven by light in cBest, the normal human eye showed changes of approximately 1 μm in the outer retina, and the normal mouse eye showed changes of approximately 4 μm in the outer retina. Human ARB has only recently been recognized and the literature on the earliest disease stages is limited. Recessive c vitelliform macular dystrophy shows phenotypic similarities to both dominant and recessive vitelliform macular dystrophies in humans. In patients with Best vitelliform macular dystrophy (BVMD), there is some controversy regarding the structural features of the retina in the vitelliform or the perilesional area in the late stage or the pre-vitelliform stage of the disease. Some studies have shown minor abnormalities at the level of the RPE-PR interface, while results from other studies do not support detectable structural defects. The cause of this controversy may be the genotype, the resolution of the different methodological approaches used, or the light history before imaging. In fact, light-dependent outer retinal changes have been described in BVMD using methods such as those disclosed herein; nevertheless, the magnitude of the changes in patients was smaller than that in cBest (approximately 2 μm). However, in general, the abnormal response of the affected retina to light stimuli may be associated with a significantly reduced light peak / dark trough ratio in the electrooculogram, a finding that is consistent in all, even pre-symptomatic Best vitelliform macular dystrophy patients.

[0151] Importantly, both micropeeling and macropeeling in cBest had an adverse effect on photoreceptor health: the areas of micropeeling tended to correspond to a super-thick ONL, while large lesions with severe macropeeling showed a thinning of the ONL. Smaller lesions with macropeeling could not be evaluated with the sampling method used here. The ONL contains the nuclei of all rods and cones, and classical studies in animal models and human eye donors generally show that the ONL thins with disease progression. What is less well-known is that some of the earliest stages of retinal disease show thickening of the ONL, which has only become measurable with the advancement of in vivo imaging methods. Human studies have previously demonstrated such thickening of the ONL in the early stages of retinal disease. There is also evidence in animal studies of ONL thickening associated with retinal stress. When examined microscopically, the super-thick areas of the ONL mapped in cBest showed a comparable number of PR nuclei to the control, indicating a greater nuclear spacing within the ONL, likely corresponding to a level of retinal stress below the apoptotic threshold. On the other hand, severe retinal detachment can lead to greater retinal stress and progressive degeneration.

[0152] To prevent photoreceptor and vision loss associated with BEST1 mutations, subretinal gene augmentation therapy was performed on retinal regions with macroscopic and microdissections. Results showed that AAV-mediated BEST1 gene augmentation was safe, reversed clinically apparent lesions, improved diffuse microdissections, and led to normalization of the ultrathick ONL. In addition, gene therapy was successful in three different BEST1 genotypes with both focal and multifocal presentations and confirmed the long-term persistence of the therapeutic effect. At the molecular level, the ability of canine and human BEST1 transgenes to correct the position of the RPE-PR complex and restore the cellular architecture of this key interface was demonstrated. This study suggests that this therapeutic approach is applicable to both early and more advanced stages of autosomal recessive diseases. Further studies using human inducible pluripotent stem cell (hiPSC)-derived RPE models from patients carrying autosomal Best1 mutations will determine whether the gene augmentation approach will also be beneficial for patients with BVMD.

[0153] To facilitate the clinical translation of successful gene augmentation therapy, patients with ARB were studied to gain a deeper understanding of their panretinal disease. Consistent with most (but not all) previous descriptions, the retinal disease in patients with ARB extends far beyond the macula into the mid-periphery. Oriented and cross-sectional imaging and retinal mapping of rod and cone function showed a distinct transition from disease to health in the mid-peripheral retina, a feature not previously emphasized. Within the diseased regions, severe abnormalities within the retinal architecture were associated with severe loss of rod function; unexpectedly, cone function was relatively preserved. Rod dysfunction within the central retina was also associated with an extremely slow retinol cycle, while the healthier periphery showed a near-normal retinol cycle. There are at least two retinol cycles that supply 11-cis-retinal chromophore for photoreceptor pigments. The canonical retinol cycle functions in the RPE to produce chromophores for rods and cones PR. On the other hand, the retinal retinol cycle is thought to regenerate chromophores within the retina for specific use in cones. The abnormal RPE-PR interface in vitelliform macular degeneration will most likely affect chromophore delivery from the canonical RPE retinol cycle; the retinal retinol cycle may be relatively unaffected, thus explaining the greater preservation of cone function.

[0154] In summary, as disclosed herein, novel molecular contributors to the pathophysiology of vitelliform macular dystrophy at the RPE-PR interface have unexpectedly been discovered. The earliest manifestation of the disease - diffuse microdetachment enhanced by light exposure - has been found, which is readily detectable by in vivo imaging. AAV-mediated BEST1 augmentation gene therapy reversed both prominent lesions and microdetachment and restored the cellular architecture of the RPE-PR interface. Evaluation of ARB patients showed that the topographic distribution and the characteristics of structural and functional deficits exceeded what would be expected from PR degeneration. Such visual dysfunction can be expected to improve following successful application of BEST1 gene augmentation therapy to patients affected by vitelliform macular dystrophy.

[0155] Example 2

[0156] The vector technology of Example 2 was designed to use RNA interference to inhibit the expression of endogenous BEST1 mRNA (both mutant and normal copies). These vectors simultaneously replaced the endogenous BEST1 mRNA with normal BEST1 mRNA to produce only the normal protein. This technology uses adeno-associated virus to deliver a copy of the BEST1 gene without introns plus the gene for a small hairpin RNA (shRNA), resulting in the production of small interfering RNA (siRNA). Due to a silent mutation in the BEST1 gene reading frame, it is resistant to siRNA. Two shRNAs were designed and thus two modified human BEST1 genes were designed. Both BEST1 genes were driven by a 623 bp fragment of the human VMD2 promoter. The BEST1 cDNA was preceded by a synthetic intron and followed by a polyadenylation sequence, both derived from the SV40 virus. In one case, shRNA05 was driven by the RNA polymerase III (polIII) H1 promoter, while in the other case, shRNA744 was driven by the pol III U6 promoter. A sequence of six thymidines was used as the termination sequence for each shRNA. To identify these active shRNAs, nine potential siRNA or shRNA sequences were screened.

[0157] The genetic sequences encoding the shRNAs are as follows:

[0158]

[0159] Figure 15 and 16 The figures of exemplary AAV vectors are shown in and, respectively, which contain heterologous nucleic acids encoding shRNA05 and shRNA744 and an hBEST1 gene containing an off-target sequence (e.g., one of SEQ ID NO:10 or 11), which is used to produce the disclosed rAAV particles. Both sequences are driven by the VMD2 promoter.

[0160] In some embodiments, the present disclosure provides a sense strand of shRNA05, which comprises: a sense strand containing the nucleotide sequence of SEQ ID NO:2, plus additional nucleotides immediately preceding the first cytosine of the sequence. In certain embodiments, the additional nucleotide comprises cytosine (C).

[0161] In some embodiments, the present disclosure provides shRNA05, which comprises an antisense strand containing the nucleotide sequence of SEQ ID NO:3.

[0162] An exemplary genetic sequence corresponding to the vector region encoding the pol III H1 promoter, shRNA05, and the termination sequence is as follows:

[0163]

[0164] (SEQ ID NO:20). The sequence also includes a BamHI endonuclease site (ggatcc) to facilitate screening and ensure that the starting site of shRNA05 will be located 25 nucleotides downstream of the H1 promoter TATA box (TATAA). Thus, in some embodiments, an shRNA (e.g., shRNA05) encoded by a nucleic acid comprising this sequence (and / or its complementary sequence) is transcribed in a host cell (e.g., in a subject treated with the vector, e.g., in a human subject). In some embodiments, two or more different shRNAs (e.g., having different starting sites and / or termination sites, e.g., differing from shRNA05 by one or two additional or fewer nucleotides) are transcribed in a host cell.

[0165] Figure 17 It is shown that the VMD2 promoter functions well in cell culture. HEK293T cells were transfected with plasmids expressing GFP or Best1 using the chicken β-actin promoter (CBA) or the VMD2 promoter. Protein lysates were separated on a polyacrylamide gel, and the expression of bestrophin (Best1) was detected by Western blot and normalized against the expression of β-tubulin to show even gel loading. Figure 18A and 18B It is shown that the Best1-specific siRNA is functional. Transfection of HEK293T stably expressing BEST1 resulted in a 75% reduction in bestrophin (Best1) protein. At 48 hours after transfection, cell analysis can be performed using 20 nM siRNA. Western blot ( Figure 18A ), and the knockdown of BEST1 was compared by normalizing the band intensity between Best1 and tubulin (Best1 / tubulin) ( Figure 18B ). Figure 19A and19B It was shown that Best1 shRNA was active: HEK293T - BEST1 cells were transfected with 4 μg of the designated plasmid. Cells were harvested 48 hours after transfection. The expression of BEST1 was determined by Western blot ( Figure 19A ). The knockdown of BEST1 was compared by normalizing the band intensity between Best1 and tubulin (Best1 / tubulin) ( Figure 19B ). Figure 20 Off - target of Best1 was shown. Silent mutations (base changes at the third position of the codon) were used to remove the siRNA target site from Best1 mRNA. The disclosed example was for shRNA744. SEQ ID NO:15 to 17 correspond to the sequences from top to bottom.

[0166] Materials and Methods

[0167] Canine BEST1 models and in - vivo retinal imaging.

[0168] cBest mutant dogs (n = 18) of both sexes (12M and 6F) were included, which carried homozygous (c.73C>T)(p.R25* / R25*) or (c.1388delC)(p.P463fs / P463fs) or biallelic mutations of cBEST1 (GB*NM_001097545) (c.73C>T / 1388delC)(p.R25* / P463fs). For ease of annotation of multiple sets of figures, these three genotypes were designated as cmr1, cmr3, and cmr1 / cmr3, respectively. This study was conducted in comparison with control cross - bred dogs (n = 12; 7M and 5F) (Table 1). All animals were bred and maintained in the Retinal Disease Studies Facility (RDSF). This study was conducted strictly in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the NIH and complied with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research. The protocol has been approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania (IACUC no.804956 and 803422). As previously described, dogs were imaged for orientation and retinal cross - sections under general anesthesia.

[0169] Human subject.

[0170] In the entire central visual field, light adaptation and dichromatic dark adaptation functions were measured at 2° intervals (central 60° along horizontal and vertical meridians) and at 12° intervals throughout the visual field. The photoreceptor-mediated under dark adaptation conditions was determined by the sensitivity difference between 500 nm and 650 nm stimuli. A LED-based dark adaptometer (Roland Consult) and short-duration (30 seconds) moderate light exposure from a clinical short-wavelength autofluorescence imaging device (25% laser output; Spectralis HRA; Heidelberg Engineering) were used to evaluate dark adaptation kinetics similar to the previously described techniques (92 - 94). Optical coherence tomography (OCT) was used to analyze the laminar structure across the retina. Retinal cross-sections were recorded with a spectral-domain (SD) OCT system (RTVue-100; Optovue). Post-acquisition data analysis was performed with a custom program (MATLAB 7.5; MathWorks). The recording and analysis techniques have been described previously (30, 31, 94). Longitudinal reflectance spectra (LRP) were used to identify retinal features. A confocal laser scanning ophthalmoscope (Spectralis HRA; Heidelberg Engineering) was used to record face images and the RPE health status was evaluated with short-wavelength reduced-illuminance autofluorescence imaging (SW-RAFI) as described previously (95). All images were acquired in high-speed mode (30°×30° square field or 50° circular field). Canine BEST1 model and in vivo retinal imaging.

[0171] Overlapping facing images (Spectralis HRA+OCT) of reflectance under near-infrared illumination (820 nm) were obtained using lenses with diameters of 30° and 55° to depict fundus features such as the optic nerve, retinal blood vessels, boundaries of injection blebs, retinal incision sites, and other local changes. Separate images were digitally stitched into a full retinal panorama using a custom program (MATLAB 7.5; MathWorks). Short-wavelength autofluorescence and reflectance imaging were used to delineate the boundaries of the retinal pigment epithelium and pigmented RPE. Spectral domain optical coherence tomography (SD-OCT) was performed using overlapping (30°×25°) raster scans over large areas of the retina. Post-processing of OCT data was performed using a custom program (MATLAB 7.5). For full retinal topographic analysis, the integrated backscatter intensity of each raster scan was used to localize its precise position and orientation relative to retinal features visible on the full retinal mosaic formed from near-infrared reflectance (NIR) images. Separate LRP's forming all recorded raster scans were assigned to regularly spaced bins (1°×1°) in a Cartesian coordinate system centered on the optic nerve; the LRP's in each bin were aligned and averaged. Retinal inner peaks and boundaries corresponding to the OPL, ELM, IS / OS, and RPE / T were segmented using both the intensity and slope information of the backscatter signal along each LRP. Topographic maps of ONL thickness were generated from the distance from the OPL to the ELM, and maps of IS / OS to RPE / T thickness were generated from the distance between these peaks. For all topographic map results, the positions of blood vessels, optic nerve head, blebs, retinal pigment epithelium, and fovea-like regions (24) were covered for reference. First, maps from WT dogs were recorded through the center of the optic nerve head and rotated to align the fovea-like regions, and an average WT topographic map was exported. The fovea-like region of the cBest mutant dog was determined by overlaying the WT template on the mutant eye by aligning the optic nerve head, major superior blood vessel, and retinal pigment epithelium boundary. Next, cBEST1 mutant maps were recorded on the WT map through the center of the optic nerve and the estimated fovea-like region, and difference maps were exported. Difference maps were sampled both inside and outside the treated bleb for each eye. The relationship between light exposure and outer retinal structural changes was evaluated by two methods. In a subset of eyes, cross-sectional OCT imaging was performed early in each experiment, followed first by autofluorescence imaging with bright short-wavelength light and then followed by further OCT imaging. Compared to recordings obtained later, OCT recordings obtained early in such a process were considered to be from retinas exposed to less light, although the exact light exposure could not be quantified.In another subgroup of eight eyes, OCT recordings were made after overnight dark adaptation and then continuously in a dark room at short intervals after short-wavelength light exposure from the cSLO. In three eyes, five increasingly intense light exposures were used: L1: laser, 20%; duration 60 seconds; L2: laser, 25%; duration 30 seconds; L3: laser, 50%; duration 30 seconds; L4: laser, 100%; duration 30 seconds; L5: laser, 100%; duration 300 seconds. In three eyes, only L4 and L5 were used. In two other eyes, only L5 was used to track the recovery of light-mediated micropeel over a 24-hour period. The estimated standard (100%) laser setting was chosen to correspond to a human retinal irradiance of 330 μW·cm−2 at a wavelength of 488 nm (98). In both methods, the areas selected for analysis were based on near-infrared imaging of the fundus with the cSLO before the start of the study, and areas where obvious clinically visible macroscopic peels were present were excluded.

[0172] Subretinal injection and postoperative procedures.

[0173] Subretinal injection of recombinant AAV2 / 2 delivering the cBEST1 or hBEST1 transgene under the human VMD2 promoter control (46) was performed under general anesthesia according to a previously published protocol (46, 82, 97). Vector production and validation have been described in detail previously (46). A viral vector solution with an injection volume of 50 to 180 μL (titer range 0.1 to 5 × 10 11 vg / mL) (Table 1) was subretinally delivered by a transvitreal approach without vitrectomy under direct observation with an operating microscope using a custom-modified RetinaJect subretinal syringe (SurModics) (97). Anterior chamber paracentesis was performed immediately after injection to prevent an increase in intraocular pressure. The formation of a subretinal bleb was recorded immediately after injection by fundus photography (RetCam Shuttle; Clarity Medical Systems). In all cases, the surgical bleb flattened and the retina reattached within 24 to 48 hours p.i. Ophthalmic examinations, including biomicroscopy, indirect ophthalmoscopy, and fundus photography, were performed regularly (24 hours, 48 hours, and 5 days p.i., and then weekly for the first 2 months and subsequently monthly) throughout the injection-endpoint evaluation time interval. Postoperative management was performed as previously described (46).

[0174] Histological and immunohistochemical evaluation.

[0175] Collect eye tissues (24, 99) for ex vivo analysis as described above. Every effort is made to improve animal welfare and minimize discomfort. For all ex vivo evaluations, cBest and control (WT) eyes are fixed in 4% paraformaldehyde, embedded in optimal cutting temperature compound, and processed as previously reported (99). Histological evaluations are performed using standard hematoxylin / eosin (H&E) staining, and all immunohistochemistry experiments are conducted on 10-μm thick cryosections according to a defined protocol (46, 99). Briefly, retinal cryosections are permeabilized with 1× PBS / 0.25% Triton X-100, blocked for 1 h at room temperature, and incubated overnight with primary antibodies (Table 2). For multicolor labeling, primary antibodies are combined with Alexa Fluor 488 phalloidin (Thermo Fisher Scientific) or PNA-AF647 (L32460; Molecular Probes), followed by incubation with the corresponding secondary antibodies (Alexa Fluor) for 1 h. Slides are examined by epifluorescence or transmitted light microscopy (Axioplan; Carl Zeiss Meditec), and digital images are collected with a Spot 4.0 camera (Diagnostic Instruments).

[0176] Table 2. List of primary antibodies used for immunohistochemical evaluation.

[0177]

[0178]

[0179] Confocal microscopy and image analysis.

[0180] Confocal images were acquired on a TCS-SP5 confocal microscope system (Leica Microsystems) or an A1R laser scanning confocal microscope (Nikon Instruments). To obtain the count of cone-associated MVs (cone-MVs), in two eyes each from 6-week-old cBest (R25* / P463fs) and age-matched WT controls, in each retinal quadrant (temporal, superior, inferior, and nasal) (n = 80 ROIs / eye) of 10 retinal sections, two adjacent fields 155 μm in length for each region of interest (ROI) were imaged 4 mm from the optic nerve head. Image stacks were acquired with a Z-step of 0.25-μm and deconvolved with Huygens deconvolution software version 17.04 (Scientific Volume Imaging). All deconvolved images were rendered in the Leica LAS X 3D rendering module, where cone-MVs were manually counted. The lengths of cone- and rod-MVs were evaluated based on maximum projection images within the Leica LAS X software. Data were analyzed in Microsoft Excel and quantified using Prism software version 7 (GraphPad).

[0181] References

[0182] 1. Bramall AN, Wright AF, Jacobson SG, McInnes RR (2010) The genomic, biochemical, and cellular responses of the retina in inherited photoreceptor degenerations and prospects for the treatment of these disorders. Annu Rev Neurosci 33:441-472.

[0183] 2. Veleri S, et al. (2015) Biology and therapy of inherited retinal degenerative disease: Insights from mouse models. Dis Model Mech 8:109-129.

[0184] 3. Cideciyan AV (2010) Leber congenital amaurosis due to RPE65 mutations and its treatment with gene therapy. Prog Retin Eye Res 29: 398 - 427.

[0185] 4. Ghazi NG, et al. (2016) Treatment of retinitis pigmentosa due to MERTK mutations by ocular subretinal injection of adeno - associated virus gene vector: Results of a phase I trial. Hum Genet 135: 327 - 343.

[0186] 5. Russell S, et al. (2017) Efficacy and safety of voretigene neparvovec (AAV2 - hRPE65v2) in patients with RPE65 - mediated inherited retinal dystrophy: A randomised, controlled, open - label, phase 3 trial. Lancet 390: 849 - 860.

[0187] 6. Best F (1905) Uber eine hereditare Maculaaffektion. Z Augenheilkd 13: 199 - 212.

[0188] 7. Petrukhin K, et al. (1998) Identification of the gene responsible for Best macular dystrophy. Nat Genet 19: 241 - 247.

[0189] 8. Boon CJ, et aL (2009) The spectrum of ocular phenotypes caused by mutations in the BEST1 gene. Prog Retin Eye Res 28: 187 - 205.

[0190] 9. Marmorstein AD, et al. (2000) Bestrophin, the product of the Best vitelliform macular dystrophy gene (VMD2), localizes to the basolateral plasma membrane of the retinal pigment epithelium. Proc Natl Acad Sci USA 97: 12758 - 12763.

[0191] 10. Sun H, Tsunenari T, Yau KW, Nathans J (2002) The vitelliform macular dystrophy protein defines a new family of chloride channels. Proc Natl Acad Sci USA 99: 4008 - 4013.

[0192] 11. Neussert R, Müller C, Milenkovic VM, Strauss O (2010) The presence of bestrophin1 modulates the Ca2+ recruitment from Ca2+ stores in the ER. Pflugers Arch 460: 163 - 175.

[0193] 12. Hartzell HC, Qu Z, Yu K, Xiao Q, Chien LT (2008) Molecular physiology of bestrophins: Multifunctional membrane proteins linked to Best disease and other retinopathies. Physiol Rev 88: 639 - 672.

[0194] 13. Strauss O, Müller C, Reichhart N, Tamm ER, Gomez NM (2014) The role of bestrophin1 in intracellular Ca(2+) signaling. Adv Exp Med Biol 801: 113 - 119.

[0195] 14. Fischmeister R, Hartzell HC (2005) Volume sensitivity of the bestrophin family of chloride channels. J Physiol 562: 477 - 491.

[0196] 15. Milenkovic A, et al. (2015) Bestrophin 1 is indispensable for volume regulation in human retinal pigment epithelium cells. Proc Natl Acad Sci USA 112: E2630 - E2639.

[0197] 16. Mullins RF, Kuehn MH, Faidley EA, Syed NA, Stone EM (2007) Differential macular and peripheral expression of bestrophin in human eyes and its implication for Best disease. Invest Ophthalmol Vis Sci 48: 3372 - 3380.

[0198] 17. Guziewicz KE, et al. (2017) Bestrophinopathy: An RPE - photoreceptor interface disease. Prog Retin Eye Res 58: 70 - 88.

[0199] 18. Kane Dickson V, Pedi L, Long SB (2014) Structure and insights into the function of a Ca(2+)-activated Cl(-) channel. Nature 516: 213 - 218.

[0200] 19. Yang T, et al. (2014) Structure and selectivity in bestrophin ion channels. Science 346: 355 - 359.

[0201] 20. Vaisey G, Miller AN, Long SB (2016) Distinct regions that control ion selectivity and calcium-dependent activation in the bestrophin ion channel. Proc Natl Acad Sci USA 113: E7399-E7408.

[0202] 21. Deutman AF (1969) Electro-oculography in families with vitelliform dystrophy of the fovea. Detection of the carrier state. Arch Ophthalmol 81: 305-316.

[0203] 22. Arden GB, Constable PA (2006) The electro-oculogram. Prog Retin Eye Res 25: 207-248.

[0204] 23. Guziewicz KE, et al. (2007) Bestrophin gene mutations cause canine multifocal retinopathy: A novel animal model for best disease. Invest Ophthalmol Vis Sci 48: 1959-1967.

[0205] 24. Beltran WA, et al. (2014) Canine retina has a primate fovea-like bouquet of cone photoreceptors which is affected by inherited macular degenerations. PLoS One 9: e90390.

[0206] 25. Hageman GS, Johnson LV (1991) The photoreceptor-retinal pigment epithelium interface. Principles and Practise of Clinical Electrophysiology of Vision, eds Hcckenlively JR, Arden GB (Mosby-Year Book, St. Louis), pp 53-68.

[0207] 26. Strauss O (2005) The retinal pigment epithelium in visual function. Physiol Rev 85: 845-881.

[0208] 27. Huang B, Karwoski CJ (1992) Light-evoked expansion of subretinal space volume in the retina of the frog. J Neurosci 12: 4243-4252.

[0209] 28. Putting BJ, Zweypfenning RC, Vrensen GF, Oosterhuis JA, van Best JA (1992) Blood-retinal barrier dysfunction at the pigment epithelium induced by blue light, Invest Ophthalmol Vis Sci 33: 3385-3393.

[0210] 29. Li JD, Govardovskii VI, Steinberg RH (1994) Light-dependent hydration of the space surrounding photoreceptors in the cat retina. Vis Neurosci 11: 743-752.

[0211] 30. Huang Y, et al. (1998) Relation of optical coherence tomography to microanatomy in normal and rd chickens. Invest Ophthalmol Vis Sci 39: 2405 - 2416.

[0212] 31. Pianta MJ, et al. (2003) In vivo micropathology of Best macular dystrophy with optical coherence tomography. Exp Eye Res 76: 203 - 211.

[0213] 32. Cideciyan AV, et al. (2005) In vivo dynamics of retinal injury and repair in the rhodopsin mutant dog model of human retinitis pigmentosa. Proc Natl Acad Sci USA 102: 5233 - 5238.

[0214] 33. Bizheva K, et al. (2006) Optophysiology: Depth - resolved probing of retinal physiology with functional ultrahigh - resolution optical coherence tomography. Proc Natl Acad Sci USA 103: 5066 - 5071.

[0215] 34. Kay CN, et al. (2012) Three - dimensional distribution of the vitelliform lesion, photoreceptors, and retinal pigment epithelium in the macula of patients with best vitelliform macular dystrophy. Arch Ophthalmol 130: 357 - 364.

[0216] 35. Bissig D, Berkowitz BA (2012) Light-dependent changes in outer retinal water diffusion in rats in vivo. Mol Vis 18: 2561.

[0217] 36. Abràmoff MD, et al. (2013) Human photoreceptor outer segments shorten during light adaptation. Invest Ophthalmol Vis Sci 54: 3721 - 3728.

[0218] 37. Li Y, Faris RN, Qian JW, Cohen ED, Qian H (2016) Light-induced thickening of photoreceptor outer segment layer detected by ultra-high resolution OCT imaging. Invest Ophthalmol Vis Sci 57: OCT105 - OCT111.

[0219] 38. Lu Y, Wang B, Pepperberg DR, Yao X (2016) Stimulus-evoked outer segment changes occur before the hyperpolarization of retinal photoreceptors. Biomed Opt Express 8: 38 - 47.

[0220] 39. Zhang P, et al. (2017) In vivo optophysiology reveals that G-protein activation triggers osmotic swelling and increased light scattering of rod photoreceptors. Proc Natl Acad Sci USA 114: E2937 - E2946.

[0221] 40. Lu CD, et al. (2017) Photoreceptor layer thickness changes during dark adaptation observed with ultrahigh-resolution optical coherence tomography. Invest Ophthalmol Vis Sci 58: 4632-4643.

[0222] 41. Steinberg RH (1985) Interactious between the retinal pigment epithelium and the neural retina. Doc Ophthalmol 60: 327-346.

[0223] 42. Mieziewska K (1996) The interphotoreceptor matrix, a space insight. Microsc Res Tech 35: 463-471.

[0224] 43. Sidjanin DJ, et al. (2002) Canine CNGB3 mutations establish cone degeneration as orthologous to the human achromatopsia locus ACHM3. Hum Mol Genet 11: 1823-1833.

[0225] 44. Komáromy AM, et al. (2013) Transient photoreceptor deconstruction by CNTF enhances rAAV-mediated cone functional rescue in late stage CNGB3-achromatopsia. Mol Ther 21: 1131-1141.

[0226] 45. Acland GM, Aguirre GD (1987) Retinal degenerations in the dog: IV. Early retinal degeneration (erd) in Norwegian elkhounds. Exp Eye Res 44: 491-521.

[0227] 46. Guziewicz KE, et al. (2013) Recombinant AAV-mediated BEST1 transfer to the retinal pigment epithelium: Analysis of serotype-dependent retinal effects. PLoS One 8: e75666.

[0228] 47. Bruewer AR, et al. (2013) Evaluation of lateral spread of transgene expression following subretinal AAV-mediated gene delivery in dogs. PLoS One 8: e60218.

[0229] 48. Beltran WA, et al. (2017) Optimization of retinal gene therapy for X-linked retinitis pigmentosa due to RPGR mutations. Mol Ther 25: 1866-1880.

[0230] 49. Sparrow JR, Hicks D, Hamel CP (2010) The retinal pigment epithelium in health and disease. Curr Mol Med 10: 802-823.

[0231] 50. Jacobson SG, et al. (2008) Photoreceptor layer topography in children with Leber congenital amaurosis caused by RPE65 mutations. Invest Ophthalmol Vis Sci 49: 4573 - 4577.

[0232] 51. Charbel Issa P, et al. (2009) Characterisation of severe rod - cone dystrophy in a consanguineous family with a splice site mutation in the MERTK gene. Br J Ophthalmol 93: 920 - 925.

[0233] 52. Meunier I, et al. (2016) A dominant mutation in MAPKAPK3, an actor of p38 signaling pathway, causes a new retinal dystrophy involving Bruch’s membrane and retinal pigment epithelium. Hum Mol Genet 25: 916 - 926.

[0234] 53. Singh R, et al. (2013) iPS cell modeling of Best disease: Insights into the pathophysiology of an inherited macular degeneration. Hum Mol Genet 22: 593 - 607.

[0235] 54. Bonilha VL, Finnemann SC, Rodriguez - Boulan E (1999) Ezrin promotes morphogenesis of apical microvilli and basal infoldings in retinal pigment epithelium. J Cell Biol 147: 1533 - 1548.

[0236] 55. Koltzscher M, Neumann C, S, Gerke V (2003) Ca2+-dependent binding and activation of dormant Ezrin by dimeric S100P. Mol Biol Cell 14: 2372-2384.

[0237] 56. Bonilha VL, et al. (2006) The retinal pigment epithelium apical microvilli and retinal function. Adv Exp Med Biol 572: 519-524.

[0238] 57. Bonilha VL, Rayborn ME, Saotome I, McClatchey AI, Hollyfield JG (2006) Microvilli defects in retinas of ezrin knockout mice. Exp Eye Res 82: 720-729.

[0239] 58. Philp NJ, Nachmias VT (1985) Components of the cytoskeleton in the retinal pigmented epithelium of the chick. J Cell Biol 101: 358-362.

[0240] 59. Bonilha VL, et al. (2004) Proteomic characterization of isolated retinal pigment epithelium microvilli. Mol Cell Proteomics 3: 1119-1127.

[0241] 60. Gao H, Hollyfield JG (1992) Aging of the human retina. Differential loss of neurons and retinal pigment epithelial cells. Invest Ophthalmol Vis Sci 33: 1-17.

[0242] 61. Kiser PD, Golczak M, Palczewski K (2014) Chemistry of the retinoid (visual) cycle. Chem Rev 114: 194 - 232.

[0243] 62. Miller SS, Steinberg RH (1977) Passive ionic properties of frog retinal pigment epithelium. J Membr Biol 36: 337 - 372.

[0244] 63. Volland S, Esteve - Rudd J, Hoo J, Yee C, Williams DS (2015) A comparison of some organizational characteristics of the mouse central retina and the human macula. PLoS One 10: e0125631.

[0245] 64. Cuenca N, - Lizarán I, Pinilla I (October 13, 2017) Cellular characterization of optical coherence tomography and outer retinal bands using specific immunohistochemistry markers and clinical implications. Ophthalmology, 10.1016 / j.ophtha.2017.09.016.

[0246] 65. Uehara F, Matthes MT, Yasumura D, LaVail MM (1990) Light - evoked changes in the interphotoreceptor matrix. Science 248: 1633 - 1636.

[0247] 66. Jonnal RS, Kocaoglu OP, Wang Q, Lee S, Miller DT (2012) Phase-sensitive imaging of the outer retina using optical coherence tomography and adaptive optics. Biomed Opt Express 3: 104 - 124.

[0248] 67. Hillmann D, et al. (2016) In vivo optical imaging of physiological responses to photostimulation in human photoreceptors. Proc Natl Acad Sci USA 113: 13138 - 13143.

[0249] 68. Bialek S, Miller SS (1994) K+ and Cl- transport mechanisms in bovine pigment epithelium that could modulate subretinal space volume and composition. J Physiol 475: 401 - 417.

[0250] 69. Lu R, Levy AM, Zhang Q, Pittler SJ, Yao X (2013) Dynamic near-infrared imaging reveals transient phototropic change in retinal rod photoreceptors. J Biomed Opt 18: 106013.

[0251] 70. Querques G, et al. (2011) The spectrum of subclinical Best vitelliform macular dystrophy in subjects with mutations in BEST1 gene. Invest Ophthalmol Vis Sci 52: 4678 - 4684.

[0252] 71. Qian CX, et al. (2017) Optical coherence tomography examination of the retinal pigment epithelium in Best vitelliform macular dystrophy. Ophthalmology 124: 456 - 463.

[0253] 72. Kay DB, et al. (2013) Outer retinal structure in best vitelliform macular dystrophy. JAMA Ophthalmol 131: 1207 - 1215.

[0254] 73. Arora R, et al. (2016) Unilateral BEST1 - associated retinopathy. Am J Ophthalmol 169: 24 - 32.

[0255] 74. Scoles D, et al. (2017) Photoreceptor inner segmenr morphology in Best vitelliform macular dystrophy. Retina 37: 741 - 748.

[0256] 75. Abràmoff MD, Mullins RF. Stone EM (2014) Outer segment length in different Best disease genotypes. JAMA Ophthalmol 132: 1152 - 1153.

[0257] 76. Faktorovich EG, Steinberg RH, Yasumura D, Matthes MT, LaVail MM (1990) Photoreceptor degeneration in inherited retinal dystrophy delayed by basic fibroblast growth factor. Nature 347: 83 - 86.

[0258] 77. Milam AH, Li ZY, Fariss RN (1998) Histopathology of the human retina in retinitis pigmentosa. Prog Retin Eye Res 17: 175 - 205.

[0259] 78. Jacobson SG, et al. (2006) Remodeling of the human retina in choroideremia: Rab escort protein 1 (REP-1) mutations. Invest Ophthalmol Vis Sci 47: 4113 - 4120.

[0260] 79. Jacobson SG, Cideciyan AV (2010) Treatment possibilities for retinitis pigmentosa. N Engl J Med 363: 1669 - 1671.

[0261] 80. Cideciyan AV, et al. (2011) Cone photoreceptors are the main targets for gene therapy of NPHP5 (IQCB1) or NPHP6 (CEP290) blindness: Generation of an all-cone Nphp6 hypomorph mouse that mimics the human retinal ciliopathy. Hum Mol Genet 20: 1411 - 1423.

[0262] 81. Sadigh S, et al. (2013) Abnormal thickening as well as thinning of the photoreceptor layer in intermediate age-related macular degeneration. Invest Ophthalmol Vis Sci 54: 1603 - 1612.

[0263] 82. Beltran WA, et al. (2015) Successful arrest of photoreceptor and vision loss expands the therapeutic window of retinal gene therapy to later stages of disease. Proc Natl Acad Sci USA 112: E5844-E5853.

[0264] 83. Johnson AA, et al. (2017) Bestrophin 1 and retinal disease. Prpg Retin Eye Res 58: 45-69.

[0265] 84. Schatz P, Klar J, Andréasson S, Ponjavic V, Dahl N (2006) Variant phenotype of Best vitelliform macular dystrophy associated with compound heterozygous mutations in VMD2. Ophthalmic Genet 27: 51-56.

[0266] 85. Burgess R, et al. (2008) Biallelic mutation of BEST1 causes a distinct retinopathy in humans. Am J Hum Genet 82: 19-31.

[0267] 86. Kinnick TR, et al. (2011) Autosomal recessive vitelliform macular dystrophy in a large cohort of vitelliform macular dystrophy patients. Retina 31: 581-595.

[0268] 87. Bitner H, et al. (2011) A homozygous frameshift mutation in BEST1 causes the classical form of Best disease in an autosomal recessive mode. Invest Ophthalmol Vis Sci 52: 5332-5338.

[0269] 88. Boon CJ, et al. (2013) Autosomal recessive bestrophinopathy: Differential diagnosis and treatment options. Ophthalmology 120: 809-820.

[0270] 89. Lamb TD, Pugh EN. Jr (2004) Dark adaptation and the retinoid cycle of vision. Prog Retin Eye Res 23: 307-380.

[0271] 90. Wang JS, Kefalov VJ (2011) The cone-specific visual cycle. Prpg Retin Eye Res 30: 115-128.

[0272] 91. Kaylor JJ, et al. (2013) Identification of DES1 as a vitamin A isomerase in Müller glial cells of the retina. Nat Chem Biol 9: 30-36.

[0273] 92. Cideciyan AV, Pugh EN. Jr, Lamb TD, Huang Y, Jacobson SG (1997) Rod plateau during dark adaptation in Sorsby’s fundus dystrophy and vitamin A deficiency. Invest Ophthalmol Vis Sci 38: 1786-1794.

[0274] 93. Cideciyan AV, et al. (2000) Rod and cone visual cycle consequences of a null mutation in the 11-cis-retinol dehydrogenase gene in man. Vis Neurosci 17: 667-678.

[0275] 94. Cideciyan AV, et al. (2013) Human cone visual pigment deletions spare sufficient photoreceptors to warrant gene therapy. Hum Gene Ther 24: 993-1006.

[0276] 95. Cideciyan AV, et al. (2007) Reduced-illuminance autofluorescence imaging in ABCA4-associated retinal degenerations. J Opt Soc Am A Opt Image Sci Vis 24: 1457-1467.

[0277] 96. National Research Council (2011) Guide for the Care and Use of Laboratory Animals (Natl Acad Press, Washington, DC), 8th Ed.

[0278] 97. Komáromy AM, Varner SE, de Juan E, Acland GM, Aguirre GD (2006) Application of a new subretinal injection device in the dog. Cell Transplant 15: 511-519.

[0279] 98. Delori F, et al. (2011) Quantitative measurements of autofluorescence with the scanning laser ophthalmoscope. Invest Ophthalmol Vis Sci 52: 9379-9390.

[0280] 99. Beltran WA, Hammond P, Acland GM, Aguirre GD (2006) A frameshift mutation in RPGR exon ORF15 causes photoreceptor degeneration and inner retina remodeling in a model of X-linked retinitis pigmentosa. Invest Ophthalmol Vis Sci 47: 1669-1681.

[0281] Other embodiments

[0282] All features disclosed in this specification can be combined in any combination. Each feature disclosed in this specification can be replaced by an alternative feature having the same, equivalent, or similar purpose. Therefore, unless otherwise expressly stated, each feature disclosed is only an example of a series of equivalent or similar generic features.

[0283] Based on the above description, those skilled in the art can easily determine the basic features of the present disclosure, and without departing from the spirit and scope of the present disclosure, various changes and modifications can be made to the present disclosure to adapt it to multiple uses and situations. Therefore, other embodiments are also within the scope of the claims.

[0284] Equivalent solutions

[0285] Although several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily conceive of many other methods and / or structures for performing the functions and / or obtaining the results and / or one or more of the advantages described herein, and it is contemplated that each such variation and / or modification is within the scope of the embodiments of the present invention described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are intended to be exemplary, and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application for which the teachings of the present invention are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Accordingly, it is to be understood that the foregoing embodiments are presented by way of example only, and that within the scope of the appended claims and their equivalents, the embodiments of the present invention may be practiced otherwise than as specifically described and claimed. Embodiments of the present disclosure relate to each and every separate feature, system, article, material, kit, and / or method described herein. Additionally, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is also included within the scope of the invention of the present disclosure.

[0286] All definitions defined and used herein are to be understood as precedence over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0287] All references, patents, and patent applications disclosed herein are incorporated by reference for the subject matter to which each is cited, and in some cases, may cover the entire content of the document.

[0288] Unless the context clearly dictates the contrary, a noun in the specification and claims herein that is not qualified with a quantifier is to be understood to mean "at least one".

[0289] As used herein in the specification and claims, the phrase "and / or" shall be understood to mean "either, or both" of the elements so joined, i.e., elements that may be present jointly in some cases and separately in other cases. Multiple elements listed with "and / or" shall be construed in the same manner, i.e., "one or more" of the elements so joined. Other elements may optionally be present in addition to those specifically identified by the "and / or" clause, whether related or unrelated to those specifically identified. Thus, as a non-limiting example, when used in conjunction with open-ended language such as "comprising / include", a reference to "A and / or B" may in one embodiment refer to only A (optionally including elements other than B); in another embodiment, only to B (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); and so forth.

[0290] As used herein in the specification and claims, "or / or" shall be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or / or" or "and / or" shall be interpreted inclusively, i.e., including at least one of a plurality of elements or a list of elements, but also including more than one, and optionally including additional unlisted items. Only the expressly stated contrary terms, such as "only one of" or "exactly one of", or when used in the claims "consisting of", refer to including exactly one element of a plurality of elements or a list of elements. In general, when preceded by an exclusive term (such as "any", "one of", "only one of" or "exactly one of"), the term "or / or" as used herein shall be interpreted only to mean an exclusive alternative (i.e., "one or the other, but not both"). "Consisting essentially of" shall have its ordinary meaning as used in the field of patent law when used in the claims.

[0291] As used herein in the specification and claims, the phrase "at least one" in reference to a list of one or more elements should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically recited in the list of elements, and also not excluding any combinations of elements in the list of elements. This definition also allows for the optional presence of elements other than those specifically recited in the list of elements to which the phrase "at least one" refers, whether related or unrelated to those specifically recited elements. Thus, as a non-limiting example, "at least one of A and B" (or equivalently, "at least one of A or B", or equivalently, "at least one of A and / or B") can in one embodiment refer to at least one A, optionally including more than one A, but no B (and optionally including elements other than B); in another embodiment, it can refer to at least one B, optionally including more than one B, but no A (and optionally including elements other than A); in yet another embodiment, it can refer to at least one A, optionally including more than one A, and at least one B, optionally including more than one B (and optionally including other elements); and so on.

[0292] It should also be understood that, unless explicitly indicated to the contrary, in any method claimed herein that includes more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

[0293] In the claims and in the above specification, all conjunctive terms such as "comprising", "including", "carrying", "having", "containing", "involving", "holding", "consisting of", etc. should be understood to be open-ended, i.e., meaning including but not limited to. As set forth in section 2111.03 of the United States Patent Office Manual of Patent Examining Procedures, only the conjunctive terms "consisting of" and "consisting essentially of" should be closed or semi-closed conjunctive terms, respectively. It should be understood that embodiments described in this document using open-ended conjunctive terms (e.g., "comprising / including") are also contemplated in some alternative embodiments as "consisting of the features described by the open-ended conjunctive term" and "consisting essentially of the features described by the open-ended conjunctive term". For example, if the disclosure describes "a composition comprising A and B", the disclosure also contemplates the following alternative embodiments: "a composition consisting of A and B" and "a composition consisting essentially of A and B".

[0294] The following corresponds to the original claims in the parent application and is hereby incorporated herein by reference as part of the specification:

[0295] 1. Short hairpin RNA (shRNA), comprising:

[0296] a) A sense strand comprising the nucleotide sequence CGUCAAAAGCUUCACAGUGU (SEQ ID NO:2) and an antisense strand comprising the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO:3); and

[0297] b) A loop.

[0298] 2. The shRNA according to item 1, wherein the loop comprises the nucleotide sequence UUCAAGAGA (SEQ ID NO:7).

[0299] 3. The shRNA according to item 1, wherein the shRNA comprises the nucleotide sequence CGUCAAAGCUUCACAGUGUUUCAAGAGAACACUGUGAAGCUUUGACG (SEQ ID NO:1).

[0300] 4. A vector encoding the shRNA according to any one of items 1 to 3.

[0301] 5. The vector according to item 4, further comprising a recombinant BEST1 coding sequence that does not contain the sequence targeted by the shRNA.

[0302] 6. The vector according to item 5, wherein the recombinant BEST1 coding sequence is codon-optimized for expression in human cells.

[0303] 7. The vector according to item 5 or 6, wherein the recombinant BEST1 coding sequence comprises a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO:9.

[0304] 8. The vector according to item 7, wherein the recombinant BEST1 coding sequence comprises the nucleotide sequence of SEQ ID NO:9.

[0305] 9. A vector encoding the shRNA according to any one of items 1 to 3 and a recombinant BEST1 sequence, which comprises a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO:11.

[0306] 10. The vector according to item 9, wherein the vector comprises the nucleotide sequence of SEQ ID NO:11.

[0307] 11. The vector according to any one of items 4 to 10, wherein the vector is a plasmid.

[0308] 12. The vector according to any one of items 4 to 10, wherein the vector is a viral vector.

[0309] 13. The vector according to item 12, wherein the viral vector is a recombinant adeno-associated virus (rAAV) vector.

[0310] 14. The vector according to item 13, wherein the rAAV vector is self-complementary.

[0311] 15. A recombinant adeno-associated virus (rAAV) particle comprising the rAAV vector according to item 13 or 14.

[0312] 16. The rAAV particle according to item 15, wherein the rAAV viral particle is an AAV serotype 2 (AAV2) viral particle.

[0313] 17. A composition comprising the vector according to any one of items 4 to 14, or the rAAV particle according to item 15 or 16, and a pharmaceutically acceptable carrier.

[0314] 18. A method for modulating BEST1 expression in a subject, the method comprising administering to the subject the composition according to item 17.

[0315] 19. A method for treating vitelliform macular degeneration in a subject, the method comprising administering to the subject the composition according to item 17.

[0316] 20. The method according to item 18 or 19, wherein the subject is a human subject.

[0317] 21. The composition according to item 17, which is used for treating vitelliform macular degeneration.

[0318] 22. The composition according to item 17, which is used for manufacturing a drug for treating vitelliform macular degeneration.

[0319] 23. Use of the composition according to item 17 in the treatment of vitelliform macular degeneration.

[0320] 24. Use of the composition according to item 17 in the manufacture of a drug for treating vitelliform macular degeneration.

[0321] 25. A method for treating autosomal recessive vitelliform macular dystrophy (ARB) in a subject, the method comprising administering to the subject the composition according to item 17.

[0322] 26. The method according to item 25, wherein the subject is a human subject.

[0323] 27. The composition according to item 17, which is used for treating ARB.

[0324] 28. The composition according to item 17, which is used for manufacturing a drug for treating ARB.

[0325] 29. Use of the composition according to item 17 in treating ARB.

[0326] 30. Use of the composition according to item 17 in manufacturing a drug for treating ARB.

[0327] 31. Short hairpin RNA (shRNA), which comprises an antisense strand containing the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3).

Claims

1. Short hairpin RNA (shRNA), comprising: a) a sense strand comprising the nucleotide sequence CGUCAAAGCUUCACAGUGU (SEQ ID NO:2) and an antisense strand comprising the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO:3); and b) a loop.

2. The shRNA according to claim 1, wherein the loop comprises the nucleotide sequence UUCAAGAGA (SEQ ID NO:7).

3. The shRNA according to claim 1, wherein the shRNA comprises the nucleotide sequence CGUCAAAGCUUCACAGUGUUUCAAGAGAACACUGUGAAGCUUUGACG (SEQ ID NO:1).

4. A vector encoding the shRNA according to any one of claims 1 to 3.

5. The vector according to claim 4, further comprising a recombinant BEST1 coding sequence that does not contain the sequence targeted by the shRNA.

6. The vector according to claim 5, wherein the recombinant BEST1 coding sequence is codon-optimized for expression in human cells.

7. The vector according to claim 5 or 6, wherein the recombinant BEST1 coding sequence comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO:

9.

8. The vector according to claim 7, wherein the recombinant BEST1 coding sequence comprises the nucleotide sequence of SEQ ID NO:

9.

9. A vector encoding the shRNA according to any one of claims 1 to 3 and a recombinant BEST1 sequence, which comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQID NO:

11.

10. The vector according to claim 9, wherein the vector comprises the nucleotide sequence of SEQ ID NO:

11.

11. The vector according to any one of claims 4 to 10, wherein the vector is a plasmid.

12. The vector according to any one of claims 4 to 10, wherein the vector is a viral vector.

13. The vector according to claim 12, wherein the viral vector is a recombinant adeno-associated virus (rAAV) vector.

14. The vector according to claim 13, wherein the rAAV vector is self-complementary.

15. A recombinant adeno-associated virus (rAAV) particle comprising the rAAV vector according to claim 13 or 14.

16. The rAAV particle according to claim 15, wherein the rAAV viral particle is an AAV serotype 2 (AAV2) viral particle.

17. A composition comprising the vector according to any one of claims 4 to 14, or the rAAV particle according to claim 15 or 16, and a pharmaceutically acceptable carrier.

18. A method of modulating BEST1 expression in a subject, the method comprising administering to the subject the composition according to claim 17.

19. A method for treating vitelliform macular degeneration in a subject, the method comprising administering to the subject the composition of claim 17.

20. The method of claim 18 or 19, wherein the subject is a human subject.

21. The composition of claim 17, which is used for treating vitelliform macular degeneration.

22. The composition of claim 17, which is used for manufacturing a medicament for treating vitelliform macular degeneration.

23. Use of the composition of claim 17 in treating vitelliform macular degeneration.

24. Use of the composition of claim 17 in manufacturing a medicament for treating vitelliform macular degeneration.

25. A method for treating autosomal recessive vitelliform macular dystrophy (ARB) in a subject, the method comprising administering to the subject the composition of claim 17.

26. The method of claim 25, wherein the subject is a human subject.

27. The composition of claim 17, which is used for treating ARB.

28. The composition of claim 17, which is used for manufacturing a medicament for treating ARB.

29. Use of the composition of claim 17 in treating ARB.

30. Use of the composition of claim 17 in manufacturing a medicament for treating ARB.

31. Short hairpin RNA (shRNA) comprising an antisense strand containing the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO:3).

Images