Biomedical applications of 3,29-dibenzoyltrichosamine diol

Abstract

This invention discloses the biomedical applications of 3,29-dibenzoyltrichosanthes glycol, specifically including its use in inhibiting the physiological activities of coronaviruses and in the preparation of drugs for the prevention and treatment of coronavirus infectious diseases. This invention is the first to propose that the triterpenoid compound 3,29-dibenzoyltrichosanthes glycol can inhibit the replication of porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, and porcine deltacoronavirus; experimental data show that this compound can effectively prevent and treat porcine epidemic diarrhea and has good application prospects in the domestic pig farming industry.

Description

Technical Field

[0001] This invention relates to terpenoid compounds, and more particularly to the biomedical uses of 3,29-dibenzoyltrichosanthes glycol. Background Technology

[0002] As an important economic animal, pigs have been frequently attacked by various coronaviruses in recent years. Among them, porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), and porcine deltacoronavirus (PDCoV) are three typical enteropathogenic coronaviruses. PEDV and TGEV belong to the genus α-coronavirus, while PDCoV is classified into the genus δ-coronavirus. All three are enveloped single-stranded positive-sense RNA viruses. Their high genomic variability makes them prone to recombination or mutation, and even the possibility of cross-species transmission. It has been reported that porcine deltacoronavirus has zoonotic infectiousness (Lednicky, John A et al. "Independent infections of porcine deltacoronavirus among Haitian children." Nature vol.600,7887(2021):133-137.), which significantly increases the difficulty of prevention and control.

[0003] These viruses primarily attack the intestinal epithelial cells of domestic pigs, causing severe watery diarrhea, vomiting, and dehydration. The mortality rate is particularly high in newborn piglets, reaching 100%, resulting in billions of dollars in economic losses to the global pig industry annually. Despite ongoing vaccine development, existing vaccines (such as inactivated or attenuated PEDV vaccines) are insufficient to provide complete protection in the field due to issues like viral antigen drift and inadequate mucosal immune responses, meaning outbreaks can still occur in immunized herds. Vaccine development against TGEV and PDCoV is even slower, with no mature commercial products yet available. Simultaneously, clinical treatment options are extremely limited, currently relying solely on supportive therapies such as fluid resuscitation and electrolyte balance, lacking specific antiviral drugs. This creates a dual dilemma of "difficult prevention and inadequate treatment" in virus control.

[0004] Against this backdrop, natural compounds, due to their structural diversity and low toxicity, have become a crucial breakthrough in the development of antiviral drugs. Triterpenoids, as one of the core families of natural products, have demonstrated broad-spectrum antiviral potential; for example, the inhibitory effects of glycyrrhizic acid on HIV and SARS-CoV-2, and the anti-influenza virus activity of betulinic acid, have both been confirmed. However, there is currently no research on the use of triterpenoids for the prevention and treatment of porcine susceptible coronaviruses. Summary of the Invention

[0005] Purpose of the invention: The purpose of this invention is to provide the application of 3,29-dibenzoyltrichosanthes glycol in inhibiting coronaviruses and in the preparation of drugs for the prevention and treatment of coronavirus infectious diseases.

[0006] Technical solution: The application of 3,29-dibenzoyltrichosanthes glycol in inhibiting the physiological activities of coronaviruses.

[0007] Preferably, the concentration of 3,29-dibenzoyltrichosanthes glycol in the application is not less than 8 μM.

[0008] Preferably, the application is to inhibit coronavirus replication.

[0009] Preferably, the coronavirus includes porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, and porcine deltacoronavirus.

[0010] The application of 3,29-dibenzoyltrichosanthes glycol described in this invention in the preparation of drugs for the prevention and treatment of coronavirus infectious diseases.

[0011] Preferably, the coronavirus includes porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, and porcine deltacoronavirus.

[0012] Preferably, the application is the preparation of a drug for preventing and treating intestinal infectious diseases in livestock caused by coronaviruses.

[0013] Preferably, the coronaviruses that cause intestinal infectious diseases in livestock include swine epidemic diarrhea, swine transmissible gastroenteritis, and swine deltacoronavirus infection.

[0014] Preferably, the drug comprises 3,29-dibenzoyltrichosanthes glycol as the active ingredient and pharmaceutically acceptable excipients.

[0015] Preferably, the dosage form of the drug is granules, tablets, capsules, oral liquid, pills, emulsions, suspensions, injections, infusions, or sprays.

[0016] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. It is the first time that the triterpenoid compound 3,29-dibenzoyltrichosanthes glycol has been proposed to inhibit the replication of porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, and porcine deltacoronavirus; 2. It can effectively prevent and treat porcine epidemic diarrhea and has good application prospects in the domestic pig farming industry. Attached Figure Description

[0017] Figure 1 Figure showing the results of a CCK8 study on the cytotoxicity of 3,29-dibenzoyltrichosanthes diol in IPEC-J2 and LLC-PK1 cells;

[0018] Figure 2Figure showing the results of qRT-PCR detection of the expression level of PEDV M gene by 3,29-dibenzoyltrichosanthes diol in IPEC-J2 cells; **P<0.01, ns: no significant;

[0019] Figure 3 Figure showing the results of qRT-PCR detection of different concentrations of 3,29-dibenzoyltrichosanthes diol on the expression level of TGEV N gene in IPEC-J2 cells; **P<0.01, ns: no significant;

[0020] Figure 4 Figure showing the results of qRT-PCR detection of different concentrations of 3,29-dibenzoyltrichosanthes glycol on the expression level of PDCoV N gene in LLC-PK1 cells; **P<0.01, ns: no significant;

[0021] Figure 5 Figure 1 shows the results of the TCID50 method for detecting the virulence of different concentrations of 3,29-dibenzoyltrichosanthes glycol against PEDV virus in IPEC-J2 cells; **P<0.01;

[0022] Figure 6 Figure 1 shows the results of the TCID50 method for detecting the virulence of different concentrations of 3,29-dibenzoyltrichosanthes glycol against TGEV virus in IPEC-J2 cells; **P<0.01;

[0023] Figure 7 Figure 1 shows the results of the TCID50 method for detecting the virulence of different concentrations of 3,29-dibenzoyltrichosanthes glycol against PDCoV virus in LLC-PK1 cells; **P<0.01;

[0024] Figure 8 Figure showing the results of Western blot analysis of the expression level of PEDV N protein in IPEC-J2 cells by different concentrations of 3,29-dibenzoyltrichosanthes diol;

[0025] Figure 9 Figure showing the results of Western blot analysis of the expression level of TGEV N protein in LLC-PK1 cells at different concentrations of 3,29-dibenzoyltrichosanthes diol.

[0026] Figure 10 Figure 1 shows the results of Western blot analysis of the expression level of PDCoV M protein in LLC-PK1 cells at different concentrations of 3,29-dibenzoyltrichosanthes glycol.

[0027] Figure 11 The experimental flowchart for the prevention of PEDV infection in pigs using 3,29-dibenzoyltrichosanthes glycol;

[0028] Figure 12 Figure 1 shows the results of qRT-PCR detection of different concentrations of 3,29-dibenzoyltrichosanthes diol on the PEDV M gene copy number in pig individuals. **P<0.01;

[0029] Figure 13 Figure showing the results of Western blot analysis of the expression level of PEDV N protein by different concentrations of 3,29-dibenzoyltrichosanthes diol in pig individuals;

[0030] Figure 14 Figure shows the results of an immunofluorescence study on the expression level of PEDV N protein in pig individuals by different concentrations of 3,29-dibenzoyltrichosanthes diol. Detailed Implementation

[0031] The technical solution of the present invention will be further described below.

[0032] Example 1: Cytotoxicity of 3,29-Dibenzoyltrichosanthes diol

[0033] IPEC-J2 and LLC-PK1 cells were seeded at approximately 4000 cells / well in 96-well plates. After 24 h, 3,29-dibenzoyltrichosanthes glycol was diluted to different concentrations (1, 1.5, 2, 2.5, 5, 10, 20, 50, 100 μM) in DMEM medium and added to each well at a concentration of 100 μL. A blank control group was included. Each concentration was replicated in 6 wells. After 24 h of incubation, 100 μL of Opti-MEM medium containing 10 μL of CCK-8 reagent was added to each well. After incubation in the dark for 2 h, the absorbance was measured at 450 nm using a microplate reader to calculate cell viability.

[0034] The results are as follows Figure 1 As shown, the CC50 value of 3,29-dibenzoyltrichosanthes glycol in IPEC-J2 cells was 160.5 μM, and the CC50 value in LLC-PK1 cells was 187.8 μM.

[0035] Example 2: 3,29-Dibenzoyltrichosanthes glycol inhibits the replication of PEDV, TGEV, and PDCoV.

[0036] Treatment with 1,3,29-dibenzoyltrichosanthes glycol inhibits the expression of coronavirus structural protein genes.

[0037] (1) IPEC-J2 cells and LLC-PK1 cells were seeded in 12-well plates. After the cells adhered, different concentrations of 3,29-dibenzoyltrichosanthes glycol (2, 5, 8, 12, 15 μM) were added and incubated for 24 h. Then, PEDV, TGEV or PDCoV with MOI=1 were added respectively.

[0038] (2) After 24 hours of viral infection, the viral supernatant was collected for later use. Then, Trizol was added to lyse the cells, and the cell RNA was extracted according to the Trizol reagent extraction instructions. The RNA was reverse transcribed into cDNA, and the copy number of PEDV M gene, TGEVN gene and PDCoV N gene was detected by qPCR using cDNA as a template.

[0039] The 20 μL reverse transcription reaction system contained: 1000 ng cDNA, 4 μL 5x HiScriptⅢqRT SuperMix, and ddH2O to a final volume of 20 μL. The reaction program was: 37℃ for 15 min; 85℃ for 5 s; and stored at 4℃ for later use.

[0040] The 10 μL qPCR reaction mixture contained: 1 μL cDNA, 0.2 μL upstream primer, 0.2 μL downstream primer, 5 μL SYBR Green Master Mix, and 3.6 μL ddH2O. The reaction program was: 95℃ for 5 min; 95℃ for 10 s, 60℃ for 30 s, for 40 cycles.

[0041] PEDV M gene amplification primer sequences: PEDV MF: AGGTCTGCATTCCAGTGCTT, PEDV MR: GGACATAGAAAGCCCAACCA; TGEV N gene amplification primer sequences: TGEV NF: CAATTCCCGTGGTCGGAAGA, TGEV NR: TTTACGTTGGCCCTTCACCA; PDCoV N gene amplification primer sequences: PDCoV NF: CCCAGCTCAAGGTTTCAGAG, PDCoV NR: ATTGGCACCAGTGCGAGACC.

[0042] The results of viral gene expression detection indicate that, Figure 2 As shown, when the concentration of 3,29-dibenzoyltrichosanthes glycol is above 12 μM, it can significantly inhibit the copy of the PEDV M gene; Figure 3 , 4 As shown, 3,29-dibenzoyltrichosanthes glycol at concentrations above 8 μM can significantly reduce the copy number of TGEV and PDCoV.

[0043] Treatment with 2,3,29-dibenzoyltrichosanthes glycol reduced coronavirus titers.

[0044] (1) Seed cells at approximately 8,000 cells / well in a 96-well plate. After the cells adhere to the plate, discard the supernatant. Then, perform a series of 10-fold serial dilutions on the viral supernatant collected in the previous steps, diluting it a total of 8 times before adding it to the 96-well plate.

[0045] (2) After 7 days of culture, the positive rate of cytopathic effect in each well was observed and recorded. The TCID50 value of each experimental group was calculated by Reed-Muench method as the viral titer value.

[0046] The results showed that, Figure 5 As shown, compared with the control group, the PEDV viral titer decreased significantly when the concentration of 3,29-dibenzoyltrichosanthes glycol was 12 μM or higher; Figure 6 , 7 As shown, 3,29-dibenzoyltrichosanthes glycol at concentrations above 8 μM can significantly reduce the viral titers of TGEV and PDCoV. These results indicate that 3,29-dibenzoyltrichosanthes glycol can inhibit the replication of these three viruses in host cells.

[0047] 3. Treatment with 3,29-dibenzoyltrichosanthes glycol inhibits the expression of coronavirus structural proteins.

[0048] (1) Cells were seeded in 6-well plates. After the cells adhered, the culture medium was discarded and replaced with DMEM medium containing 2, 5, 8, 12 and 15 μM of 3,29-dibenzoyltrichosanthes diol. After culturing for 24 h, the supernatant was discarded and PEDV, TGEV and PDCoV viruses were inoculated at a multiplicity of infection (MOI) of 1. After 24 h, total protein was extracted using RIPA lysis buffer.

[0049] (2) After determining the protein concentration using the BCA method, a Western blot experiment was performed, with a protein loading amount of 20 μg. Electrophoresis was performed using 1× Tris-glycine-SDS (TGS) electrophoresis buffer, and electrophoresis was stopped when all the blue bromophenol blue had eluted. The protein was transferred to a PVDF membrane at a constant current of 300 mA for 1 h in Tris-glycine-methanol transfer buffer. Blocking was performed using 5% skim milk at room temperature for 2 h. After washing three times with PBST, diluted GAPDH (1:5000) and PEDVN (1:1000) were added, and the membrane was incubated overnight at 4°C. After washing three times with PBST, goat anti-mouse secondary antibody (1:5000) was added, and the membrane was incubated at room temperature for 2 h. After washing three times, the membrane was developed using ECL developing solution.

[0050] The results showed that, Figure 8As shown, compared with the control group, the expression of PEDV N protein was inhibited when the concentration of 3,29-dibenzoyltrichosanthes glycol was 12 μM or higher; Figure 9 , 10 As shown, 3,29-dibenzoyltrichosanthes glycol at concentrations above 8 μM can inhibit the expression of TGEV and PDCoV viral proteins. These results further demonstrate that 3,29-dibenzoyltrichosanthes glycol can significantly inhibit the replication of the three viruses in host cells.

[0051] Example 3: 3,29-Dibenzoyltrichosanthes glycol for the prevention of PEDV infection

[0052] 1. Eighteen Large White pigs were housed in a sterile environment. The indoor temperature was maintained at 24±2℃ during the experiment. All pigs had free access to food and water. All pigs were randomly assigned to the following groups: PBS control group (Mock), 5 mg / kg 3,29-dibenzoyltrifolin glycol treatment group (5 mg / kg DIKA), 10 mg / kg 3,29-dibenzoyltrifolin glycol treatment group (10 mg / kg DIKA), PBS+PEDV infection treatment group (PEDV), 5 mg / kg 3,29-dibenzoyltrifolin glycol + PEDV infection treatment group (5 mg / kg DIKA + PEDV), and 10 mg / kg 3,29-dibenzoyltrifolin glycol + PEDV infection treatment group (10 mg / kg DIKA), with 3 pigs in each group.

[0053] 2. All pigs were orally administered PBS or 3,29-dibenzoyltrichosanthes glycol solution twice daily, according to the dosages specified in the above groupings. Two days later, the large white pigs in the PBS + PEDV infection treatment group and the 3,29-dibenzoyltrichosanthes glycol + PEDV infection treatment group were orally administered 300 μL of the solution with milk powder. The viral titer was 10. 4.5 PEDV, control group and 3,29-dibenzoyltrichosanthes glycol treatment group large white pigs were orally administered 300 μL of PBS with milk powder;

[0054] 3. Three days after treatment, under the guidance of a veterinarian, intestinal tissue was collected from all groups of pigs. Some tissue was preserved in fixative and some was preserved in a -80°C freezer for later use.

[0055] 3.1 The copy number of the PEDV M gene in the collected pig intestinal tissue was determined by qRT-PCR, using the same primers as in Example 1.

[0056] The qRT-PCR reaction system is shown in Table 1, and the reaction conditions are shown in Table 2.

[0057] Table 1 qRT-PCR reaction system

[0058] Composition volume SYBR Green Master Mix 5μL 10μM upstream primer 0.2μL 10μM downstream primer 0.2μL DNA template 1μL <![CDATA[ddH2O]]> Add to 10 μL

[0059] Table 2 qRT-PCR reaction conditions

[0060]

[0061] The mean Ct value of the PEDV M gene in collected porcine intestinal tissue was obtained using three replicate qPCR reactions, and the PEDV copy number was identified based on the standard curve.

[0062] The results are as follows Figure 12 As shown, the addition of 3,29-dibenzoyltrichosanthes glycol significantly reduced the viral copy number. When the concentration of 3,29-dibenzoyltrichosanthes glycol was 5 mg / kg, the viral copy number decreased extremely significantly. These results indicate that 3,29-dibenzoyltrichosanthes glycol can prevent PEDV.

[0063] 3.2. Western blot was used to detect the expression level of PEDV N protein in all pigs (specific samples). The protein concentration was detected using the BCA method, and the protein loading amount was kept consistent at 20 μg. The specific steps of WB were the same as in Example 2.

[0064] The results are as follows Figure 13 As shown, the addition of 3,29-dibenzoyltrichosanthes glycol significantly reduced the expression of PEDV N protein. When the concentration of 3,29-dibenzoyltrichosanthes glycol was 5 mg / kg, the expression of PEDV N protein was lower than that at 10 mg / kg. These results indicate that 3,29-dibenzoyltrichosanthes glycol can prevent and treat PEDV infection.

[0065] 4. Porcine intestinal tissue preserved in fixative was dehydrated, embedded, and sectioned to a thickness of 2 μm. It was then immersed in 0.01 M sodium citrate solution, heat-retarded, and naturally cooled.

[0066] 3% H2O2 was added to the surface of the tissue section and incubated at room temperature for 20 min to remove endogenous peroxidase; after rinsing, 5% goat serum was added and incubated at room temperature for 1 h for blocking.

[0067] Dilute the mouse-derived PEDV N protein primary antibody to the working concentration, drop it onto the tissue surface, place it in a humidified chamber, and incubate at 4°C for 18 hours. Then, wash the tissue three times with PBS for 5 minutes each time.

[0068] Dilute the goat anti-mouse secondary antibody to the working concentration, drop it onto the tissue surface, place it in a humidified chamber, incubate at 37°C for 1 hour, and then wash with PBS 3 times for 5 minutes each time.

[0069] After mounting with DAPI-containing mounting medium, observe the specimen.

[0070] The results are as follows Figure 14As shown, the addition of 3,29-dibenzoyltrichosanthes glycol significantly reduced the expression of PEDV N protein. When the concentration of 3,29-dibenzoyltrichosanthes glycol was 5 mg / kg, the expression of PEDV N protein was lower than that at 10 mg / kg. These results indicate that 3,29-dibenzoyltrichosanthes glycol can prevent and treat PEDV infection.

Claims

1. The application of 3,29-dibenzoyltrichosanthes glycol in the preparation of drugs for the prevention and treatment of coronavirus infectious diseases, wherein, The coronaviruses mentioned are porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, and porcine deltacoronavirus.

2. The application of 3,29-dibenzoyltrichosanthes glycol in the preparation of a drug for preventing and treating intestinal infectious diseases in pigs caused by coronavirus, wherein, The coronaviruses include porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, and porcine deltacoronavirus, and the intestinal infectious diseases of pigs caused by the coronaviruses are porcine epidemic diarrhea, porcine transmissible gastroenteritis, and porcine deltacoronavirus infection.

3. The application according to claim 1 or 2, characterized in that, The drug contains 3,29-dibenzoyltrichosanthes glycol as the active ingredient and pharmaceutically acceptable excipients.

4. The application according to claim 3, characterized in that, The dosage form of the drug is granules, tablets, capsules, oral liquid, pills, emulsions, suspensions, injections, infusions, or sprays.

Images