A method for isolation and culture of mouse midpalatal suture stem cells

Abstract

The present application relates to a kind of mouse palatine midline stem cell separation and culture method, belong to stem cell separation culture technical field.The method of the present application includes the following steps: S1: separation 3-5 days old mouse maxillary tissue, retain palatine midline and its two sides tissue, tear two sides tissue along palatine midline, obtain unilateral palatine midline tissue;S2: with the medium containing serum, antibiotic and growth factor is cultured within 7 days in step S1 unilateral palatine midline tissue, obtain primary mouse palatine midline stem cell;The growth factor includes at least one of epidermal cell growth factor, fibroblast growth factor and transforming growth factor;S3: step S2 primary mouse palatine midline stem cell is subcultured, and obtain subculture mouse palatine midline stem cell.The method of the present application greatly shortens experimental time, and the palatine midline stem cell extracted is high, and it is convenient to operate, and it provides basis for the repair of cleft palate and other congenital developmental deformity.

Description

Technical Field

[0001] This invention relates to the field of stem cell isolation and culture technology, and in particular to a method for isolating and culturing mouse palatal raphe stem cells. Background Technology

[0002] The isolation and culture of mouse stem cells is fundamental to many biological experiments. Current techniques primarily involve isolating and culturing mesenchymal stem cells (MSCs) from tissues such as mouse long bone bone marrow. The closest technique to this one is the extraction and culture of suture stem cells (SuSCs) from the cranial sutures of newborn mice. The isolation and culture process mainly involves: incising the skin and subcutaneous tissue, removing attached connective tissue and periosteum, separating from the dura mater, cutting bone fragments from the suture region into small segments, seeding them in a culture dish, and passaged after the primary suture stem cells have adhered and grown for 9–12 days.

[0003] However, palatal suture stem cells and cranial suture stem cells have different biological characteristics. For example, existing methods for extracting bone suture stem cells are often used to extract palatal suture stem cells, which have the following drawbacks:

[0004] (1) Palatal suture stem cells and cranial suture stem cells differ in anatomical location, biological characteristics, and clinical applications, and cranial suture stem cells or mesenchymal stem cells cannot be used as substitutes for palatal suture stem cells. The palatal suture is located between the palatine bones of the maxilla, which differs from the location of the cranial sutures. Therefore, the characteristic gene expression and functions of palatal suture stem cells and cranial suture stem cells are also different. Palatal suture stem cells tend to differentiate into osteoblasts, chondrocytes, and mesenchymal matrix cells related to palatal development, playing an important role in the repair of cleft lip and palate and palatal regeneration. Cranial suture stem cells, on the other hand, tend to differentiate into osteoblasts, periosteal cells, and cranial mesenchymal cells, playing a key role in cranial growth, cranial suture closure, and cranial repair. Therefore, it is necessary to extract palatal suture stem cells for the repair of congenital malformations such as cleft palate, precisely targeting the palate to further achieve precise autologous healing.

[0005] (2) Existing methods for extracting cranial suture stem cells are not suitable for extracting mid-palatal suture stem cells. This is because the tissue at the cranial sutures is relatively loose, allowing for the removal of skin, subcutaneous tissue, connective tissue, and dura mater during stem cell extraction, leaving only the bone tissue of the sutures for culturing stem cells. However, the tissue at the mid-palatal suture is dense, making it impossible to separate the mucosa, connective tissue, periosteum, and bone tissue. Therefore, it is impossible to isolate the bone tissue from the mid-palatal suture area, making the extraction of mid-palatal suture stem cells more difficult and affecting their purity. Thus, the existing methods for culturing cranial suture stem cells are unsuitable for extracting mid-palatal suture stem cells. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a simple and efficient method for isolating and culturing palatal raphe stem cells.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] A method for isolating and culturing mouse palatal raphe stem cells, comprising the following steps:

[0009] S1: Separate the maxillary tissue of 3-5 day old mice, retain the palatal midline and the tissues on both sides, tear open the tissues on both sides along the palatal midline to obtain the unilateral palatal midline tissue;

[0010] S2: Primary mouse palatal raphe stem cells are obtained by culturing the unilateral palatal raphe tissue from step S1 in a culture medium containing serum, antibiotics, and growth factors within 7 days; the growth factors include at least one of epidermal growth factor, fibroblast growth factor, and transforming growth factor.

[0011] S3: Passage the primary mouse palatal raphe stem cells from step S2 to obtain passaged mouse palatal raphe stem cells.

[0012] Primary cells cultured for 7 days exhibit higher stem cell activity. During the first 7 days of adherent culture, stem cells primarily migrate out of the palatal raphe; after 7 days, other cells begin to migrate out, thus affecting the stem cell activity and purity of palatal raphe stem cells. Palatal raphe stem cells extracted from mice younger than 5 days old show significantly higher stem cell activity than those extracted from mice older than 5 days old.

[0013] In a specific embodiment of the present invention, the mice in step S1 are 5 days old.

[0014] Further, in step S1, the mice are disinfected by immersing them in ethanol with a concentration greater than 75% v / v and then euthanized, preferably with an ethanol concentration of 75% v / v.

[0015] Furthermore, the soaking time is 1–2 minutes, preferably 2 minutes. Note that the soaking time should not be too long to avoid affecting the activity of palatal raphe stem cells.

[0016] Furthermore, in step S1, the palatal midline and 1-2 mm of tissue on both sides are preserved. The tissue at the palatal midline is dense, making it impossible to separate the mucosa, connective tissue, periosteum, and bone tissue. Therefore, it is not possible to isolate the bone tissue at the palatal midline alone. It is necessary to preserve the palatal midline and the tissue on both sides before induction culture.

[0017] In a specific embodiment of the present invention, in step S1, the mid-palatal suture and 2 mm of tissue on each side are preserved. The maxillary tissue is trimmed under a stereomicroscope, retaining the mid-palatal suture and 2 mm of tissue on each side. Under a stereomicroscope, the mid-palatal suture is highly translucent, while the tissue on both sides is less translucent, making them easily distinguishable. Only the mid-palatal suture and 2 mm of tissue on each side are preserved, and the remaining tissue, including the maxillary sinus, is removed. Note that this step should minimize the amount of other tissue to reduce contamination from other cells. Note that this step should ensure separation only at the mid-palatal suture, and the tissue should not be fragmented to reduce contamination from other cells.

[0018] Furthermore, in step S1, the operation is performed under a stereomicroscope to reduce tissue damage during the extraction of palatal raphe stem cells.

[0019] Furthermore, the stereomicroscope used in this invention is a Leica M80 stereomicroscope. It features a continuous zoom system and a cold light source illumination system. During operation, the magnification is set to 16× to obtain a sufficiently clear field of view of the palatal midline structure, facilitating the differentiation of the palatal midline and suture boundaries. Operation is conducted under aseptic conditions; the work surface is equipped with a laminar flow clean bench, the operating area is thoroughly disinfected with 75% v / v ethanol, and all instruments are autoclaved.

[0020] Further, in step S2, the concentration of the growth factor is 5–20 ng / mL.

[0021] Preferably, in step S2, the growth factor is 10 ng / mL epidermal growth factor, which can significantly enhance the expression level of CD44 in palatal raphe stem cells and increase their stemness retention ability.

[0022] Furthermore, in step S2, during culture, to ensure adherent culture, the unilateral palatal midline tissue is attached to the bottom of the culture dish with the palatal midline facing downwards to ensure adherent culture.

[0023] Furthermore, in step S2, the culture time is 4–7 days. During the culture process, the culture medium should be moved as little as possible to prevent the unilateral palatal suture tissue from shifting and floating. Care should be taken to add the culture medium very gently to avoid rinsing the unilateral palatal suture tissue and preventing it from shifting and floating.

[0024] In a specific embodiment of the present invention, in step S2, the culture time is 7 days. Cells can be seen emerging from the midline tissue of the palate on one side, arranged in a dense, spindle-shaped pattern.

[0025] Furthermore, in step S2, the serum includes fetal bovine serum.

[0026] Furthermore, in step S2, the fetal bovine serum concentration is 5–20% v / v, preferably 10% v / v.

[0027] Furthermore, in step S2, the antibiotic includes at least one of penicillin, streptomycin, and amphotericin B.

[0028] Further, in step S2, the concentration of penicillin is 50–200 U / mL, the concentration of streptomycin is 50–200 μg / mL, and the concentration of amphotericin B is 0.125–0.5 μg / mL.

[0029] Preferably, in step S2, the concentration of penicillin is 100 U / mL, the concentration of streptomycin is 100 μg / mL, and the concentration of amphotericin B is 0.25 μg / mL.

[0030] The antibiotics penicillin and streptomycin have effective combined antibacterial activity against both Gram-positive and Gram-negative bacteria, and are used to prevent bacterial contamination of cell cultures. Amphotericin B can inhibit multicellular fungi and yeasts, thereby preventing fungal contamination of cell cultures.

[0031] Further, in step S3, the primary mouse palatal raphe stem cells from step S2 are washed with PBS buffer and then digested.

[0032] Furthermore, in step S3, primary mouse palatal raphe stem cells are digested and cultured using a digestive solution containing trypsin and ethylenediaminetetraacetic acid.

[0033] Furthermore, in step S3, the concentration of trypsin is 0.1–0.5 mg / mL, and the concentration of ethylenediaminetetraacetic acid is 0.01–0.25 mg / mL.

[0034] Preferably, the concentration of trypsin is 0.25 mg / mL and the concentration of ethylenediaminetetraacetic acid is 0.02 mg / mL.

[0035] Furthermore, in step S3, the ratio of the digestive fluid to the diameter of the culture dish for culturing the unilateral palatal suture tissue is 0.5–2 mL: 10 cm, preferably 1 mL: 10 cm.

[0036] Furthermore, in step S3, the digestion time is 1–2 minutes, preferably 1 minute, during which 60%–70% of the cells can be observed floating under a microscope. Note that the digestion time should not be too long to avoid affecting the activity of palatal raphe stem cells.

[0037] Furthermore, in step S3, after digestion, the digestion is terminated using the culture medium described in step S2, and the volume of the culture medium used to terminate the digestion is the same as that of the digestion solution.

[0038] Further, in step S3, after digestion, centrifuge at 300-1500 rpm for 3-10 min, discard the supernatant, and collect the palatal raphe stem cells; preferably, centrifuge at 1000 rpm for 5 min.

[0039] Further, in step S3, the palatal raphe stem cells are resuspended in the culture medium described in step S2 to obtain a palatal raphe stem cell suspension.

[0040] Furthermore, in step S3, during passage culture, the seeding density of mouse palatal raphe stem cells is no less than 1 × 10⁻⁶. 4 pcs / cm 2 Cells that are too sparsely distributed are not conducive to cell proliferation, and cells that are too densely distributed are also not conducive to cell proliferation.

[0041] Furthermore, the seeding density of mouse palatal raphe stem cells was 1–4 × 10⁻⁶. 4 pcs / cm 2 .

[0042] Furthermore, the seeding density of mouse palatal raphe stem cells was 2–4 × 10⁻⁴. 4 pcs / cm 2 .

[0043] Furthermore, in step S3, the culture time for each subculture is 2 to 3 days, preferably 3 days.

[0044] Furthermore, in step S3, the number of subcultures is limited to 5 generations. This helps maintain good cell stemness.

[0045] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0046] (1) Because the tissue at the mid-palatal suture is dense, it is impossible to separate the bone tissue at the suture site, making it difficult to extract mid-palatal suture stem cells using traditional methods. Furthermore, the purity of mid-palatal suture stem cells is extremely low after 9-12 days of culture. The method of this invention does not require the removal of the palatal mucosa and submucosal tissue. The palatal tissue is directly pulled apart at the mid-palatal suture under a stereomicroscope to separate the middle suture portion of the mid-palatal suture. During adherent culture, this ensures that mid-palatal suture stem cells can emerge from the suture. The purity of mid-palatal suture stem cells is high on day 7 of adherent culture. This provides a simple and efficient technique for isolating and extracting mid-palatal suture stem cells.

[0047] (2) The stem cell count of palatal raphe stem cells extracted from mice less than 5 days old was significantly higher than that extracted from mice older than 5 days old. The method of this invention significantly shortens the experimental time, and the extracted palatal raphe stem cells have high stem cell expression. It is also convenient to operate, providing a basis for the repair of congenital developmental malformations such as cleft palate.

[0048] (3) The present invention significantly enhances the expression level of CD44 by adding 10 ng / mL EGF to the culture medium, thereby enhancing its ability to maintain stemness. Attached Figure Description

[0049] Figure 1 This is a schematic diagram of the separation of the mid-palatal suture tissue.

[0050] Figure 2 To separate the mid-palatal suture tissue under a stereomicroscope.

[0051] Figure 3 To facilitate adherent culture of palatal midline tissue.

[0052] Figure 4 The growth of palatal raphe stem cells after adhering to the culture vessel for palatal raphe tissue.

[0053] Figure 5 The effect of adherent culture time on the stemness and purity of palatal raphe stem cells. In this study, A represents adherent culture for 7 days; and B represents adherent culture for 8 days.

[0054] Figure 6 The effect of mouse age on the stemness of palatal raphe stem cells was investigated. In this study, A represents 5-day-old mice, and B represents 6-day-old mice.

[0055] Figure 7 The effects of different concentrations of EGF, FGF and TGF-β on the expression level of CD44 in palatal raphe stem cells.

[0056] Figure 8 The mRNA expression differences between palatal raphe stem cells and cranial raphe stem cells are shown. A represents BMP2; B represents Runx2; C represents Wnt3a; and D represents Axin2.

[0057] Figure 9 The effects of different concentrations of EGF, FGF and TGF-β on the expression level of CD44 in cranial suture stem cells. Detailed Implementation

[0058] To better illustrate the purpose, technical solution, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Unless otherwise specified, other materials and reagents used in the embodiments are commercially available.

[0059] Example 1: Isolation, extraction, and culture of palatal raphe tissue for palatal raphe stem cell culture

[0060] The following steps are performed in a clean bench:

[0061] 1. Take three 3-day-old newborn mice and immerse them in a 50mL centrifuge tube containing 75% (v / v) ethanol for 2 minutes to disinfect the newborn mice and simultaneously euthanize them. Note that the alcohol immersion time should not be too long to avoid affecting the activity of palatal raphe stem cells.

[0062] 2. Using ophthalmic forceps and scissors, dissect and separate the maxillary tissue from the mouth of the mouse treated in step 1. Note that this process should be gentle, as mouse tissue is fragile and easily broken.

[0063] 3. Rinse the maxillary tissue separated in step 2 in a six-well plate containing 1% (w / v) triantigen antibody (a mixture of penicillin-streptomycin-amphoteric B from Gibco, 100X triantigen antibody, which is a mixture of 10000 U / mL penicillin, 10000 μg / mL streptomycin and 25 μg / mL amphotericin B) to remove blood and other tissues adhering to the maxillary tissue.

[0064] 4. The stereomicroscope (Leica M80) features a continuous zoom system and a cold light source illumination system. During operation, the magnification is set to 16× to obtain a sufficiently clear field of view of the palatal midline structure, facilitating the differentiation of the palatal midline and suture boundaries. Operation is performed under aseptic conditions. The work surface is equipped with a laminar flow clean bench, and the operating area is thoroughly disinfected with 75% (v / v) ethanol. All instruments are autoclaved.

[0065] Under a stereomicroscope, the maxillary tissue processed in step 3 was trimmed, retaining the mid-palatal suture and 2 mm of tissue on each side, resulting in the trimmed mid-palatal suture tissue. Under the stereomicroscope, the mid-palatal suture is highly translucent, while the tissues on both sides are less translucent, making them easily distinguishable. Only the mid-palatal suture and 2 mm of tissue on each side were retained, and the remaining tissue, including the maxillary sinuses, was removed. Note that this step should minimize the amount of other tissue to reduce contamination from other cells.

[0066] 5. For example Figure 1 and Figure 2 As shown, under a stereomicroscope, take the palatal midline tissue trimmed in step 4. Gently grasp the tissue on both sides of the palatal midline with two ophthalmic forceps and pull lightly to separate the intact palatal midline tissue from the midline. If it is difficult to separate from the midline, you can try to use ophthalmic forceps to bluntly dissect from the palatal midline to create a slit, and then use ophthalmic forceps to tear the tissue to obtain the separated palatal midline tissue. Note that this step should be done as close to the palatal midline as possible, and do not cut the tissue into pieces to reduce contamination by other cells.

[0067] 6. For example Figure 3 As shown, place the unilaterally separated palatal midline tissue from step 5 into a 100mm culture dish, with 6 pieces of unilateral palatal midline tissue per 100mm culture dish, and let stand for 10 minutes to allow the tissue pieces to adhere to the bottom of the culture dish. Note that the palatal midline should be facing down when placing the tissue pieces into the culture dish.

[0068] 7. Slowly and gently add 10 mL of DMEM complete medium (containing 10% v / v fetal bovine serum, 1% w / v triple antibodies, and 10 ng / mL epidermal growth factor EGF) to the culture dish from step 6. Note that the medium should be added very gently to avoid rinsing the tissue block and causing it to float.

[0069] 8. Place the tissues and culture dishes processed in step 7 in an incubator and incubate them at 37°C, 5% CO2, and 95% humidity for 7 days. During this period, avoid moving the culture medium as much as possible to prevent the tissue blocks from shifting and floating.

[0070] 9. Observe the palatal midline tissue cultured in step 8 under an inverted microscope, such as... Figure 4 As shown, cells can be seen crawling out around the tissue block, arranged in a dense, spindle-shaped pattern.

[0071] 10. Gently remove the culture medium and tissue blocks from step 8. Gently wash the cells with 5 mL of PBS buffer twice. Add 1 mL of 0.25% Trypsin-EDTA (a solution containing 0.25 mg / mL trypsin and 0.02 mg / mL EDTA) and incubate for 1 min. Note that the digestion time should not be too long to avoid affecting the activity of palatal raphe stem cells.

[0072] 11. Observe under a microscope: After digestion in step 10, when 60% to 70% of the cells are floating, immediately add 1 mL of DMEM complete culture medium (with 10% v / v fetal bovine serum, 1% w / v triple antibodies and 10 ng / mL EGF) to stop the digestion reaction and gently rinse the culture dish (gently rinsing off any cells that are not floating). Collect all the liquid in the culture dish into a 15 mL centrifuge tube, centrifuge at 1000 rpm for 5 min, and discard the supernatant.

[0073] 12. Resuspend the cell pellet from step 11 in 3 mL of DMEM complete medium (added with 10% v / v fetal bovine serum, 1% w / v triple antibodies and 10 ng / mL EGF) to obtain a cell suspension. The cell count in the cell suspension was measured to be 1.2 × 10⁻⁶. 5 Seed the cell suspension at a density of 1 × 10⁶ cells / mL into 60 mm culture dishes and incubate statically for 3 days. Carefully resuspend the cells to prevent cell breakage. Ensure the seeding density is at least 1 × 10⁶ cells / mL. 4 pcs / cm 2 Too sparse a cell structure is not conducive to cell proliferation, and too dense a cell structure is also not conducive to cell proliferation.

[0074] 13. Observe the cells cultured in step 12 under an inverted microscope. The cells should basically cover the culture dish, and the cell density should be 2.5 × 10⁻⁶. 4 pcs / cm 2 To maintain cell stemness, it is recommended to use cells passaged up to 5 times for subsequent cell experiments.

[0075] Example 2 Identification of Cell Stemness

[0076] 1. Take cells cultured for 7 and 8 days respectively from step 8 of Example 1, digest and resuspend them according to steps 10-12 to obtain cell suspensions, add 1 μL of anti-CD44 monoclonal antibody (CD44 is a cell surface glycoprotein, diluted 1:200, i.e., anti-CD44 monoclonal antibody diluted 200 times) and 1 μL of anti-Sca-1 monoclonal antibody (Sca-1 is stem cell antigen 1, diluted 1:200, i.e., anti-Sca-1 monoclonal antibody diluted 200 times), incubate at room temperature in the dark for 20 min, centrifuge at 250g for 5 min and discard the supernatant, wash twice with PBS, resuspend the cells with 400 μL of PBS and perform flow cytometry detection.

[0077] 7 days after first-generation cell culture ( Figure 5 The dryness of A) was significantly higher than that of 8 days ( Figure 5 The stemness of B) indicates that in the first 7 days of adherent culture, mainly stem cells migrate out, while after 7 days, other cells migrate out, affecting stemness.

[0078] 2. Newborn mice aged 5 days and 6 days were taken respectively, and palatal raphe tissue was isolated, extracted and cultured according to the method in Example 1. Palatal raphe stem cells were obtained and their stemness was identified according to the method in step 1 of Example 2.

[0079] Using mice less than 5 days old ( Figure 6 A) The stem cells extracted from the palatal raphe were significantly more stem than those from mice older than 5 days. Figure 6 B) Extracted mid-palatal raphe stem cells.

[0080] Example 3: Effects of epidermal growth factor (EGF), fibroblast growth factor (FGF), and transforming growth factor-β (TGF-β) on the expression level of CD44 in palatal raphe stem cells.

[0081] In Example 1, the concentrations of EGF were 0, 5, 10, and 20 ng / mL to investigate the effect of different concentrations of EGF on the expression level of CD44 in palatal raphe stem cells.

[0082] In Example 1, EGF was replaced with FGF or TGF-β, and the effects of different concentrations (0, 5, 10 and 20 ng / mL) on the expression level of CD44 in palatal raphe stem cells were investigated.

[0083] Flow cytometry was performed according to the method in Example 2 to obtain the expression level of CD44 in palatal raphe stem cells under different conditions.

[0084] like Figure 7 As shown, 10 ng / mL EGF CD44 +With a cell ratio of 98.5%, it significantly enhanced the expression level of CD44 in palatal raphe stem cells and increased their stemness retention capacity. In contrast, even with increased concentrations of FGF and TGF-β, the increase in CD44 expression was relatively limited, remaining within the range of 70-80%.

[0085] Example 4: Identification of differential mRNA expression between palatal suture stem cells and cranial suture stem cells

[0086] mRNA was extracted from palatal suture stem cells (palatal suture stem cells isolated and cultured according to the method in Example 1, passaged to the third generation) and cranial suture stem cells cultured by conventional methods, and then reverse transcribed into cDNA. The cDNA was then processed using PrimeScript. TM The RTMaster Mix (Perfect Real Time) kit was used to perform qTR-PCR experiments to detect and analyze the mRNA expression of BMP pathway-related genes (BMP2, Runx2) and Wnt pathway-related genes (Wnt3a, Axin2) in various cells. The primers used are shown in Table 1.

[0087] Table 1

[0088] Gene upstream primer Downstream primer BMP2 TCTTCCGGGAACAGATACAGG TGGTGTCCAATAGTCTGGTCA Runx2 GACTGTGGTTACCGTCATGGC ACTTGGTTTTTCATAACAGCGGA Wnt3a CTCCTCTCGGATACCTCTTAGTG CCAAGGACCACCAGATCGG Axin2 ATGAGTAGCGCCGTGTTAGTG GGGCATAGGTTTGGTGGACT

[0089] The conventional method for culturing cranial suture stem cells is as follows:

[0090] Five-day-old newborn mice were placed in a 50 mL centrifuge tube containing 75% (v / v) ethanol for 3 min to disinfect the newborn mice and euthanize them at the same time.

[0091] Under aseptic conditions, the skin and subcutaneous tissue were incised along the midline suture of the mouse skull, the attached connective tissue and periosteum were removed, and bone blocks 1 mm on each side of the midline suture were retained. These were carefully cut off and separated from the dura mater to obtain the separated bone blocks in the midline suture area.

[0092] The separated bone fragments from the suture zone were repeatedly rinsed with PBS buffer, cut into small segments, and placed in α-DMEM medium containing 10% (v / v) fetal bovine serum. The medium was then seeded into culture dishes, ensuring it covered the bone fragments. The dishes were incubated at 37°C with 5% CO2. The medium level was monitored every 4–5 hours, and replenished as needed. After 2–3 days of culture, cells began to emerge from the suture zone at the center of the bone fragments. The medium was then changed every 3 days for 9–12 days until the cells reached 80%–90% confluence. The medium was then discarded, and the cells were rinsed 2–3 times with PBS. 1 mL of 0.25% Trypsin-EDTA was added, and the cells were passaged at a 1:2 ratio (the cells in the original culture dish were evenly diluted to half the concentration in two identical culture dishes). The medium was changed every 3 days, and cell growth was closely monitored. Once the cells had largely confluenced, the cells were continuously passaged and expanded to the third generation using the same method.

[0093] like Figure 8 A and Figure 8 As shown in Figure B, palatal raphe stem cells highly express BMP pathway-related genes (BMP2, Runx2), which are involved in palatal development. Figure 8 C and Figure 8 As shown in D, cranial suture stem cells highly express Wnt pathway-related genes (Wnt3a, Axin2), which are involved in skull growth.

[0094] Comparative Example 1: Effects of Epidermal Growth Factor (EGF), Fibroblast Growth Factor (FGF), and Transforming Growth Factor-β (TGF-β) on CD44 Expression Levels in Cranial Suture Stem Cells

[0095] In Example 4, different concentrations (0, 5, 10, and 20 ng / mL) of EGF, FGF, and TGF-β were added to the culture medium for culturing cranial suture stem cells to investigate the effects of different concentrations of EGF, FGF, and TGF-β on the expression level of CD44 in cranial suture stem cells.

[0096] Flow cytometry was performed according to the method in Example 2 to obtain the expression level of CD44 in cranial suture stem cells under different conditions.

[0097] like Figure 9 As shown, there was no significant difference in the CD44 positivity rate of cranial suture stem cells at different concentrations of EGF, FGF, and TGF-β. EGF had a specific effect on optimizing the activity of palatal suture stem cells, but did not significantly promote the activity of cranial suture stem cells, suggesting that palatal suture tissue and palatal suture stem cells have tissue specificity.

[0098] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A method for isolating and culturing mouse palatal raphe stem cells, characterized in that, Includes the following steps: S1: Separate the maxillary tissue of 3-5 day old mice, retain the palatal midline and the tissues on both sides, tear open the tissues on both sides along the palatal midline to obtain the unilateral palatal midline tissue; S2: Primary mouse palatal raphe stem cells were obtained by adhering and culturing the unilateral palatal raphe tissue from step S1 within 7 days in a culture medium containing serum, antibiotics and 10 ng / mL epidermal growth factor. S3: Passage the primary mouse palatal raphe stem cells from step S2 to obtain passaged mouse palatal raphe stem cells.

2. The method for isolating and culturing mouse palatal raphe stem cells as described in claim 1, characterized in that, In step S1, the palatal midline and 1-2 mm of tissue on both sides are preserved.

3. The method for isolating and culturing mouse palatal raphe stem cells as described in claim 1, characterized in that, In step S2, during culturing, the palatal suture is placed downwards against the bottom of the culture dish.

4. The method for isolating and culturing mouse palatal raphe stem cells as described in claim 1, characterized in that, In step S2, the serum includes fetal bovine serum.

5. The method for isolating and culturing mouse palatal raphe stem cells as described in claim 1, characterized in that, In step S2, the antibiotic includes at least one of penicillin, streptomycin, and amphotericin B.

6. The method for isolating and culturing mouse palatal raphe stem cells as described in claim 1, characterized in that, In step S3, primary mouse palatal raphe stem cells are digested and cultured using a digestive solution containing trypsin and ethylenediaminetetraacetic acid.

7. The method for isolating and culturing mouse palatal raphe stem cells as described in claim 1, characterized in that, In step S3, during passage culture, the seeding density of mouse palatal raphe stem cells should be no less than 1 × 10⁻⁶. 4 pcs / cm 2 .

8. The method for isolating and culturing mouse palatal raphe stem cells as described in claim 1, characterized in that, In step S3, the culture time for each subculture is 2 to 3 days.

9. The method for isolating and culturing mouse palatal raphe stem cells as described in claim 1, characterized in that, In step S3, the number of generations of subculture is no more than 5.

Images