Application of plasmodiophora brassicae Pb035 gene in prevention and control of clubroot of cruciferae crops

By targeting the inhibition of the Pb035 gene of the root knot fungus and silencing its expression using RNA interference technology, the limitations of existing prevention and control methods were overcome, and efficient prevention and control of root knot disease in cruciferous crops was achieved, thereby enhancing crop resistance and reducing environmental pollution risks.

CN120608073AActive Publication Date: 2025-09-09OIL CROPS RES INST CHINESE ACAD OF AGRI SCI
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202511121512.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-12
Publication Date
2025-09-09
Estimated Expiration
2045-08-12

AI Technical Summary

Technical Problem

Existing methods for preventing and controlling clubroot in cruciferous crops, such as chemical control, soil management, biological control, and breeding of disease-resistant varieties, have limitations and are unable to effectively prevent and control clubroot. In addition, the long-term use of chemical pesticides leads to drug resistance and environmental pollution, biological control is restricted by environmental conditions, and the effectiveness of disease-resistant varieties is limited.

Method used

RNA interference technology is used to target and inhibit the Pb035 gene of root knot fungus. By constructing a recombinant vector and using Agrobacterium-mediated method or root irrigation to apply RNA interference fragments, the expression of Pb035 gene is silenced, and its expression level in cruciferous crops is reduced, thereby achieving the prevention and treatment of root knot disease.

Benefits of technology

Significantly enhance the resistance of cruciferous crops to clubroot, reduce the disease index and pathogen biomass, provide long-lasting and efficient prevention and control measures, and reduce the environmental risks of chemical pesticide use.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120608073A_ABST
    Figure CN120608073A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of agricultural plant pathology and plant protection, and relates to a plasmodiophora brassicae Pb035 gene and application thereof in prevention and control of clubroot of cruciferae crops. The core of the invention lies in that the plasmodiophora brassicae Pb035 gene expression is silenced by using a host induced gene silencing (HIGS) technology or an exogenous RNA interference fragment delivery technology, so that the resistance of cruciferae crops to clubroot is enhanced. The discovery provides a key technology and method for prevention and control of clubroot of cruciferae crops, and has wide agricultural application prospect and market value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of crucifer clubroot disease prevention and control, and in particular to a clubroot fungus gene Pb035 Application in preventing and controlling clubroot disease in cruciferous crops. Background Art

[0002] Cruciferous crops, including rapeseed, cabbage, kale, radish, mustard, etc., play an important role in global agriculture and are an important part of the human food supply chain and agricultural economy. Plasmodiophora brassicae Clubroot, caused by the worm Woronin, can harm nearly all cruciferous crops. It causes root enlargement, deformity, and rot, severely impairing the crop's ability to absorb water and nutrients, ultimately leading to premature plant failure, yield reduction, and even total crop failure. Currently, over 3.2 million hectares of land in my country are affected annually, accounting for over one-third of the cruciferous crop planting area. Yield losses average 20-30%, and in severely affected fields, total crop failure can occur, resulting in tens of billions of yuan in economic losses annually.

[0003] Existing control methods, such as chemical control, soil management, biological control, and breeding of disease-resistant varieties, all have significant limitations. Long-term use of chemical pesticides can lead to resistance and environmental pollution; soil improvement methods are costly and difficult to scale up; biological control methods are limited by environmental conditions; and the effectiveness of disease-resistant varieties is limited due to the rapid evolution of pathogens. Therefore, the development of new technologies for clubroot control is imperative.

[0004] RNA interference (RNAi) is an evolutionarily conserved gene silencing mechanism mediated by double-stranded RNA. It can specifically degrade mRNAs that are complementary to its sequence, thereby inhibiting target gene expression. In recent years, the application of RNAi technology in plant disease control has rapidly developed. In particular, strategies such as host-induced gene silencing (HIGS) and spray-induced gene silencing (SIGS) have become important directions in green pesticides and precision breeding. Summary of the Invention

[0005] The purpose of the present invention is to provide a key target of root knot fungus for improving the clubroot disease resistance of cruciferous crops, to carry out targeted inhibition on the target, to achieve the improvement of the clubroot disease resistance of cruciferous crops, and to provide new key targets and technical means for the improvement of the clubroot disease resistance of cruciferous crops and the long-term and efficient prevention and control.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: In a first aspect, the present invention provides a root knot fungus Pb035 gene, the Pb035 The nucleotide sequence of the gene is shown in SEQ ID NO.1: In a second aspect, the present invention also provides a method for silencing Pb035 base The biomaterial comprises a target Pb035 RNA interference fragments of genes; Preferably, the RNA interference fragment includes a target gene fragment S1 and a reverse complementary fragment S2 of the target gene fragment, and the nucleotide sequences are shown in SEQ ID NO. 2-3 respectively: S1: (SEQ ID NO. 2); S2: (SEQ ID NO. 3).

[0007] Preferably, the biological material is at least one of a recombinant expression vector, a transgenic cell line and a recombinant bacterium.

[0008] In a third aspect, the present invention also provides a method for preventing and controlling clubroot disease in cruciferous crops, comprising the following steps: Pb035 Transformation of gene-expressing biomaterials into cruciferous crops to reduce Pb035 Gene expression level.

[0009] It should be noted that the control process of the present invention includes two aspects: prevention and treatment. That is, before the root knot fungus infection, the Pb035 Gene expression biomaterials that stably express targeted root knot fungi in plant cells Pb035 RNA interference fragments of genes can prevent root knot infection; they can also be transferred to silence genes after root knot infection. Pb035Gene expression biological materials can interfere with gene expression in a timely manner and block the infection process of root knot fungi.

[0010] Preferably, the biological material is transformed into the cruciferous crop by constructing a silencing vector and using Agrobacterium-mediated method; or, the biological material is transformed into the cruciferous crop by root irrigation.

[0011] More preferably, the biomaterial comprises a targeting Pb035 The RNA interference fragment of the gene comprises a target gene fragment S1 and a reverse complementary fragment S2 of the target gene fragment, and the nucleotide sequences are shown in SEQ ID NO. 2-3 respectively.

[0012] More preferably, the Agrobacterium is Agrobacterium tumefaciens.

[0013] More preferably, the method for constructing the silencing vector comprises the following steps: (1) Root-knot fungus Pb035 The gene sequence (shown in SEQ ID NO. 1) was used as a template, and the primers shown in SEQ ID NO. 4-5 were used to amplify the target gene fragment S1 (shown in SEQ ID NO. 2); (2) Use BamH I to digest the PBI121Bar-RNAi vector to obtain a linearized vector; (3) Homologous recombination of the target fragment S1 (as shown in SEQ ID NO. 2) and the linearized vector PBI121Bar-RNAi was performed to obtain the recombinant vector PBI121Bar-RNAi-S1; (4) root knot fungus Pb035 The gene sequence (shown in SEQ ID NO. 1) was used as a template, and the primer pair shown in SEQ ID NO. 6-7 was used to amplify the reverse complementary fragment S2 (shown in SEQ ID NO. 3) of the target gene fragment; (5) Use Sac I to digest the recombinant vector PBI121Bar-RNAi-S1 to obtain a linearized vector; (6) The target fragment S2 (shown in SEQ ID NO.3) and the linearized vector PBI121Bar-RNAi-S1 were homologously recombined to obtain Pb035 Gene silencing vectors.

[0014] Further preferably, the primers for amplifying the target gene fragment S1 and the reverse complementary fragment S2 of the target gene fragment are as shown in SEQ ID NO. 4-7: S1-F: AACACGGGGGACTCTAGA GGATCC GATTGCACGGTCGAGAAGGA (SEQ ID NO. 4); S1-R: TTACCAAGCTGGGGTACCGGATCC CGAGAGCTGAACTGGGATCC (SEQ ID NO.5); S2-F: GCTGGGTTCGAAGTCGAC GAGCTC CGAGAGCTGAACTGGGATCC (SEQ ID NO.6); S2-R: GAACGATCGGGGAAATTC GAGCTC GATTGCACGGTCGAGAAGGA (SEQ ID NO. 7); Among them, in SEQ ID NO.4-7, the underlined part is the vector homology arm, the bold part is the enzyme cutting site, and the italic part is the specific amplification Pb035 Gene primers.

[0015] More preferably, the biomaterial is introduced into cruciferous crops by root irrigation, comprising the following steps: mixing the biomaterial, the nanomaterial delivery carrier and the RNase inhibitor, preparing a solution with RNase-free water, and subjecting the solution to root irrigation treatment on the plants.

[0016] More preferably, the synthesis of the RNA interference fragment contained in the biological material comprises the following steps: using the primer pair shown as SEQ ID NO. 8-9 and adopting T7 RNA in vitro transcription technology to synthesize the RNA interference fragment.

[0017] Most preferably, the primers for synthesizing RNA interference fragments are as shown in SEQ ID NO.8-9: F: TAATACGACTCACTATAGGGGATTGCACGGTCGAGAAGGA(SEQ ID NO.8); R: CCCTATAGTGAGTCGTATTACGAGAGCTGAACTGGGATCC (SEQ ID NO. 9).

[0018] Compared with the prior art, the present invention has the following advantages and beneficial effects: The present invention provides a method for enhancing the resistance of cruciferous crops to clubroot disease, using host-induced gene silencing technology or exogenous double-stranded RNA delivery technology to silence key target genes of clubroot fungi. Pb035 Gene expression can enhance the resistance of cruciferous plants to clubroot disease; it provides a key technology for the prevention and control of clubroot disease in cruciferous crops and has broad agricultural application prospects and market value. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. Those skilled in the art can also derive other drawings based on these drawings without inventive effort.

[0020] Figure 1 When root knot fungi infect Arabidopsis thaliana at different growth stages Pb035 Schematic diagram of gene expression in root cells; RS is dormant spores, MP is mid-primary infection stage, IS is early secondary infection stage, MS is mid-secondary infection stage, and LS is late secondary infection stage; FPKM is the fragment length per kilobase of transcript per million mapped reads.

[0021] Figure 2 for Pb035 Protein structure diagram.

[0022] Figure 3 This is the map of the pBI121Bar-RNAi vector.

[0023] Figure 4 for Pb035 Schematic diagram of the construction of gene silencing vector.

[0024] Figure 5 Targeting root knot fungi with host-induced gene silencing Pb035 Disease survey diagram of transgenic Arabidopsis thaliana after inoculation with different root knot fungus physiological races; Figure A is Pb035 Figure A is a gene expression analysis diagram; Figure B is a physical picture of Arabidopsis root swelling; Figure C is a disease index survey diagram.

[0025] Figure 6 To target clubroot fungi through root irrigation Pb035 Gene silencing using double-stranded RNA technology Pb035 The survey results of diseases of transgenic Arabidopsis thaliana plants with the gene; Figure A is Pb035 Figure A is the gene expression analysis diagram; Figure B is the disease index survey diagram; Figure C is the root knot fungus biomass survey diagram. DETAILED DESCRIPTION

[0026] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0027] It should be noted that the order of description of the following embodiments is not intended to limit the preferred order of the embodiments. In addition, in the description of this application, the term "including" means "including but not limited to". Various embodiments of the present invention may be in the form of a range; it should be understood that the description in the form of a range is merely for convenience and brevity and should not be understood as a rigid limitation on the scope of the invention; therefore, it should be considered that the range description has specifically disclosed all possible sub-ranges and single numerical values ​​within the range. For example, the range description from 1 to 6 should be considered to have specifically disclosed sub-ranges, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as single numbers within the numbered ranges, such as 1, 2, 3, 4, 5 and 6, regardless of the range. In addition, whenever a numerical range is indicated herein, it is meant to include any cited numbers (fractions or integers) within the indicated range.

[0028] The embodiment of the present invention provides a root knot fungus Pb035 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0029] The embodiment of the present invention also provides a method for silencing Pb035 Gene expression biomaterials, including targeted Pb035 RNA interference fragment of the gene.

[0030] Specifically, the RNA interference fragment includes a target gene fragment S1 and a reverse complementary fragment S2 of the target gene fragment, and the nucleotide sequences are shown in SEQ ID NO. 2-3 respectively.

[0031] Specifically, the biological material is at least one of a recombinant expression vector, a transgenic cell line and a recombinant bacterium.

[0032] The embodiment of the present invention also provides a method for preventing and controlling clubroot disease in cruciferous crops, comprising the following steps: Pb035 Transformation of gene-expressing biomaterials into cruciferous crops to reduce Pb035 Specifically, the biomaterial is transformed into cruciferous crops by constructing a silencing vector and using Agrobacterium-mediated method; or, the biomaterial is transformed into cruciferous crops by root irrigation.

[0033] More specifically, the biomaterial comprises a targeting Pb035 The RNA interference fragment of the gene comprises a target gene fragment S1 and a reverse complementary fragment S2 of the target gene fragment, and the nucleotide sequences are shown in SEQ ID NO. 2-3 respectively.

[0034] More specifically, the Agrobacterium is Agrobacterium tumefaciens.

[0035] More specifically, the method for constructing a silencing vector includes the following steps: (1) Root-knot fungus Pb035 The gene sequence (shown in SEQ ID NO. 1) was used as a template, and the primers shown in SEQ ID NO. 4-5 were used to amplify the target gene fragment S1 (shown in SEQ ID NO. 2); (2) Use BamH I to digest the PBI121Bar-RNAi vector to obtain a linearized vector; (3) Homologous recombination of the target fragment S1 (as shown in SEQ ID NO. 2) and the linearized vector PBI121Bar-RNAi was performed to obtain the recombinant vector PBI121Bar-RNAi-S1; (4) root knot fungus Pb035 The gene sequence (shown in SEQ ID NO. 1) was used as a template, and the primer pair shown in SEQ ID NO. 6-7 was used to amplify the reverse complementary fragment S2 (shown in SEQ ID NO. 3) of the target gene fragment; (5) Use Sac I to digest the recombinant vector PBI121Bar-RNAi-S1 to obtain a linearized vector; (6) The target fragment S2 (shown in SEQ ID NO.3) and the linearized vector PBI121Bar-RNAi-S1 were homologously recombined to obtain Pb035 Gene silencing vectors.

[0036] More specifically, the biomaterial is introduced into cruciferous crops by root irrigation, which includes the following steps: mixing the biomaterial, the nanomaterial delivery carrier and the RNase inhibitor, preparing a solution with RNase-free water, and applying the solution to the plants by root irrigation.

[0037] More specifically, the synthesis of the RNA interference fragment includes the following steps: using the primer pair shown in SEQ ID NO. 8-9, and adopting T7 RNA in vitro transcription technology to synthesize the RNA interference fragment.

[0038] More specifically, synthesizing the RNA interference fragment contained in the biological material includes the following steps: using the primer pair shown as SEQ ID NO. 8-9 and adopting T7 RNA in vitro transcription technology to synthesize the RNA interference fragment.

[0039] The following further describes the present invention with specific examples. Pb035 Application methods of genes in the prevention and control of clubroot in cruciferous crops. This section further illustrates the present invention with reference to specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the art.

[0040] In the following embodiments, the cruciferous crops include one or more of rapeseed, cabbage, kale, mustard or radish.

[0041] In the following examples, the specific survey method for the incidence rate and disease index is as follows: 30 days after the Arabidopsis thaliana was inoculated with root knot fungi, the plants were uprooted, the roots were washed with running water, and the disease was surveyed. The number of diseased plants and the disease level were counted, and the incidence rate and disease index were calculated. The disease index was calculated as follows:

[0042] Among them, the classification of clubroot disease is divided into levels 0-3, level 0: normal root system, no disease symptoms; level 1: no clubroot on the main root; a small number of small tumors formed on less than 1 / 3 of the lateral roots; level 2: clubroot formed on the main root or tumors formed on 1 / 3-2 / 3 of the lateral roots; level 3: large tumors formed on the main root and more than 2 / 3 of the lateral roots. In the following examples, detection and verification Pb035 The primers for gene expression are as shown in SEQ ID NO.10-11: Pb035 -F: GATTGCACGGTCGAGAAGGA (SEQ ID NO.10); Pb035 -R: TGCATGAGAGCTTGACAGGG (SEQ ID NO. 11).

[0043] Example 1: Plasmodium Pb035 Genes are highly expressed at all infection stages To explore the root nodule fungus Pb035 In order to investigate the biological function of the gene and its potential application value in disease prevention and control, this study systematically analyzed the expression pattern of the gene at different stages of root knot fungus infection based on transcriptome data. The root knot fungus strain used was the physiological race 4 collected from Jishou City, Hunan Province. Two-week-old Arabidopsis seedlings were used as the material, and the concentration was 10 6 The roots were inoculated with a suspension of resting spores of Rhizoctonia solani containing 100 dormant spores / strain to ensure the consistency and repeatability of infection. Sample collection covered all key stages of Rhizoctonia solani infection, including resting spores (RS), mid primary (MP), initial secondary (IS), mid secondary (MS) and late secondary (LS). The results showed that Rhizoctonia solani Pb035 The gene has a relatively high expression level in each infection stage, especially at the end of the secondary infection ( Figure 1), suggesting that this gene may play a key role in the establishment of infection and progression of root knot fungus. This discovery provides a basis for in-depth analysis of Pb035 This study laid the foundation for its functional mechanism and its use as a potential target for disease prevention and control.

[0044] Further based on protein sequence and structure ( Figure 2 ) annotation found that the protein has a typical signal peptide and protein disulfide isomerase functional domain, which can catalyze the formation and reconstruction of disulfide bonds, suggesting that it can enhance the adaptability and pathogenicity of root knot fungi to the host environment by regulating the correct folding of proteins, which provides a basis for the development of targeted Pb035 Genetic disease prevention and control technology provides a theoretical basis and molecular targets. Figure 2 As shown in the figure, the pLDDT (predicted Local Distance Difference Test) score indicates the confidence of each amino acid residue in the predicted protein structure, ranging from 0 to 100, with higher scores indicating more reliable structures. The 82.48 shown in the figure is the average confidence score for all residues.

[0045] Example 2 Targeted silencing based on host-induced gene silencing (HIGS) technology Pb035 Transgenic plants with the gene have significantly enhanced resistance to clubroot To verify Pb035 The disease control potential of genes, this example constructed a targeted silencing Pb035 The original vector of the silencing expression vector is the pBI121Bar-RNAi vector stored in our laboratory, and its host bacteria is Escherichia coli. Figure 3 See Figure 4 , Pb035 The construction process of gene silencing vector specifically includes: Pb035 The gene sequence (as shown in SEQ ID NO.1) was used as a template, and the primers shown in SEQ ID NO.4-5 were used to amplify the target gene fragment S1 (as shown in SEQ ID NO.2); the PBI121Bar-RNAi vector was digested with BamH I to obtain a linearized vector; the target fragment S1 (as shown in SEQ ID NO.2) and the linearized vector PBI121Bar-RNAi were homologously recombined to obtain the recombinant vector PBI121Bar-RNAi-S1; Pb035The gene sequence (as shown in SEQ ID NO.1) was used as a template, and the reverse complementary fragment S2 of the target gene fragment (as shown in SEQ ID NO.3) was amplified using the primer pair shown in SEQ ID NO.6-7; the recombinant vector PBI121Bar-RNAi-S1 was digested with Sac I to obtain a linearized vector; the target fragment S2 (as shown in SEQ ID NO.3) and the linearized vector PBI121Bar-RNAi-S1 were homologously recombined to obtain Pb035 Gene silencing vector. Restriction enzyme digestion confirmed correct vector construction. The 35S promoter and NOS terminator carried on the vector drive expression of the RNA interference fragment.

[0046] Will Pb035 The gene silencing vector was transformed into Agrobacterium GV3101 (Shanghai Weidi Biotechnology Co., Ltd.), and the inflorescence dipping method was used to transform Columbia-0 Arabidopsis thaliana ( Arabidopsis thaliana Transgenic plants were screened for the herbicide-resistance gene (bar) carried by the vector. Harvested Arabidopsis seeds were evenly sown in 10 cm × 20 cm bread boxes and grown under artificial light for one week before the first herbicide screening. 80 µL of 10% glufosinate ammonium dissolved in 500 mL of deionized water was shaken and evenly sprayed onto the plant leaf surface using a spray bottle, ensuring complete wetting. The spraying was repeated one week later; surviving plants were designated as T1 transgenic plants. The T2 generation screening method was essentially the same, except that the seeds were sown in small pots for cultivation. For T3 generation screening, to more accurately observe the homozygosity of the progeny, nine seeds were evenly sown in each pot and sprayed and screened according to the aforementioned method. Plants with all surviving progeny were designated as homozygous. Ultimately, two homozygous transgenic lines (L1 and L2) were successfully obtained.

[0047] After inoculation with a suspension of spores from six different species of root knotweed, root samples were taken on the eighth day for qPCR testing. Pb035The specific experimental procedures for gene expression were as follows: total RNA was extracted using TriQuick Reagent (Beijing Solarbio Technology Co., Ltd., Catalog No.: R1100), and genomic DNA contamination was removed with DNase I (Beyotime Biotech Inc., Catalog No.: D7076). After RNA precipitation, it was dissolved in RNase-free water (Beyotime Biotech Inc., Catalog No.: R0022). cDNA was synthesized using 5× TS RT-Mix (Shaanxi Proyanti Biotechnology Development Co., Ltd, Catalog No.: RT-010-100), reacted at 50°C for 15 minutes, and then inactivated at 85°C for 5 seconds. qPCR was performed using 2× Universal SYBR qPCR Master Mix (Beijing noble Ryder Technology Co. Ltd, Catalog No.: FQ-PCR05-1). A 20 μL reaction system contained 10 μL of the premix and 0.4 μL of 10 μM forward / reverse primers (primer sequences are shown in SEQ ID NO: 1). No. 10-11, primers (final concentration 0.2 μM) and 1-2 μL cDNA template were run on an ABI 7500 Fast fluorescent PCR instrument (Thermo Fisher Scientific Inc.): pre-denaturation at 95°C for 30 seconds, followed by 40 cycles of denaturation at 95°C for 10 seconds / annealing and extension at 60°C for 30 seconds, and finally melting curve collection; the root knotweed actin gene was used as an internal reference gene, and the PCR product was purified by 2 -ΔΔCt Calculation Pb035 The relative expression level of the gene was determined to ensure that the melting curve showed a single peak and the amplification efficiency was between 90% and 110%.

[0048] like Figure 5 As shown, qPCR analysis results confirmed that the transgenic plants Pb035 Gene expression was significantly downregulated ( Figure 5 Figure A in the figure shows the root swelling of the transgenic lines ( Figure 5 Figure B) and disease index (after t test, Figure 5 Figure C) was significantly lower than that of the control group, indicating that the targeted Pb035 The HIGS technology of the gene can give plants a broad spectrum of resistance to clubroot. This result verifies the functional level Pb035 The feasibility of genes as key targets for disease prevention and control.

[0049] Example 3 External application of silencing Pb035 RNA interference of a gene fragment significantly enhances plant resistance to clubroot To verify the targeting Pb035 To investigate whether the RNA interference fragment of the gene has the effect of preventing and controlling clubroot disease, the TR102-T7 RNAi Transcription Kit (Nanjing Novozymes Biotech Co., Ltd.) was used to synthesize the targeted Pb035 The RNA interference fragment of the gene and the primer sequences used for in vitro transcription synthesis of the RNA interference fragment are shown in SEQ ID NO.8-9.

[0050] Under artificial light culture conditions, each wild-type Arabidopsis thaliana ( Arabidopsis thaliana ) 1 mL of the root was inoculated with a concentration of 1×10 6 A spore suspension of Physiological Race 4 of Rhizoctonia solani from Jishou, Hunan Province, was prepared at 40 nmol / L using RNase-free water (Beyotime Biotech Inc., Catalog No. R0022). A double-stranded RNA solution was added to a final concentration of 40 nmol / L. An amino-modified dendritic macroporous silica nanomaterial delivery vehicle (Jiangsu Xianfeng Nanomaterial Technology Co., Ltd., Catalog No. 778949) was added to a final concentration of 0.5 mg / mL, along with an RNase inhibitor (RNaseOUT™, Thermo Fisher Scientific Inc., Catalog No. 10777019) to a final concentration of 1 U / μL. The solution was incubated on ice for 30 minutes before use. The solution was thoroughly mixed before application. 1 mL of the solution was pipetted and slowly dripped onto the roots of each Arabidopsis plant. The RNAi fragment solution was applied three times, on days 2, 4, and 6 after inoculation with Rhizoctonia solani. A blank control group was also established. Pb035 The method for detecting gene expression level is the same as that in Example 2.

[0051] The results showed that 8 days after inoculation with root knot fungus, Pb035 The gene expression level decreased by 52.8% compared with the control group ( Figure 6 Figure A in the figure); 25 days after inoculation, the disease index of the roots of Arabidopsis thaliana in the treatment group ( Figure 6 Figure B) and root knotweed biomass ( Figure 6 The above results indicate that exogenous administration of silencing Pb035 The RNA interference fragment of the gene can effectively silence the key genes of the pathogen, significantly inhibit the infection process of root-knot fungus, and has good prevention and control potential.

[0052] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Clubroot fungus Pb035 A gene characterized by described Pb035 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. Used for silence Pb035 A gene-expressing biomaterial, characterized in that The biomaterial comprises a targeting agent as claimed in claim 1 Pb035 RNA interference fragments of genes; The RNA interference fragment includes a target gene fragment S1 and a reverse complementary fragment S2 of the target gene fragment, and the nucleotide sequences are shown in SEQ ID NO. 2-3 respectively.

3. The method for silencing as claimed in claim 2 Pb035 A gene-expressing biomaterial, characterized in that The biological material is at least one of a recombinant expression vector, a transgenic cell line and a recombinant bacterium.

4. A method for preventing and controlling clubroot of cruciferous crops, characterized in that: The following steps are involved: The method for silencing as claimed in claim 3 Pb035 Transformation of gene-expressing biomaterials into cruciferous crops to reduce Pb035 Gene expression level.

5. The method for preventing and controlling clubroot of cruciferous crops according to claim 4, wherein: The biological material is transformed into cruciferous crops by constructing a silencing vector and using Agrobacterium-mediated method; Alternatively, the biological material is introduced into cruciferous crops by root irrigation; The Agrobacterium is Agrobacterium tumefaciens.

6. The method for preventing and controlling clubroot of cruciferous crops according to claim 5, wherein: The method for constructing the silencing vector comprises the following steps: (1) The root knot fungus as claimed in claim 1 Pb035 The gene sequence is used as a template, and the primers shown in SEQ ID NO. 4-5 are used to amplify the target gene fragment S1 as claimed in claim 2; (2) Use BamH I to digest the PBI121Bar-RNAi vector to obtain a linearized vector; (3) Homologous recombination of the target fragment S1 and the linearized vector PBI121Bar-RNAi was performed to obtain the recombinant vector PBI121Bar-RNAi-S1; (4) The root knot fungus as claimed in claim 1 Pb035 The gene sequence is used as a template, and the primer pair shown in SEQ ID NO. 6-7 is used to amplify the reverse complementary fragment S2 of the target gene fragment as claimed in claim 2; (5) Use Sac I to digest the recombinant vector PBI121Bar-RNAi-S1 to obtain a linearized vector; (6) Homologous recombination of the target fragment S2 and the linearized vector PBI121Bar-RNAi-S1 was performed to obtain Pb035 Gene silencing vectors.

7. The method for preventing and controlling clubroot of cruciferous crops according to claim 5, wherein: The method of transferring the biomaterial into cruciferous crops by root irrigation comprises the following steps: mixing the biomaterial, the nanomaterial delivery carrier and the RNase inhibitor, preparing the solution with RNase-free water, and performing root irrigation treatment on the plants.

8. The method for preventing and controlling clubroot of cruciferous crops according to claim 7, wherein: The synthesis of the biomaterial comprises the following steps: using the primer pair shown in SEQ ID NO. 8-9 and adopting T7 RNA in vitro transcription technology to synthesize the biomaterial.

9. The method for preventing and controlling clubroot of cruciferous crops according to any one of claims 4 to 8, wherein: The cruciferous crops include one or more of rapeseed, cabbage, kale, mustard or radish.

Citation Information

Patent Citations

  • Method for inhibiting growth of plasmodiophora brassicae woronin, method for preventing and treating club roots of cruciferae crops and application of azalomycin

    CN106719770A

  • Application of cruciferous crop GSL5 gene in clubroot resistance improvement and product development

    CN117604030A

  • Method for cultivating anti-clubroot plant by targeting plasmodiophora brassicae pyruvate kinase based on HIGS technology and biological material used by method

    CN118853737A

  • Plasmodiophora brassicae effector Pb78 and application thereof in prevention and treatment of Plasmodiophora brassicae infection

    CN119552231A

  • Application of plasmodiophora brassicae infected early chitin in prevention and control of cruciferae clubroot

    CN119592560A