Application of stenotrophomonas maltophilia in inhibition of pyricularia oryzae
By killing and inhibiting rice blast fungus, Stenotrophomonas maltophilia solves the environmental pollution and drug resistance problems of chemical control of rice blast, provides an efficient and green control method, and achieves significant growth inhibition and spore germination inhibition of rice blast fungus.
Patent Information
- Application Number
- CN202510771230.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-10
- Publication Date
- 2025-09-23
AI Technical Summary
Existing chemical agents for controlling rice blast have problems of environmental pollution and drug resistance. Biological control methods are easily affected by environmental factors and have unstable effects, and there is a lack of efficient and green control methods.
Stenotrophomonas maltophilia CGMCC NO.1.1788 was used to kill and inhibit the rice blast fungus (Magnaporthe oryzae Guy11), obtaining nutrients through killing and inhibiting growth and spore germination.
Significantly reduce the use of chemical pesticides and prevent the development of drug resistance. The growth inhibition rate of Stenotrophomonas maltophilia on rice blast fungus reaches 90.9%, and the spore germination inhibition effect is significant, providing a green and safe prevention and control method.
Smart Images

Figure HDA0005443029310000011 
Figure HDA0005443029310000021 
Figure HDA0005443029310000022
Abstract
Description
Technical Field
[0001] The invention belongs to the field of microorganisms, and particularly relates to application of Stenotrophomonas maltophilia in inhibiting the growth of rice blast fungus. Background Art
[0002] Rice blast, caused by the rice blast fungus Magnaporthe oryzae, is one of the most destructive diseases of rice. Currently, the prevention and control measures for rice blast mainly focus on chemical agents. The most effective agent is 6% kasugamycin aqueous solution, which has a long duration of efficacy; the second most effective agent is 40% pyraclostrobin emulsifiable concentrate; and the least effective agent is 10% azoxystrobin microcapsule suspension concentrate (Jin Jian. Screening test of rice blast control agents [J]. Agricultural Technology and Equipment, 2023(6):193-194.). Although chemical control agents are highly effective, they cause great pollution to the environment and are very likely to cause drug resistance. It is necessary to explore more green and safe control methods.
[0003] In recent years, research on the prevention and control of rice blast through biological control methods has become more and more extensive, and many examples of biocontrol bacteria have been found to show high biocontrol potential against rice blast, such as Bacillus subtilis GB519 (Qi Shanyan, Zhu Feng, Wang Jichun, et al. Colonization of Bacillus subtilis GB519 in rice plants and field control effect on rice blast [J]. Plant Protection, 2023, 49(2):48-56.), Bacillus velezensis 5-8 (Li Shenyu, Jia Xiangzi, Guo Juntao, et al. Identification and characterization of rice blast biocontrol bacteria 5-8 Study on its biocontrol mechanism [J]. Journal of Northern Agriculture, 2021, 49(3):74-81.), Bacillus amyloliquefaciens HR-2 (Li Jin. Antagonistic effect of Bacillus amyloliquefaciens HR-2 on rice blast pathogen and rapeseed sclerotinia pathogen [D]: Master's thesis. Changsha: Hunan University, 2021.) and Actinomycetes Ahn109 (Hu Zhan, Cheng Wei, Li Yilu, et al. Isolation and identification of rice endophytic actinomycetes Ahn109 and its inhibitory activity against rice blast [J / OL]. Jiangsu Agricultural Science: 1-8). The use of biocontrol agents can prevent and control the occurrence of diseases in a green and safe way, but biocontrol agents are easily affected by environmental factors and lose their biocontrol effect. In addition, exploring new disease-resistant varieties and selecting appropriate cultivation management are also important measures to prevent and control rice blast, but there are many problems such as the lack of resistant germplasm resources, cumbersome agricultural operations, and low efficiency. Summary of the Invention
[0004] The purpose of the present invention is to prevent and control rice blast fungus.
[0005] The present invention first protects the application of Stenotrophomonas maltophilia, which can be S1) or S2) or S3):
[0006] S1) Killing rice blast fungus;
[0007] S2) inhibiting rice blast fungus;
[0008] S3) Control rice blast fungus.
[0009] In the above application, the killing of rice blast fungus may be manifested as Stenotrophomonas maltophilia obtaining nutrition by killing rice blast fungus.
[0010] In the above application, the killing method can be to besiege and kill the rice blast fungus.
[0011] In the above application, the inhibition of rice blast fungus may be embodied as inhibiting the growth of rice blast fungus and / or inhibiting the spore germination of rice blast fungus.
[0012] In any of the above applications, the rice blast fungus may be rice blast fungus (Magnaporthe oryzae) Guy11.
[0013] In any of the above applications, the Stenotrophomonas maltophilia may specifically be Stenotrophomonas maltophilia CGMCC NO.1.1788.
[0014] The present invention also protects a method for inhibiting, killing or preventing and controlling rice blast fungus, which can be achieved by directly or indirectly treating the rice blast fungus with Stenotrophomonas maltophilia.
[0015] In the above method, the killing of the rice blast fungus may be manifested as Stenotrophomonas maltophilia obtaining nutrition by killing the rice blast fungus.
[0016] In the above method, the killing method can be to besiege and kill the rice blast fungus.
[0017] In the above method, the inhibition of rice blast fungus may be manifested as inhibiting the growth of rice blast fungus and / or inhibiting the spore germination of rice blast fungus.
[0018] In any of the above methods, the rice blast fungus may be rice blast fungus (Magnaporthe oryzae) Guy11.
[0019] In any of the above methods, the Stenotrophomonas maltophilia may specifically be Stenotrophomonas maltophilia CGMCC NO.1.1788.
[0020] Experiments have shown that Stenotrophomonas maltophilia CGMCCNO.1.1788 can inhibit and kill rice blast fungi. Killing rice blast fungi is mainly manifested in killing rice blast fungi to obtain nutrients, and inhibiting rice blast fungi is mainly manifested in inhibiting the growth of rice blast fungi (the growth inhibition effect on rice blast fungi (Magnaportheoryzae) Guy11 reaches 90.9%) and / or inhibiting the germination of rice blast fungi spores. Currently, the problem of drug resistance caused by the abuse of antibiotics poses a serious threat. High-efficiency new biological agents can eliminate the problem of drug resistance and have considerable application prospects. Stenotrophomonas maltophilia can be used as a natural microbial antagonist to control rice blast disease, significantly reducing the use of chemical pesticides and preventing the development of drug resistance in plant pathogens caused by the abuse of chemical pesticides. The present invention has important application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 Stenotrophomonas maltophilia CGMCC NO.1.1788 inhibits the growth of rice blast fungus (Magnaporthe oryzae) Guy11, Rhizoctonia solani, Fusarium graminearum and Cochliobolus sativus.
[0022] Figure 2 Sma obtains nutrients to survive by killing Guy11.
[0023] Figure 3 Besiege and kill Guy11 for Sma. DETAILED DESCRIPTION
[0024] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0025] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0026] The quantitative tests in the following examples were all repeated three times, and the results were averaged.
[0027] In the following examples, Stenotrophomonas maltophilia CGMCC No. 1.1788 was purchased by the inventors of this application from the China General Microbiological Culture Collection Center (CGMCC). Hereinafter, Stenotrophomonas maltophilia CGMCC No. 1.1788 is referred to as Stenotrophomonas maltophilia or Sma.
[0028] In the following examples, the rice blast fungus (Magnaporthe oryzae) Guy11 is described in the following literature: Andrew J. Foster, Magdalena Martin-Urdiroz, Xia Yan, Harriet Sabrina Wright, Darren M. Soanes & Nicholas J.
[0029] Talbot. CRISPR-Cas9 ribonucleoprotein-mediated co-editing and counterselection in the rice blast fungus. Scientific Reports volume 8, Article number: 14355 (2018), which is named M. oryzae strain Guy11 in the literature. The Genbank of rice blast fungus (Magnaporthe oryzae) Guy11 in NCBI is GCA_050157985.1. Hereinafter, rice blast fungus (Magnaporthe oryzae) Guy11 is referred to as rice blast fungus Guy11 or Guy11.
[0030] The culture medium involved in the following examples is as follows:
[0031] The solutes and concentrations of the LB liquid culture medium were 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride, the solvent was water, and the pH value was 5.8; the medium was sterilized by high-temperature steam sterilization at 121°C for 20 min.
[0032] The solutes and concentrations of the LB solid medium were 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, and 15 g / L agar powder, the solvent was water, and the pH value was 5.8; the medium was sterilized by high-temperature steam sterilization at 121°C for 20 min.
[0033] The solutes and concentrations of NYG liquid culture medium are 5.0 g / L yeast extract, 5.0 g / L peptone, and 10 g / L glycerol, the solvent is water, and the pH value is 7.0; high-temperature steam sterilization is performed at 121°C for 20 min.
[0034] The solutes and concentrations of NYG solid medium are 5.0 g / L yeast extract, 5.0 g / L peptone, 10 g / L glycerol, and 15 g / L agar powder, the solvent is water, and the pH value is 7.0; high-temperature steam sterilization is performed at 121°C for 20 min.
[0035] PDA solid culture medium: Cut 200g of peeled potatoes into small pieces, add distilled water and boil for 20-30 minutes. Then filter through eight layers of gauze and collect the filtrate. Add 15g of agar to the filtrate and continue stirring to mix thoroughly. Then add 20g of glucose and stir thoroughly. After cooling slightly, dilute to 1000ml with distilled water. Finally, sterilize at 115°C for 20 minutes.
[0036] The solutes and their concentrations of CM solid culture medium are NaNO3 6g / L, KCl 0.52g / L, MgSO4.7H2O0.52g / L, KH2PO4 1.52g / L, Peptone 2g / L, Yeast extract 1g / L, Casamino acid 1g / L, D-Glucose 10g / L, Trace elements 1ml / L, Vitamin solution 1ml / L, and agar powder 15g / L. The solvent is water, and the pH value is adjusted to 6.5 with 10M NaOH. Sterilize with high-temperature steam at 121°C for 20min. Each 1L of Trace elements consists of 22gZnSO4.7H2O, 11g H3BO3, 5g MnCl2.4H2O, 5g FeSO4.7H2O, 1.7g CoCl2.6H2O, 1.6g CuSO4.5H2O, 1.5g Na2MoO4.5H2O, 50g Na4EDTA and water; each 100ml of Vitamin solution consists of Biotin 0.01g, Thiamine 0.01g, Pyridoxin 0.01g, Riboflavin 0.01g, PABA (p-aminobenzonic acid) 0.01g, Nicotinic acid 0.01g and water.
[0037] Example 1: Detection of the inhibitory effect of Sma on plant pathogenic fungi by mixed plate method
[0038] 1. Inoculate plant pathogenic fungi (Magnaporthe oryzae Guy11, Rhizoctonia solani, Fusarium graminearum, or Cochliobolus sativus) preserved on paper onto PDA solid medium and incubate at 28°C for 5 days. Then, transfer young mycelium from the edge of the colony to PDA solid medium, place upright, and incubate at 28°C in the light for 7 days. Use an inoculating loop to cut a fungal mass approximately 5 mm in diameter from the edge of the plate. This is the plant pathogenic fungal mass.
[0039] 2. Preparation of Sma working bacterial solution
[0040] (1) Thaw the Sma preservation solution stored at -80°C on an ice box. Then, use a toothpick to streak the Sma preservation solution on LB solid medium and incubate at 28°C for 2 days.
[0041] (2) Pick a single colony from the culture medium obtained in step (1) and inoculate it into LB liquid culture medium, shake and culture it at 28°C overnight, then add LB liquid culture medium to obtain the OD 600nm The Sma working bacterial solution is 0.4.
[0042] 3. After the sterilization, the PDA solid culture medium was cooled to about 50°C, and the Sma working bacterial solution prepared in step (2) was added and mixed thoroughly (the mixing ratio was: 10 μl Sma working bacterial solution: 10 ml PDA solid culture medium). Then, the mixture was poured into a sterile culture dish and allowed to stand and solidify to obtain an Sma plate.
[0043] 4. Use sterile tweezers to place the plant pathogenic fungus block prepared in step 1 in the center of the Sma plate or PDA plate (i.e., PDA solid culture medium) (PDA plate is used as a control), and gently press the block to ensure that it is in good contact with the culture medium. Then turn it upside down and place it in a constant temperature incubator at 28°C for culture. Observe the growth of plant pathogenic fungi hyphae every 24 hours, and record the hyphae diameter, morphology and interaction with Sma. Continue observing for 5-7 days until the hyphae of the plant pathogenic fungi cover the entire plate or obvious changes occur. Record the growth rate of the hyphae of the plant pathogenic fungi (cm / day) and the effect of Sma on the growth of plant pathogenic fungi.
[0044] The morphology of plant pathogenic fungi is shown in Figure 1A in the figure (Magnaporthe oryzae represents rice blast fungus Guy 11, Rhizoctonia solani represents Rhizoctonia solani, Fusarium graminearum represents Fusarium graminearum, and Cochliobolus sativus represents Cochliobolus sativus; the upper left corner of each figure indicates a PDA plate with plant pathogenic fungi, and +Sma indicates an Sma plate with plant pathogenic fungi). The results showed that Sma had strong inhibitory effects on Magnaporthe oryzae Guy 11, Rhizoctonia solani, Fusarium graminearum, and Cochliobolus sativus, with the strongest inhibitory effect on Magnaporthe oryzae Guy 11.
[0045] The effect of Sma on the mycelial growth of Magnaporthe oryzae Guy11 was observed. The results showed that the growth of Magnaporthe oryzae Guy11 on Sma plates was almost completely inhibited (see Figure 1 In B, Guy11 is the PDA plate on which Guy11 was placed, Sma+Guy11 is the Sma plate on which Guy11 was placed, and time is the incubation time of the plant pathogenic fungus on the plate); the quantitative results showed that the growth inhibition rate of Sma on Guy11 was 90.9% ( Figure 1 In (C), the ordinate is the colony diameter and the abscissa is the culture time).
[0046] Example 2: Sma obtains nutrients by killing Guy11
[0047] 1. Sma kills rice blast fungus
[0048] 1. Preparation of Guy11 spore suspension 1
[0049] Add 2-3 ml of 10 mM MgCl₂ aqueous solution to a Guy 11 culture dish (for collecting spores) of the rice blast fungus (Magnaporthe oryzae). Gently scrape the colonies with a glass rod, shake, and filter through a 40 μm filter (to remove hyphae). Collect the filtrate in a 50 ml centrifuge tube. Count the spores using a hemocytometer and adjust with water to obtain a Guy 11 spore suspension with a spore concentration of approximately 25 spores / μl. Note that the spore suspension should be washed immediately before use to avoid germination due to prolonged storage.
[0050] 2. Thaw the Sma preservation solution stored at -80℃ on an ice box, then use a toothpick to pick up the bacterial solution and streak it on LB solid medium, and culture it at 28℃ for 2 days. Pick a single colony from the culture medium and inoculate it into LB liquid medium, culture it at 28℃ with shaking overnight, then add LB liquid medium to obtain the OD value. 600nm The Sma bacterial solution is 1.0.
[0051] 3. Thaw the Xanthomonas campestris pv. campestris (Xcc8004) preservation solution stored at -80℃ on an ice box. Then, use a toothpick to streak the Xcc8004 preservation solution on NYG solid medium and culture at 28℃ for 2 days. Then, pick a single colony and inoculate it into NYG liquid medium. Culture it with shaking at 28℃ overnight. Then, add NYG liquid medium and obtain the OD value. 600nm The Xcc bacterial solution is 1.0.
[0052] 4. Co-cultivation
[0053] After 10 ml of sterilized CM solid culture medium has cooled to about 50°C, add 50 μl of Guy11 spore suspension 1 and 10 μl of bacterial solution (Sma solution or Xcc solution), mix, and culture at 28°C for 5-6 days to observe the germination of Guy11 spores (Xcc solution is used as a control).
[0054] See the results Figure 2 The results showed that, compared to wild-type Guy11 spores, Guy11 spores mixed with Sma did not germinate at all, but spores mixed with wild-type Xanthomonas campestris germinated normally. This suggests that Sma can affect the germination of Guy11 spores, indicating that Sma can kill rice blast fungi.
[0055] Quantification of Fungal and Bacterial Biomass Changes after Co-cultivation Using qPCR
[0056] The copy numbers of bacterial 16S rRNA and 28S rRNA of rice blast fungus were used to quantify the biomass of bacteria and rice blast fungus, respectively, to quantitatively characterize the killing ability of bacteria against rice blast fungus (Li Z, Ye X, Liu M, Xia C, Zhang L, Luo X, Wang T, Chen Y, Zhao Y, Qiao Y, Huang Y, Cao H, Gu X, Fan J, CuiZ, Zhang ZA novel outer membrane β-1,6-glucanase is deployed in the predation of fungi by myxobacteria. ISME J. 2019 Sep; 13(9): 2223-2235.).
[0057] 1. Preparation of Guy11 spore suspension 2
[0058] Add 2-3 ml of 10 mM MgCl2 aqueous solution to a Guy11 culture dish (for collecting spores) of rice blast fungus (Magnaporthe oryzae). Gently scrape the colony with a toothpick, shake, and filter through a 40 μm filter (to remove hyphae). Collect the filtrate in a 50 ml centrifuge tube. Count the spores using a hemocytometer and adjust with water to obtain a spore concentration of approximately 5 × 10 4 2. Note that the spore suspension should be washed immediately before use to avoid germination due to long-term storage.
[0059] 2. After 10 ml of sterilized CM solid medium has cooled to approximately 50°C, add 10 μL of the bacterial suspension (Sma or Xcc) prepared in Step 1, Guy11 spore suspension 2, or a mixture (5 μL of bacterial suspension and 5 μL of Guy11 spore suspension 2), mix, and incubate at 28°C for 4 days. Subsequently, use an inoculating loop to remove an equal amount of sample, place it in a 1.5 ml EP tube, and snap-freeze in liquid nitrogen.
[0060] 3. Total DNA from the sample obtained in step 2 was extracted using the phenol-chloroform method. The relative biomass was then quantified by absolute quantification of Sma16S rRNA, Xcc16S rRNA, and 28S rRNA copies of the rice blast fungus, thereby quantitatively characterizing the bacterial ability to kill the blast fungus. Absolute quantification of copy number was performed using quantitative PCR. Three independent samples were used in three separate experiments.
[0061] The primers for detecting Sma16S rRNA were Sma-16s-f: ttacgctaataccgcatacgacct and Sma-16s-r: aggagtctggaccgtgtctcag.
[0062] The primers for detecting Xcc16S rRNA were Xcc-16s-f: tagggaaacttacgctaataccgc and Xcc-16s-r: agttccagtgtggctgatcatcct.
[0063] The primer for detecting 28S rRNA of rice blast fungus is M-28S-F:
[0064] TACGAGAGGAACCGCTCATTCAGATAATTA and M-28S-R:
[0065] TCAGCAGATCGTAACGATAAAGCTACTC.
[0066] qPCR quantitative analysis was performed on the copy numbers of bacterial Sma / Xcc 16S rRNA and rice blast fungus Guy11 28S rRNA. The results showed that due to the killing of Sma, the relative biomass of rice blast fungus Guy11 decreased by 98.2%, while the relative biomass of Sma increased by 50.2% ( Figure 2 Neutralization B, Sma is Sma solution, Sma+Guy11 is mixed solution, * indicates significant difference, **** indicates extremely significant difference); after adding Xcc, the relative biomass of rice blast fungus Guy11 decreased by only 6.9%, and the relative biomass of Xcc decreased by 80.8% (see Figure 2 In C, * indicates significant difference).
[0067] The above results indicate that Sma has the ability to kill Guy11, and Sma obtains nutrients for survival by killing Guy11.
[0068] Example 3: Sma besieges and kills Guy11
[0069] 1. Add 2-3 ml of 10 mM MgCl2 aqueous solution to a Guy11 culture dish (for collecting spores) of rice blast fungus (Magnaporthe oryzae). Gently scrape the colony with a sterile glass rod, shake, and filter with a 40 μm filter (to remove hyphae). Collect the filtrate in a 50 ml centrifuge tube. Count the number of spores using a hemocytometer. Then add water to adjust the spore concentration to approximately 5 × 10 4 spores / ml of Guy11 spore suspension.
[0070] 2. Take a PCR tube, add 100 μl of Guy11 spore suspension, then inoculate a single Sma colony and mix thoroughly to obtain a mixed suspension.
[0071] 3. Place three layers of filter paper in a fresh-keeping container. Add water until the filter paper is completely moistened but not confluent. Place a hydrophobic glass slide on top of the filter paper. Then, use a pipette to aspirate 15 μl of the mixed suspension prepared in step 2 or the Guy11 spore suspension (as a blank control) onto the hydrophobic glass slide. Place three drops on each slide, representing three replicates of each sample. Cover the fresh-keeping container and incubate in a 28°C incubator protected from light.
[0072] 4. After culturing in a 28°C incubator for about 8 hours in step 3, the cells were treated with the live cell fluorescent dye SYTO 9 (green) and the chitin-specific binding dye Calcofluor White Stain (blue), respectively, and observed and analyzed using a Leica TCS SP8 STED ultra-high resolution confocal microscope.
[0073] Observation results are shown in Figure 3 Figure A (SYTO 9 represents treatment with the live cell fluorescent dye SYTO 9, and CFW represents treatment with Calcofluor fluorescent brightener). The results showed that Guy11 spores cultured alone germinated to form germ tubes and appressoria, but Guy11 spores co-incubated with Sma failed to germinate and form germ tubes and appressoria; instead, Sma surrounded and gathered around the Guy11 spores.
[0074] 5. After culturing in a 28°C incubator for 1 h, 2 h, 3 h, or 4 h in step 3, treat with the dead cell dye propidium iodide (PI) (red), place the hydrophobic slide upside down on a glass slide, observe under a microscope, and count the Guy11 spore germination rate, the appressorium formation rate, and observe whether Sma can be adsorbed on the spores and the changes in spore morphology.
[0075] Some test results can be found in Figure 3 B and C. The results showed that wild-type Guy11 hyphae were filamentous, and Sma treatment caused Guy11 hyphae to swell and break into small balls, making it easier for Sma to kill.
[0076] These results suggest that Sma kills Guy11 by besieging and then killing it. This killing method differs from traditional epigenetic and non-contact killing and expands the existing lethal bacterial-fungal killing methods.
[0077] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.
Claims
1. Application of Stenotrophomonas maltophilia, as S1) or S2) or S3) S1) Killing rice blast fungus; S2) inhibiting rice blast fungus; S3) Control rice blast fungus.
2. The use according to claim 1, characterized in that: The killing of rice blast fungus is manifested in that Stenotrophomonas maltophilia obtains nutrition by killing rice blast fungus.
3. The use according to claim 1, characterized in that: The killing method is to besiege and kill the rice blast fungus.
4. The use according to claim 1, characterized in that: The inhibition of rice blast fungus is embodied in inhibiting the growth of rice blast fungus and / or inhibiting the spore germination of rice blast fungus.
5. The use according to any one of claims 1 to 4, characterized in that: The rice blast fungus is Magnaporthe oryzae Guy11.
6. The use according to any one of claims 1 to 5, characterized in that: The Stenotrophomonas maltophilia is Stenotrophomonas maltophilia CGMCC NO.1.1788.
7. A method for inhibiting, killing or preventing and controlling rice blast fungus, comprising directly or indirectly treating the rice blast fungus with Stenotrophomonas maltophilia.
8. The method according to claim 7, wherein: The killing of rice blast fungus is manifested in that Stenotrophomonas maltophilia obtains nutrition by killing rice blast fungus.
9. The method according to claim 7, wherein: The inhibition of rice blast fungus is embodied in inhibiting the growth of rice blast fungus and / or inhibiting the spore germination of rice blast fungus.
10. The method according to any one of claims 7 to 9, characterized in that: The rice blast fungus is Magnaporthe oryzae Guy11; The Stenotrophomonas maltophilia is Stenotrophomonas maltophilia CGMCCNO.1.1788.