A fusion protein expression frame for multiple gene editing of rice and application thereof

By constructing a fusion protein expression cassette of ribonuclease Csy4, DNA endonuclease nickase Cas9, M-MLV reverse transcriptase, and Cas12a nuclease in rice, the randomness and efficiency issues of multi-target editing in the CRISPR/Cas9 system in plants were solved, achieving efficient and stable multi-gene editing and improving editing accuracy.

CN121137039BActive Publication Date: 2026-06-19ANHUI AGRICULTURAL UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ANHUI AGRICULTURAL UNIVERSITY
Filing Date
2025-08-25
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

Existing CRISPR/Cas9 systems exhibit randomness and uncertainty in multi-site editing, precise base substitution, and complex trait improvement, leading to inaccurate editing. Furthermore, multi-target editing results in complex system structures, severe expression interference, and unstable editing efficiency. In particular, natural HDR efficiency is low in plant cells, making it difficult to achieve efficient and stable Prime Editing.

Method used

A fusion protein expression cassette was constructed using ribonuclease Csy4, DNA endonuclease nickase Cas9, M-MLV reverse transcriptase, and Cas12a nuclease. Through specific recognition and cleavage of pegRNA, combined with precise DNA cutting and base substitution, multi-gene and multi-type editing was achieved.

Benefits of technology

It improves the accuracy of gene editing, reduces inaccurate editing, and achieves high efficiency and stability in multi-target editing of rice, making it suitable for gene function verification and precision crop breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121137039B_ABST
    Figure CN121137039B_ABST
Patent Text Reader

Abstract

This invention relates to the field of genetic engineering technology, specifically to a fusion protein expression cassette for multiplex gene editing in rice and its applications. The fusion protein expression cassette for multiplex gene editing in rice provided by this invention includes the ribonuclease Csy4, the DNA endonuclease nickase Cas9, the M-MLV reverse transcriptase, and the Cas12a nuclease. In the guide editing fusion protein cassette, the ribonuclease Csy4 is located at the N-terminus, the DNA endonuclease nickase Cas9 is located between the ribonuclease Csy4 and the M-MLV reverse transcriptase, the M-MLV reverse transcriptase is located between the DNA endonuclease nickase Cas9 and the Cas12a nuclease, and the Cas12a nuclease is located at the C-terminus of the fusion protein cassette. This fusion protein expression cassette can not only ensure editing efficiency but also improve editing accuracy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a fusion protein expression cassette for multiplex gene editing in rice and its applications. Background Technology

[0002] The advent of the CRISPR / Cas system has greatly promoted the development of gene function research and crop genetic improvement, especially in plants, where Cas9 nuclease-based gene editing systems have become a highly efficient, precise, and convenient means of genome modification. Traditional CRISPR / Cas9 systems induce DNA double-strand breaks (DSBs) and utilize non-homologous end joining (NHEJ) or homologous recombination (HDR) mechanisms to achieve gene knockout, insertion, or repair. However, in applications such as multi-site editing, precise base substitution, and improvement of complex traits, these systems still face the following core bottlenecks: the DSB-based repair mechanism itself is random and uncertain, often leading to insertion / deletion mutations (indels) that have uncontrollable effects on the function of the target gene; simultaneous editing of multiple targets typically requires multiple gRNAs, multiple promoters, and multiple expression cassettes, resulting in a complex system structure, severe expression interference, and unstable editing efficiency, limiting its application in practical crop breeding; the natural HDR efficiency in plant cells is far lower than that in animal cells, and in the absence of efficient donor templates, precise substitution editing (such as point mutations and repair substitutions) is significantly limited.

[0003] To address these issues, Prime Editing (PE) technology was developed. This system consists of a Cas9 nickase (such as Cas9H840A) fused with reverse transcriptase (RT). Its editing process is independent of DSB and does not require exogenous donor DNA. Guided by pegRNA, it can precisely perform point mutations, base insertions, or small fragment deletions at target sites. Prime Editing has shown promising editing potential in animal cells and some plants, particularly suitable for high-fidelity site-directed modification of complex genomes. However, achieving efficient and stable Prime Editing in plant systems still faces many obstacles. In particular, the simultaneous expression of multiple pegRNAs competes for limited RNA polymerase resources, leading to uneven expression levels of each pegRNA; if multiple pegRNAs are directly tandem within the same expression framework, some pegRNAs often lose function due to splicing, transcription, or stability issues.

[0004] However, existing fusion protein expression cassettes produce a lot of inaccurate editing when performing single-target and multi-target editing, thus affecting the accuracy of editing. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a fusion protein expression cassette for multiplex gene editing in rice. By constructing a fusion protein expression cassette using ribonuclease Csy4, DNA endonuclease nickase Cas9, M-MLV reverse transcriptase, and Cas12a nuclease, the inventors discovered that when applied to single-target and multi-target editing in rice, the four components work together to not only ensure editing efficiency but also reduce inaccurate editing, thereby improving the accuracy of editing.

[0006] Therefore, the present invention provides the following technical solution:

[0007] In a first aspect, the present invention provides, in an optional embodiment, a fusion protein expression cassette for multiplex gene editing in rice, the fusion protein expression cassette comprising the ribonuclease Csy4, the DNA endonuclease nickase Cas9, the M-MLV reverse transcriptase, and the Cas12a nuclease;

[0008] In the guided editing fusion protein frame, the ribonuclease Csy4 is located at the N-terminus of the guided editing fusion protein frame, the DNA endonuclease nickase Cas9 is located between the ribonuclease Csy4 and the M-MLV reverse transcriptase, the M-MLV reverse transcriptase is located between the DNA endonuclease nickase Cas9 and the Cas12a nuclease, and the Cas12a nuclease is located at the C-terminus of the fusion protein frame.

[0009] In this invention, the ribonuclease Csy4 possesses the specific recognition and cleavage function of the Csy4 recognition sequence (Csy4 RS), which can cleave multiple pegRNA units tandemly in the transcript to release them into active monomers. The ribonuclease Csy4 is used to specifically recognize and cleave the Csy4 recognition site on the RNA precursor to release more pegRNA and crRNA. The DNA endonuclease nickase Cas9 is used for specific recognition of DNA sequences and site-specific cleavage of single-stranded DNA. The M-MLV reverse transcriptase is an RNaseH domain-deleted type to enhance its elongation stability. The M-MLV reverse transcriptase achieves precise base substitution at the target site based on the template sequence on the pegRNA. The Cas12a protein and crRNA complex precisely and specifically act on the DNA double-strand cleavage of the targeted knockout gene, thereby achieving efficient production of multiple genes and multiple types of editing simultaneously.

[0010] Preferably, the nucleotide sequence of the ribonuclease Csy4 is shown in positions 1 to 570 of SEQ ID NO.1; the nucleotide sequence of the DNA endonuclease nickase Cas9 is shown in positions 718 to 4818 of SEQ ID NO.1; the nucleotide sequence of the M-MLV reverse transcriptase is shown in positions 5137 to 6678 of SEQ ID NO.1; and the nucleotide sequence of the Cas12a nuclease is shown in positions 6802 to 10599 of SEQ NO.1.

[0011] Preferably, the fusion protein expression cassette further includes a linker polypeptide sequence, an XTEN linker sequence, an HIV-1 nucleocapsid protein NC, a nuclear localization signal SV40 NLS sequence, and a C-myc NLS sequence; the linker polypeptide sequence is located between the ribonuclease Csy4 and the DNA endonuclease nickase Cas9; the XTEN linker sequence is located between the DNA endonuclease nickase Cas9 and the HIV-1 nucleocapsid protein NC; the HIV-1 nucleocapsid protein NC is located between the XTEN linker sequence and the M-MLV reverse transcriptase; the nuclear localization signal SV40 NLS sequence is located between the M-MLV reverse transcriptase and the C-myc NLS sequence; and the C-myc NLS sequence is located between the nuclear localization signal SV40 NLS sequence and the Cas12a nuclease. The nucleotide sequences of the linking polypeptide sequence are shown from positions 571 to 717 in SEQ ID NO.1; the nucleotide sequences of the XTEN linking sequence are shown from positions 4819 to 4866 in SEQ ID NO.1; the nucleotide sequences of the HIV-1 nucleocapsid protein NC are shown from positions 4867 to 5034 in SEQ ID NO.1; the nucleotide sequences of the nuclear localization signal SV40NLS sequence are shown from positions 6682 to 6702 in SEQ ID NO.1; and the nucleotide sequences of the C-myc NLS sequence are shown from positions 6712 to 6738 in SEQ ID NO.1.

[0012] Preferably, the nucleotide sequence of the fusion protein expression cassette is shown in SEQ ID NO.1.

[0013] In this invention, the editing types of the fusion protein expression cassette used for multiple gene editing in rice include: performing multiple base substitutions in the promoter, splice site, or CDS region of the target gene; and performing knockout by introducing a TAG stop codon in the CDS region of the target gene, thereby achieving the multiple editing needs of multiple genes.

[0014] Secondly, in an optional embodiment, the present invention provides a backbone vector for plant multiplex gene editing, comprising the above-mentioned fusion protein expression cassette and pegRNA and crRNA expression cassette for rice multiplex gene editing.

[0015] Preferably, the nucleotide sequences of the pegRNA and crRNA expression cassettes are as shown in SEQ ID NO.2; and / or, the pegRNA and crRNA expression cassettes include a complex promoter sequence and a Csy4 protein-specific recognition RS sequence, the nucleotide sequence of the complex promoter sequence is shown in positions 1 to 993 of SEQ ID NO.2, and the nucleotide sequence of the RS sequence is shown in positions 1001 to 1020 and positions 2284 to 2303 of SEQ ID NO.2.

[0016] In this invention, the pegRNA and crRNA expression cassettes are mainly driven by the CMYL-35S-U6 complex promoter to express pegRNA, and are tandemly linked to the 8bp RS specific recognition site of the Csy4 protein. In addition, to facilitate subsequent target ligation, the BsaI restriction site is introduced and the resistance selection gene SPR is fused to form the sequence shown in SEQ ID NO.2.

[0017] Thirdly, in optional embodiments, the present invention provides a plant multiplex gene editing system, including the fusion protein expression cassette for rice multiplex gene editing described above or the backbone vector for plant multiplex gene editing described above.

[0018] Fourthly, in optional embodiments, the present invention provides a recombinant vector and host bacteria for plant multiple gene editing, including the aforementioned backbone vector for plant multiple gene editing.

[0019] The method for constructing the recombinant vector includes: designing the corresponding sgRNA sequence based on the coding sequence of the target gene and the expected mutation type, and determining the reverse transcription template (RT) and primer binding site (PBS) sequences; digesting the backbone vector with BsaI restriction enzyme; and using a Golden Gate assembly system containing BsaI sites to insert the pegRNA sequence, sgRNA backbone sequence, PBS sequence, RT sequence, and 8bp linker sequence (which completes targeted recognition and precise replacement) and the crRNA sequence (which completes targeted recognition and efficient knockout) into the backbone vector, replacing the original spectinomycin resistance gene (SpR) expression cassette, thereby constructing a crop gene-guided editing recombinant vector with directional editing function.

[0020] The host bacteria are those transformed with the recombinant vector, which can be used for subsequent plant transformation experiments, plasmid amplification, or storage, facilitating efficient site-directed base substitution or knockout editing operations in the crop genome.

[0021] Fifthly, in an optional embodiment, the present invention provides an application of the above-described plant multiplex gene editing system in rice gene knockout and single base substitution.

[0022] The application involves introducing the constructed recombinant expression vector into plant cells, enabling the plant cells to simultaneously express the fusion protein expression cassette and tandem pegRNA and crRNA expression boxes. The Csy4 domain in the fusion protein expression cassette specifically recognizes and cleaves the pegRNA precursor, releasing multiple functional pegRNAs and crRNAs. These pegRNAs and crRNAs guide the fusion protein to accurately recognize target genomic sites, completing targeted editing and achieving simultaneous gene knockout and precise single-base substitution.

[0023] Furthermore, the gene knockout described in this invention includes introducing Indels by forming DNA double-strand breaks in the target gene sequence; single base substitutions include, but are not limited to, precise substitutions of single nucleotides (such as C→T or G→A). Simultaneous editing of multiple targets using the above system can yield mutant plants with specific genetic modifications, suitable for gene function verification and precision crop breeding.

[0024] The nucleotide sequence of SEQ ID NO.1 is shown below:

[0025]

[0026] The amino acid sequence of SEQ ID NO.2 is shown as follows:

[0027] ATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAG

[0028] TTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACG

[0029] ACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGA

[0030] CTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTT

[0031] ATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAG

[0032] GCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGC

[0033] ATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATTGGCAG

[0034] ACATACTGTCCCACAAATGAAGATGGAATCTGTAAAAGAAAACGCGTGAAATAATGCGTCTGA

[0035] CAAAGGTTAGGTCGGCTGCCTTTAATCAATACCAAAGTGGTCCCTACCACGATGGAAAAACTGT

[0036] GCAGTCGGTTTGGCTTTTTCTGACGAACAAATAAGATTCGTGGCCGACAGGTGGGGGTCCACC

[0037] ATGTGAAGGCATCTTCAGACTCCAATAATGGAGCAATGACGTAAGGGCTTACGAAATAAGTAAG

[0038] GGTAGTTTGGGAAATGTCCACTCACCCGTCAGTCTATAAATACTTAGCCCCTCCCTCATTGTTAA

[0039] GGGAGCAAAATCTCAGAGAGATAGTCCTAGAGAGAGAAAGAGAGCAAGTAGCCTAGAAGTAG

[0040] TCAAGGCGGCGAAGTATTCAGGCACGTGGCCAGGAAGAAGAAAAGCCAAGACGACGAAAAC

[0041] AGGTAAGAGCTAAGCATCTAGAAAGTTGAAAACAATCTTCAAAAGTCCCACATCGCTTAGATAA

[0042] GAAAACGAAGCTGAGTTTATATACAGCTAGAGTCGAAGTAGTGATTGAACAAAGTTCACTGCC

[0043] GTATAGGCAGAGAGACCAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGT

[0044] AGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAG

[0045] TGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAG

[0046] CAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGC

[0047] AGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGGGGGAAGCGGTGATCGCCGAAGTATCGA

[0048] CTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACA

[0049] TTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACG

[0050] GTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCG

[0051] GCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGAC

[0052] ATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACA

[0053] TTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGC

[0054] AAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGA

[0055] ACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCT

[0056] GGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAA

[0057] TCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCG

[0058] TCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGA

[0059] TCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAATG

[0060] TCTAGCTAGAAATTCGTTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAACTCAAGCGTTAGATG

[0061] CACTAAGCACAATAATTGCTCACAGCCAAACTATCAGGTCAAGTCTGCTTTTATTATTTTTAAGCG

[0062] TGCATAATAAGCCGGTCTCATTGACGCGGTTCTATCTAGTTACGCGTTAAAACCAACTAGAAAGTT

[0063] CACTGCCGTATAGGCAGTTTTTTTTGATATCTCCGGGGCTAATTGAATATGAAGATGAAGATGAA

[0064] ATATTTGGTGTGTCAAATAAAAAGCTGGTGTGCTTAAGTTTGTGTTTTTTTCTTGGCTTGTTGTG

[0065] TTATGAATTTGTGGCTTTTTCTAATATTAAATGAATGTAAGATCTCATTATAATGAATAAACAAATG

[0066] TTTCTATAATCCATTGTGAATGTTTTGTTGGATCTCTTCTGCAGCATATAACTACTGTATGTGCTATGGTATGGACTATGGAATATGATTAAAGATAAG.

[0067] Compared with the prior art, the present invention has one of the following beneficial effects:

[0068] 1. This invention constructs a fusion protein expression cassette by combining ribonuclease Csy4, DNA endonuclease nickase Cas9, M-MLV reverse transcriptase, and Cas12a. When applied to single-target and multi-target editing in rice, the inventors found that the four components work together to not only ensure editing efficiency but also reduce inaccurate editing, thereby improving the accuracy of editing.

[0069] 2. Compared with previous dual editing methods, the fusion protein and its subsequent vector strategy provided by this invention can achieve more precise and efficient multiple editing of genes. Attached Figure Description

[0070] Figure 1 This is a schematic diagram of the structure of the PE-KO carrier constructed in Embodiment 1 of the present invention;

[0071] Figure 2 This is a schematic diagram of the phenotypic results of plants with simultaneous editing of plant type regulating genes mediated by PE-KO in Example 2 of the present invention;

[0072] Figure 3 This is a schematic diagram showing the comparison results of different expression vectors in terms of editing accuracy and efficiency in Embodiment 3 of the present invention. Detailed Implementation

[0073] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0074] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0075] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0076] Example 1

[0077] Design of multiple gene editing systems

[0078] The backbone vector of the guided editing system in this embodiment includes an expression cassette of pegRNA and crRNA tandem; and an expression cassette of the PE-KO fusion protein composed of ribonuclease Csy4, DNA endonuclease nickase Cas9, M-MLV reverse transcriptase, and Cas12a nuclease. The construction of the multiplex editing system expression vector includes constructing the above two parts. These two expression cassettes are designed separately and ligated into the PHUC backbone vector. The above two expression cassettes are unique parts of the expression vector of the guided editing system in this embodiment; they may also include some general structures found in conventional vectors, which will not be elaborated here.

[0079] 1. Construction of fusion protein expression cassette:

[0080] The fusion protein expression cassette of the present invention is named PE-KO, and its sequence is shown in SEQ ID NO.1.

[0081] The ribonuclease Csy4 and linker genes were synthesized at Suzhou Genewise Biotechnology Co., Ltd., then ligated into the PUC57-AMP vector to form the PUC57-AMP-Csy4-linker vector, which was then loaded into Escherichia coli XL-blue strain.

[0082] Based on the principle of homologous recombination splicing, the Csy4-linker gene, the DNA endonuclease nickase Cas9 gene, the M-MLV reverse transcriptase, and the Cas12a nuclease gene were ligated into a T vector. The specific procedures are as follows:

[0083] Primers were synthesized based on the splicing sequences of the Csy4-linker gene, the Cas9 DNA endonuclease gene, the M-MLV reverse transcriptase gene, and the Cas12a nuclease gene, as well as the T-vector sequence:

[0084] The upstream primer for the Csy4-linker gene is: 5'-TTACGCCAAGCTGCCCTTGCTGCAGGGCCACCATGGACC ACTACCTCGA-3'.

[0085] The downstream primer for the Csy4-linker gene is: 5'-atggagtacttcttgtcCACTTTTCTCTTTTTCTTAGG-3'.

[0086] The upstream primer for the DNA endonuclease Cas9 gene is: 5'-gacaagaagtactccatcggcc-3'.

[0087] The downstream primer for the DNA endonuclease Cas9 gene is: 5'-GCGGCCGAGGTCCTCTTGGCCCGCGGGGC TTCTTTG-3'.

[0088] The upstream primer for the M-MLV reverse transcriptase gene is: 5'-CAAGAGGACCTCGGCCGCAGACCTCCCTCCTTTC-3'.

[0089] The downstream primer for the M-MLV reverse transcriptase gene is: 5'-AGTAAAGAGCCGCGGCCCTCTCCTGATCCATCGAGCTTCACC-3'.

[0090] The upstream primer for the Cas12a nuclease gene is: 5'-AGGGCCGCGGCTCTTTACTCACTTGTGGCGACGTGGA-3'.

[0091] The downstream primer for the Cas12a nuclease gene is: 5'-TCAaacCACCTTGCGCTTCTTCTTCGGGGAGCCGCCGG A-3'.

[0092] Using PUC57-AMP-Csy4-linker as a template, PCR amplification was performed using upstream and downstream primers of the Csy4-linker gene, and the PCR products were recovered. Using the nickase Cas9 gene as a template, PCR amplification was performed using upstream and downstream primers of the nickase Cas9 gene, and the PCR products were recovered. Using the M-MLV reverse transcriptase gene as a template, PCR amplification was performed using upstream and downstream primers of the M-MLV reverse transcriptase gene, and the PCR products were recovered. Using the Cas12a nuclease gene as a template, PCR amplification was performed using upstream and downstream primers of the Cas12a nuclease gene, and the PCR products were recovered. The four recovered PCR products and the T vector fragment digested with EcoRI were combined according to the principle of homologous recombination to form a gene that integrates the Csy4-linker gene, the DNA endonuclease nickase Cas9 gene, the M-MLV reverse transcriptase gene, and the Cas12a nuclease gene, named the T-PE-KO gene.

[0093] 2. Construction of plant-targeting vectors containing the PE-KO gene

[0094] Plasmids were extracted from *E. coli* XL-blue containing the T-PE-KO vector using the Axygen plasmid extraction kit. The PE-KO gene fragment was recovered after digestion with PstI / SacI. Simultaneously, the intermediate vector pHUC400 was linearized using PstI / SacI, and the pHUC400 fragment was recovered. The PE-KO gene fragment and the pHUC400 fragment were ligated using Quick ligase (purchased from NEB) to obtain the plant intermediate vector pHUC400-PE-KO. Plasmids were then extracted from *E. coli* XL-blue containing the pHUC400-PE-KO plant intermediate vector using the Axygen plasmid extraction kit. The PE-KO gene fragment was recovered after digestion with HindIII.

[0095] 3. Construction of multiple pegRNA tandem expression cassettes

[0096] The pegRNA expression cassette is composed of a 35S-CmYLCV-U6 complex promoter, a Csy4 RS gene sequence, a spectinomycin resistance gene SpR, a Csy4 RS sequence, a Q1 sequence, and a polyT-HSPt complex terminator. Synthesized by Suzhou Genewise Biotechnology Co., Ltd., the pegRNA expression cassette is coupled with HindIII restriction sites at both ends, ligated into the pUC57-AMP vector, and loaded into *E. coli* XL-blue strain. The pegRNA expression cassette is then ligated into the pHUC backbone vector using an enzyme digestion and ligation reaction.

[0097] The final vector sequence obtained above is as follows: Figure 1 As shown, it was named pHUC422-PE-KO. The pegRNA fragment was amplified using PCR primers. Two or more pegRNA fragments were ligated into one fragment using fusion PCR. Each pegRNA unit contained: a guide sequence (spacer), 20 nt in length, corresponding to the target site; a PBS region, approximately 13 nt in length, complementary to the sequence near the target site; an RT template region, approximately 10-30 nt in length, designed according to the expected editing; and a Csy4 recognition site (CRS) placed between the two pegRNAs to achieve cleavage and release. Then, multiple pegRNA tandem fragments were ligated into the BsaI-digested pHUC422-PE-KO vector using the Gibson method, replacing the spectinomycin resistance gene SpR. For example, the pHUC422-PE-KO-D10-PIN1b vector was constructed.

[0098] PIN1b crRNA backbone, synthesizing FP:5'-GCAGTAATTTCTACTATGTGTAGATCTCAAGGGCATGTACGGGGAGTTGTTCACTGCCGTATAGGCAG-'3;

[0099] RP:5'-TGCACTGCCTATACGGCAGTGAACAACTCCCCGTACATGCCCTTGAGATCTACACATAGTAGAAATTA-'3;

[0100] The D10 target sequence was amplified using the sgRNA backbone as a template. FP: 5'-TGCAGGATGGCACGTACCTGGTTTCAGAGCTATGCTGG-'3;

[0101] RP:5'-TCAATATCTTTAGGCACGTACCCGAGGAACGGCCGCACCGACTCGGTGCCA-'3;

[0102] The amplified fragment was ligated to the vector via a goldgate method, and the correct target vector was obtained through streak screening, PCR identification, and sequencing. The vector was then transformed to obtain the corresponding Agrobacterium.

[0103] Example 2

[0104] Rice genetic transformation and editing efficiency detection

[0105] Agrobacterium tumefaciens transformed into the recombinant expression vector was subjected to Agrobacterium-mediated genetic transformation. The genetic transformation, transformant selection, and transgenic plant regeneration were carried out in accordance with the methods proposed by Yongbo Duan (Yongbo Duan, Chenguang Zhai, et al. An efficient and high-throughput protocol for Agrobacterium mediated transformation based on phosphomannose iso merase positive selection in Japonica rice (Oryza sativa L.)[J]. Plant Cell Report, 2012.DOI 10.1007 / s00299-012-1275-3.).

[0106] For each vector, hygromycin-resistant (HYG) callus was extracted, and 200 resistant callus cells selected after 2 weeks were used using a plant genome mini-extraction kit (Tiangen Biotech). Genomic DNA was extracted. Primers were synthesized to amplify the target fragment, and three biological replicates were set up for amplicon NGS sequencing and analysis.

[0107] Rice tillering phenotype is synergistically regulated by multiple genes. A single SNP mutation in the D10 gene results in shorter plant height and increased tillering; while a loss-of-function mutation in the PIN1b gene significantly increases the number of tillers. In this invention, the PE-KO editor is used to simultaneously edit both the D10 and PIN1b genes. PegRNA causing T-to-C substitution in the D10 gene and crRNA causing knockout of the PIN1b gene are designed and targeted at rice callus to efficiently obtain lines with simultaneous mutations in both D10 and PIN1b. Phenotypic observation shows that both gene mutations significantly reduce plant height and increase tillering. Genotypes and phenotypes are as follows: Figure 2 As shown.

[0108] Example 3

[0109] To compare the efficiency and accuracy of existing commonly used editors that mediate multiple edits, different expression vehicles were constructed sequentially:

[0110] 1: The PE-KO expression cassette involved in this invention mediates the knockout of gene A and the base substitution of gene B, respectively. Figure 3 PE-KO in the middle;

[0111] 2: PE protein + two sgRNA expression cassettes mediate gene A knockout + one pegRNA mediates gene B base substitution, i.e. Figure 3 C4ePE2-nick;

[0112] 3: The knockout of gene A is mediated by the full Cas9 PE protein + an sgRNA expression cassette + a base substitution of gene B is mediated by a pegRNA. Figure 3 C4ePE2-full in;

[0113] Selecting two types of genes as targets, statistical results show that the PE-KO expression vector provided by this invention significantly reduces the generation of inaccurate editing without affecting site efficiency. Considering editing efficiency, the PE-KO expression vector provided by this invention has significantly higher editing efficiency in gene A knockout than other expression vectors; and in gene B base substitution, the PE-KO expression vector provided by this invention is also more efficient than the other two expression vectors; furthermore, the statistical results of dual-gene co-editing efficiency also indicate that the PE-KO expression vector provided by this invention is optimal. Regarding precision, the PE-KO expression vector provided by this invention can efficiently knock out gene A, while gene B undergoes a specific type of base substitution; the other expression vectors either have low gene A knockout efficiency or cause gene B to undergo indel mutations such as deletion / insertion in addition to specific base substitutions, resulting in editing byproducts.

[0114] In summary, the expression vector PE-KO provided by this invention has significant advantages in achieving precise co-editing of multiple genes.

[0115] Although the principles of the present invention have been described in detail above with reference to preferred embodiments, those skilled in the art should understand that the above embodiments are merely illustrative explanations of the implementation of the present invention and are not intended to limit the scope of the present invention. The details in the embodiments do not constitute a limitation on the scope of the present invention. Any obvious changes, such as equivalent transformations or simple substitutions, based on the technical solutions of the present invention without departing from the spirit and scope of the present invention fall within the protection scope of the present invention.

Claims

1. A fusion protein expression cassette for multiplex gene editing in rice, characterized in that, The nucleotide sequence of the fusion protein expression cassette is shown in SEQ ID NO.

1.

2. A backbone vector for plant multiplex gene editing, characterized in that, It includes the fusion protein expression cassette and pegRNA and crRNA expression cassette for rice multiplex gene editing as described in claim 1.

3. The backbone vector for plant multiplex gene editing according to claim 2, characterized in that, The nucleotide sequences of the pegRNA and crRNA expression cassettes are shown in SEQ ID NO.2; and / or, The pegRNA and crRNA expression cassettes include a complex promoter sequence and an RS sequence. The nucleotide sequence of the complex promoter sequence is shown in positions 1 to 993 of SEQ ID NO.2, and the nucleotide sequence of the RS sequence is shown in positions 1001 to 1020 and positions 2284 to 2303 of SEQ ID NO.

2.

4. A plant multiplex gene editing system, characterized in that, This includes the fusion protein expression cassette for multiple gene editing in rice as described in claim 1, or the backbone vector for multiple gene editing in plants as described in claim 2 or 3.

5. A recombinant vector or host bacterium for multiple gene editing in plants, characterized in that, Includes the backbone vector for plant multiple gene editing as described in claim 2 or 3.

6. The application of the plant multiplex gene editing system of claim 4 in rice gene knockout and single base substitution.