Recombinant bacteria with high yield of serine and application thereof in fermentative production of serine

By knocking out the ptsI gene in Escherichia coli and carrying out growth adaptation evolution and site-directed mutagenesis, a recombinant strain with high serine production was constructed, enhancing the expression of key genes. This solved the problems of low glucose transport efficiency and serine synthesis precursor diversion in L-serine fermentation production, and achieved efficient L-serine fermentation production.

CN121249549BActive Publication Date: 2026-04-10INST OF MICROBIOLOGY CHINESE ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511407687.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-29
Publication Date
2026-04-10
Estimated Expiration
2045-09-29

AI Technical Summary

Technical Problem

In existing technologies, the fermentation production of L-serine suffers from low glucose transport efficiency and serine synthesis precursor diversion, resulting in low fermentation yield. Furthermore, traditional methods are subject to environmental pollution and high costs.

Method used

By knocking out the ptsI gene in Escherichia coli, combined with growth-adaptive evolution and site-directed mutagenesis, a recombinant strain that produces high levels of serine was constructed. The expression of key genes serA, serB, and serC was enhanced, and the sdaA, sdaB, and tdcG genes were knocked out, thus forming an engineered strain that produces serine through efficient fermentation.

Benefits of technology

This improved the fermentation production efficiency of L-serine, solved the problems of low glucose transport efficiency and serine synthesis precursor diversion, and achieved high-yield L-serine fermentation production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121249549B_ABST
    Figure CN121249549B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of genetic engineering, and particularly relates to a recombinant bacteria with high yield of serine and application of the recombinant bacteria in fermentative production of serine. By knocking out ptsI gene of Escherichia coli, the present application blocks glucose PTS system, releases the association reaction between glucose transport and phosphorylation and PEP-pyruvate, and reduces the branch synthesis of pyruvate from serine synthesis precursor 3-phosphoglycerate. The present application further carries out growth adaptability evolution on the Escherichia coli with knocked out ptsI gene, and carries out sequencing on the obtained mutant strain, and the mutation is shown in Table 2. Finally, a chassis bacteria with accelerated growth rate is obtained. Then, by enhancing the expression of key serine genes serA, serB and serC of the mutant strain, and knocking out serine degradation pathway genes sdaA, sdaB and tdcG, the present application constructs an engineering bacteria for fermentative production of serine, and the serine yield of the engineering bacteria is significantly improved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to a recombinant bacterium with high yield of serine and application thereof in fermentative production of serine. BACKGROUND

[0002] L-serine (L-Serine), also known as 2-amino-3-hydroxypropionic acid, is a protein amino acid. Serine is a one-carbon unit donor for synthesis of various important biological substances in cells, and is involved in synthesis of purine, thymine and choline; after modification of the hydroxyl group of L-serine by phosphorylation, phosphoserine is formed, which is a main component of phospholipids and directly involved in construction of cell membranes. As a metabolic intermediate, L-serine is also a precursor for synthesis of glycine, cysteine, tryptophan and methionine. Although L-serine is a non-essential amino acid, it has many important physiological functions in organisms. Therefore, L-serine has wide application in the fields of chemical industry, pharmaceutical industry, cosmetic industry and food industry.

[0003] Industrial production methods of L-serine mainly include protein hydrolysis method, enzyme method and fermentation method. Protein hydrolysis method is easy to cause environmental pollution and corrosion of equipment; in addition, the hydrolysis product is mostly a mixture of amino acids, and further separation and purification of the target amino acid are required. Enzyme method utilizes SHMT reverse reaction to catalyze glycine and formaldehyde to generate serine, which is a main method for production of serine. This method has high cost of glycine substrate, and formaldehyde is toxic. Fermentation method uses glucose as carbon source to produce serine through strain fermentation, which has better application prospect.

[0004] The metabolic pathway of E. coli for synthesis of serine is as follows: first, glucose enters the cell through PTS transport system. Glucose transport EⅡGlc complex contains three subunits, which are encoded by crr and ptsG. EⅡAGlc accepts the phosphate group transferred from HPr and transfers it to EⅡBGlc, and EⅡBGlc transfers the phosphate group to glucose molecules which are specifically recognized and transported into the cell by EⅡCGlc, to complete the phosphorylation of glucose into glycolysis pathway. PTS system provides phosphate group for biochemical reactions related to phosphoenolpyruvate (PEP) to pyruvate, which is used for phosphorylation of glucose. Glucose is further oxidized to 3-phosphohydroxypyruvate through the metabolic intermediate 3-phosphoglycerate by 3-phosphoglycerate dehydrogenase (PGDH, encoded by serA gene); then, 3-phosphohydroxypyruvate and glutamate are subjected to amino group transfer under the action of phosphoserine aminotransferase (PSAT, encoded by serC gene), to form 3-phosphoserine; finally, 3-phosphoserine is hydrolyzed to serine under the action of phosphoserine phosphatase (PSP, encoded by serB gene).

[0005] In the glycolysis pathway, the precursor of serine, 3-phosphoglycerate, is an upstream intermediate metabolite of pyruvate, and thus, the PTS system is associated with the phosphorylation reaction of PEP to pyruvate, so that 3-phosphoglycerate is shunted to pyruvate, reducing the synthesis precursor of serine. Therefore, blocking the PTS system can theoretically improve the fermentation yield of serine by reducing the shunting of the synthesis precursor of serine, 3-phosphoglycerate, to the pyruvate pathway. However, after blocking the PTS system, the glucose transport efficiency is reduced, which seriously limits the growth of Escherichia coli. Therefore, the present application obtains a growth recovery mutant strain of Escherichia coli with a knockout ptsI gene by an adaptive evolution method, and applies the gene mutation thereof to the metabolic engineering construction of a serine fermentation strain, thereby improving the fermentation production efficiency of serine. SUMMARY

[0006] The present application aims to provide a recombinant bacterium with high yield of serine and its application in the fermentation production of serine, so as to solve the problems existing in the prior art.

[0007] To achieve the above-mentioned purpose, the present application provides the following solutions.

[0008] The present application provides an Escherichia coli △ptsI ALE-1, and the preservation number of the Escherichia coli △ptsI ALE-1 is CGMCC No. 35527.

[0009] The present application provides the application of the above-mentioned Escherichia coli △ptsI ALE-1 in the preparation of an engineering bacterium with high yield of serine.

[0010] Further preferably, the Escherichia coli △ptsI ALE-1 uses Escherichia coli as a chassis bacterium, knocks out the ptsI gene, and performs the following table mutations:

[0011]

[0012] The present application provides an engineering bacterium with high yield of serine, which uses the Escherichia coli △ptsI ALE-1 as an initial strain, knocks out the sdaA gene, the sdaB gene and the tdcG gene, and simultaneously introduces the serA gene, the serB gene and the serC gene.

[0013] The preservation number of the Escherichia coli △ptsI ALE-1 is CGMCC No. 35527.

[0014] Preferably, the nucleotide sequence of the sdaA gene is shown as SEQ ID NO: 15; the nucleotide sequence of the sdaB gene is shown as SEQ ID NO: 24; the nucleotide sequence of the tdcG gene is shown as SEQ ID NO: 33; the nucleotide sequence of the serA gene is shown as SEQ ID NO: 43; the nucleotide sequence of the serB gene is shown as SEQ ID NO: 46; and the nucleotide sequence of the serC gene is shown as SEQ ID NO: 46.

[0015] The application provides a method for constructing the high-serine yield engineering bacterium.

[0016] The sdaA gene, the sdaB gene and the tdcG gene of the E. coli △ptsI ALE-1 are knocked out, and the serA gene, the serB gene and the serC gene are introduced to obtain the high-serine yield engineering bacterium.

[0017] The preservation number of the E. coli △ptsI ALE-1 is CGMCC No. 35527.

[0018] Preferably, the nucleotide sequence of the sdaA gene is shown as SEQ ID NO: 15; the nucleotide sequence of the sdaB gene is shown as SEQ ID NO: 24; the nucleotide sequence of the tdcG gene is shown as SEQ ID NO: 33.

[0019] Preferably, the nucleotide sequence of the serA gene is shown as SEQ ID NO: 43; the nucleotide sequence of the serB gene is shown as SEQ ID NO: 46; and the nucleotide sequence of the serC gene is shown as SEQ ID NO: 46.

[0020] Preferably, the copy number of the serA gene, the serB gene and the serC gene is 1 copy.

[0021] The application provides an application of the high-serine yield engineering bacterium in the production of serine.

[0022] The application provides a method for producing serine, which comprises the step of producing serine by using the high-serine yield engineering bacterium.

[0023] The application has the following technical effects:

[0024] The present application blocks the glucose PTS system by knocking out the ptsI gene of E. coli, releases the association reaction of glucose transport and phosphorylation with PEP-pyruvate, and reduces the synthesis of pyruvate in the branch of the serine synthesis precursor 3-phosphoglycerate. However, the glucose metabolism of the E. coli with the ptsI gene knocked out is weakened, and the growth rate is greatly reduced. Therefore, the present application further carries out growth adaptive evolution on the E. coli with the ptsI gene knocked out, obtains a mutant strain with accelerated growth rate, and analyzes the genetic mutation site through genome sequencing, specifically: carrying out growth adaptive evolution on the E. coli with the ptsI gene knocked out by taking glucose as raw material, in the experimental process, first, glucose enters the cell to generate 3-phosphoglycerate (3-PG) through the glycolytic pathway; second, as the synthesis precursor of L-serine, 3-PG can obtain L-serine through three reactions: 3-phosphoglycerate is oxidized to 3-phosphohydroxypyruvate (3-PHP) under the action of 3-phosphoglycerate dehydrogenase (PGDH, encoded by serA gene); then, 3-phosphohydroxypyruvate and glutamate are transferred between the amino groups under the action of phosphoserine aminotransferase (PSAT, encoded by serC gene), to form 3-phosphoserine; finally, 3-phosphoserine is hydrolyzed to form L-serine under the action of phosphoserine phosphatase (PSP, encoded by serB gene); wherein, PGDH is an important factor for synthesizing 3-PHP in the synthesis process of L-serine, and is also a rate-limiting enzyme in the whole process, and is inhibited by feedback of L-serine; then, the obtained mutant strain is sequenced, and the mutation is shown in Table 2, and finally a growth rate accelerating chassis bacterium, E. coli △ptslALE-1, is obtained, and the preservation number is CGMCC No. 35527. On the basis of the strain provided in the present application, an engineering bacterium for fermentative production of serine can be obtained.

[0025] In order to release the feedback inhibition of serine, the present application adopts site-directed mutagenesis technology to site-directly mutate the 344th histidine and the 346th aspartic acid codons of the PGDH enzyme of E. coli △ptslALE-1 to alanine codons. Then, the present application carries out adaptive evolution on the mutant strain with growth recovery through metabolic engineering, and produces serine by fermentation. In the specific embodiment of the present application, the engineering bacterium for fermentative production of serine is constructed by enhancing the expression of the key serine genes serA, serB and serC, and knocking out the serine degradation pathway genes sdaA, sdaB and tdcG, that is, in the mutant strain, the serA gene, the serB gene and the serC gene are overexpressed, and the sdaA gene is knocked out, to obtain the engineering bacterium for fermentative production of serine. The serine yield of the engineering bacterium is significantly improved.

[0026] In conclusion, by the method of adaptive evolution, the growth recovery mutant strain of E. coli with ptsI gene knocked out is obtained, and the gene mutation is applied to the metabolic engineering construction of serine fermentation strain, so that the fermentation production efficiency of serine is improved, and ideas and directions are provided for subsequent research. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 Growth rate investigation results of the unevolved strain (PTS- strain E. coli MG1655AptsI or MG1655AptsI) and the evolved strain (PTS-ALE-1 strain or MG1655AptsIALE-1) using Glc. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present application will now be described in detail with reference to the figures. Such description, however, is to be considered in all respects only as illustrative, and not restrictive.

[0029] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, where particular ranges of values are given, understand that each intervening value, to the upper or lower limit of the ranges is also specifically included. Each smaller range that falls within the integer ranges are also specifically included. The upper and lower limits of these smaller ranges can independently be included or excluded in the range.

[0030] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict, the present specification will control.

[0031] Various modifications and changes can be made to the specific embodiments of the present application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples presented herein. The description and examples are illustrative of the application and are not intended to limit the scope of the application.

[0032] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having" or the like are open-ended terms that are intended to mean including, but not limited to.

[0033] The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all commercially available from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples are all set up in triplicate, and the results are averaged. The technical means used in the following examples are conventional means known to those skilled in the art and commonly used instruments and reagents available on the market unless otherwise specified, which can be found in Molecular Cloning: A Laboratory Manual (3rd Edition) (Science Press), Microbiology Experiments (4th Edition) (Higher Education Press), and the manufacturer's instructions of the corresponding instruments and reagents, etc.

[0034] In the following examples, each nucleotide sequence in the sequence listing is written from left to right in the order of 5' to 3' end, and each amino acid sequence is written from left to right in the order of amino-terminal to carboxyl-terminal. If the sequence described in the specification is inconsistent with that in the sequence listing, the sequence described in the specification shall prevail.

[0035] Escherichia coli K12 MG1655 (E. coli MG1655): ATCC No. 700926, the genome version of this strain is U00096.3. pACYC184 plasmid: NEB, product catalog No. E4152S. Plasmid pcas9 was purchased from Addgene, item No. 62225; plasmid pTargetF was purchased from Addgene, item No. 62226; Gene Mutagenesis Kit (Site-Directed Mutagenesis Kit) was purchased from NEB, item No. E0552S. Site-Directed Mutagenesis Kit) was purchased from NEB, item No. E0552S.

[0036] Example 1, Construction of engineered E. coli MG1655ΔptsI

[0037] The CRISPR-Cas9 gene editing system containing pCas9 and pTargetF vectors reported in the literature was used (Jiang, Y., Chen, B., Duan, C. L., Sun, B. B., Yang, J. J., and Yang, S. (2015) MuLtigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System, AppL Environ Microb 81, 2506-2514.).

[0038] Gene Mutagenesis Kit (Site-Directed Mutagenesis Kit) from NEB, item No. E0552S. Site-Directed Mutagenesis Kit, Cat. No. E0552S) according to the kit instructions to mutate the pTargetF vector with primers Q45 (SEQ ID NO: 4) and Q46 (SEQ ID NO: 5), the sequence of N20 mutation in the pTargetF vector is tgaatacctgaaagaacgtg (SEQ ID NO: 1), the sequence of the targeted knockout of ptsI gene is shown as SEQ ID NO: 2, and the mutated pTargetF is named as pTargetF-ptsI.

[0039]

[0040] The upstream homologous arm sequence was amplified using primers Q47 (SEQ ID NO: 6) and Q48 (SEQ ID NO: 7) and the downstream homologous arm sequence was amplified using primers Q49 (SEQ ID NO: 8) and Q50 (SEQ ID NO: 9) with E. coli MG1655 chromosome as template. The correct product was detected by 1% agarose gel electrophoresis and recovered. The two fragments were connected by overlapping PCR using Q47 (SEQ ID NO: 6) and Q50 (SEQ ID NO: 9) as primers to obtain a combination of two DNA fragments, Donor△ptsI, which deleted the 115-1560 bases of SEQ ID NO: 2, as a template for gene editing, and the sequence of Donor△ptsI is shown in SEQ ID NO: 3:

[0041] SEQ ID NO: 3: aactgatggcggaactcgagtaatttcccgggttcttttaaaaatcagtcacaagtaaggtagggttatgatttcaggcattttagcatcccgggtatcgctttcggtaaagctctgcttctgaaagaagacgaaattgtcattgaccggaaaaaaatttctgccgaccaggttgatcaggacgaattctctatgagcgccatttctatcccgcgcattaagaagattatccgtaacacgaacttcgaagatgcgaaggtgttagcagagcaggctcttgctcaaccgacaacggacgagttaatgacgctggttaacaagttcattgaagaaaaaacaatctgctaatccacgagatgcggcccaatttactgcttaggagaagatcatgggtttgttcgataaactgaaatctctggtttccgacgacaag.

[0042] The pCas9 plasmid was transformed into E. coli MG1655 and plated on a 50 mg / L kanamycin-containing plate and incubated at 30°C overnight to obtain the strain E. coli MG1655 / pCas9. The E. coli MG1655 / pCas9 bacterial lawn was inoculated into a 500 mL shake flask containing 50 mL of LB medium containing kanamycin and incubated at 30°C, 220 rpm, and when the OD 600 of the culture medium was 0.2, 10 mM arabinose was added for induction, and the OD600 For 0.45, prepare competent cells. Take 2 μL pTargetF-ptsI plasmid and 10 μL Donor△ptsI template DNA, electro-transform into E. coli MG1655 / pCas9 competent cells, and spread on a double-antibiotic plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and incubate at 30°C. Identify single colonies using primers Q51 (SEQ ID NO: 10) and Q52 (SEQ ID NO: 11), and sequence-verify the PCR product of correct size. Pick single colonies with correct sequence of the knockout ptsI gene, and add 0.2 mM isopropyl-β-D-thiogalactopyranoside (IPTG) to induce culture, eliminate the pTargetF-ptsI plasmid, and obtain recombinant bacteria E. coli MG1655△ptsI / pCas, which is still prepared as a competent cell stock according to the foregoing method.

[0043] Recombinant bacteria E. coli MG1655△ptsI / pCas are inoculated into antibiotic-free LB liquid medium, and incubated at 37°C for 12 h, diluted and spread on LB plates to obtain recombinant bacteria E. coli MG1655△ptsI (PTS- strain E. coli MG1655△ptsI) with the pCas plasmid eliminated. The primers used are shown in Table 1.

[0044] Table 1 Primer information

[0045]

[0046] Example 2, Growth adaptive evolution of PTS-strain E. coli MG1655△ptsI

[0047] PTS-strain E. coli MG1655△ptsI, which is significantly affected in the use of glucose for growth after knockout, is subjected to adaptive evolution, with the following steps:

[0048] (1) Streak activation of PTS-strain E. coli MG1655△ptsI

[0049] Streak LB solid medium from glycerol stock tubes in a -80°C freezer, and incubate in a 37°C incubator overnight.

[0050] (2) Preparation of seed liquid of PTS-strain E. coli MG1655△ptsI

[0051] Scrape the bacterial lawn in LB solid medium of PTS-strain E. coli MG1655△ptsI, inoculate into LB liquid medium, and incubate at 37°C, 200 rpm in a shaker, and measure OD 600 .

[0052] (3) Inoculation and evolution of PTS-strain E. coli MG1655△ptsI

[0053] MOPS medium without carbon source: (NH4)2SO48 g / L, KH2PO42 g / L, MOPS 60 g / L, NH3-H2O to pH 7.0, 121 °C high pressure sterilization for 20 min.

[0054] When the above strain culture is in the logarithmic phase, it is transferred at 1% (v / v) to MOPS medium without carbon source added with 1 g / L of Yeast extract, 20 g / L of Glucose, 2 g / L of MgSO4-7H2O and 2 mL of trace element liquid TSM, and cultured in a 37 °C, 200 rpm shaker. After 12 h of culture, the OD 600 (dilution ratio and calculation), according to the OD value, the inoculation volume is converted, and 1% (v / v) when OD is 1 is the conversion standard, and the culture is transferred to fresh MOPS medium. According to the OD value change trend every 12 h, the final concentration of Yeast extract in the culture medium is gradually reduced. Every several times of subculture, a certain amount of culture solution is preserved in a glycerol tube at -80 °C refrigerator, and the final concentration of Yeast extract is gradually reduced to 0 g / L and the inoculation amount is gradually reduced to 0.2% (v / v) during the subculture process.

[0055] (4) Characterization of Glc utilization ability of PTS-ALE-1 strain

[0056] When the above evolution is subcultured to a certain number of generations, the culture solution is diluted and plated on LB solid medium, single colonies are picked, and the growth curve is determined according to the method of characterization of Glc utilization ability of PTS-strain, and the change of the growth curve is compared with that of PTS-strain E. coli MG1655△ptsI. The growth rate is accelerated when glucose is used, which is PTS-ALE-1 strain, and the glycerol tube is preserved in a -80 °C refrigerator in time.

[0057] After about 60 days of continuous subculture, the results show that one PTS-strain has obvious phenomenon of faster growth rate. The growth rate of PTS-strain E. coli MG1655△ptsI is slow, the Yeast extract addition concentration is 1 g / L in the early stage, the inoculation amount is 1% (v / v), the OD value is determined at 12 h and 24 h, and the subculture is performed at 24 h. In the early evolution, the OD value rapidly rises to nearly 20 at 24 h. At the same time, during the evolution, it is observed that the OD value of the evolved strain (PTS-ALE-1 strain) gradually increases at 12 h, and the OD value does not obviously increase at 24 h.

[0058] MG1655ΔptsIALE-1 strain liquid was diluted and coated on LB solid medium, single colony was streaked on LB solid medium, and the bacterial lawn was scraped on LB medium and cultured overnight. The growth was determined by transferring to MOPS carbon-free medium (due to the long lag phase, the inoculum was increased to 5%). Compared with the non-evolved strain (PTS strain E. coli MG1655ΔptsI or MG1655ΔptsI), the evolved strain (PTS-ALE-1 strain or MG1655ΔptsIALE-1) had a faster growth rate using Glc Figure 1 The evolved strain was named E. coli MG1655ΔptsIALE-1 mutant strain, and was sent to Anleida Biotechnology Co., Ltd. for genome resequencing. The genetic mutation information is shown in Table 2.

[0059] Table 2 Mutation of E. coli MG1655ΔptsIALE-1 mutant strain compared with PTS strain E. coli MG1655ΔptsI

[0060]

[0061] The obtained E. coli MG1655ΔptsIALE-1 mutant strain was named Escherichia coliΔptsIALE-1, and its classification name was Escherichia coli, which was preserved in China General Microbiological Culture Collection Center (CGMCC) on August 6, 2025, the address of which is No. 1 Yard 3, Beijing Chaoyang District Beichen West Road, Institute of Microbiology, Chinese Academy of Sciences, and the preservation number is CGMCC No. 35527.

[0062] Example 3, metabolic engineering of serine-producing strain for fermentation

[0063] (1) Knockout of sdaA gene

[0064] The NEB gene mutation kit was used Site-Directed Mutagenesis Kit, Cat. No. E0552S) according to the kit instructions, the primers S1 (SEQ ID NO: 12, GTGGACGTTTAGTTTTAGAGCTAGAAATAGC) and S2 (SEQ ID NO: 13, GGCAACGCGGACTAGTATTATACCTAGG) were designed to mutate the pTargetF vector, the sequence of the pTargetF vector after mutation of N20 was CGCGTTGCCGTGGACGTTTA (SEQ ID NO: 14), the sequence of the sdaA gene to be knocked out was as shown in SEQ ID NO: 15, and the mutated pTargetF was named as pTargetF-sdaA.

[0065]

[0066] The primer S3 (SEQ ID NO: 16, GCCTATGAAGGCAGGTAAACAGTTCGTCGATGATCTGGTCGAAAAAGGCTTACTGGATAGGATTGGTGC) and S4 (SEQ ID NO: 17, CTGGCAACCAAC TTCCGCACCGGAAATAGAGGCGTTCATTTTATACAATG CACCAATCCTATCCAGT) were added to the PCR mixture to obtain a combination of two primers connected by overlap PCR, Donor△sdaA, which deletes the 123-962 bases of SEQ ID NO: 15, as a template for gene editing. The sequence of Donor△sdaA is shown in SEQ ID NO: 18.

[0067] SEQ ID NO: 18: GCCTATGAAGGCAGGTAAACAGTTCGTCGATGATCTGGTCGAAAA AGGCTTACTGGATAGGATTGGTGCATTGTATAAAATGAACGCCTCTATTTCCGGTGCGGAAGTTGGTTGCCAG.

[0068] The pCas9 plasmid was transformed into the adaptively evolved Escherichia coli △ptsIALE-1, coated on a plate containing 50 mg / L kanamycin resistance, and cultured overnight at 30°C to obtain the strain E. coli MG1655△ptsIALE-1 / pCas9. The E. coli MG1655△ptsIALE-1 / pCas9 bacterial lawn was picked into a 500 mL shake flask containing LB medium (50 mL) containing kanamycin, and cultured at 30°C, 220 rpm. When the OD 600 was 0.2, 10 mM arabinose was added for induction, and the OD 600Competent cells were prepared at a concentration of 0.45. 2 μL of pTargetF-sdaA plasmid and 10 μL of LdonorΔsdaA template DNA were electroporated into E. coli MG1655ΔptsIALE-1 / pCas9 competent cells and plated on double-antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and incubated at 30°C. Single colonies were identified using primers S19 (SEQ ID NO:19, GGATTGGTCCCTCATCTTC) and S20 (SEQ ID NO:20, CCAGCAGTTC TGCAAGAC). Sequencing verified the correct clone with deletions of bases 123-962 of SEQ ID NO:15. Select single colonies with the sdaA gene knocked out and correctly sequenced, add 0.2 mM isopropyl-β-D-thiogalactoside (IPTG) to induce culture, eliminate pTargetF-ptsI plasmid, and obtain recombinant E. coli MG1655ΔptsIALE-1ΔsdaA / pCas. Prepare competent cells according to the above method for later use.

[0069] The recombinant strain E. coli MG1655ΔptsIALE-1ΔsdaA / pCas was inoculated into antibiotic-free LB liquid medium and cultured at 37°C for 12 h. The culture was then diluted and plated on LB agar plates to obtain the recombinant strain E. coli MG1655ΔptsIALE-1ΔsdaA with pCas plasmid eliminated.

[0070] (2) Knockout of the sdaB gene

[0071] Using NEB's gene mutation kit ( Site-Directed Mutagenesis Kit (Catalog No. E0552S) was used to design primers S5 (SEQ ID NO:21, AGTGACAGCCGTTTTAGAGCTAGAAATAGC) and S6 (SEQ ID NO:22, CCTGGCCTGGACTAGTATTATACCTAGG) to mutate the pTargetF vector according to the kit instructions. The N20 mutation sequence in the pTargetF vector is CAGGCCAGAG GTGACAGCC (SEQ ID NO:23). The sdaB gene sequence was knocked out as shown in SEQ ID NO:24. The mutated pTargetF was named pTargetF-sdaB.

[0072]

[0073] The primer S7 (SEQ ID NO: 25, CTTCCAGTTCTCATACCGTTGGACCAATGAAAGCGGGTAAACAATTTACCGACGATCTGACAGTTCTGG) and S8 (SEQ ID NO: 26, ACGAGCCAGTGAGTTAGCGTTCACTTCGCGGATAAACTTGTCGTAGTACGCCAGAACTGTCAGATCGT) were added to the PCR mixture to obtain a combination of two primers connected by overlapping PCR, Donor AsdaB, as a template for gene editing, which deletes 101-883 bases of SEQ ID NO: 24, and the sequence of Donor AsdaB is shown in SEQ ID NO: 27.

[0074] SEQ ID NO: 27: CTTCCAGTTCTCATACCGTTGGACCAATGAAAGCGGGTAAACAATTTACCGACGATCTGACAGTTCTGGCGTACTACGACAAGTTTATCCGCGAAGTGAACGCTAACTCACTGGCTCGT.

[0075] The E. coli MG1655ALE-1AsdaA / pCas9 bacterial lawn was picked into a 500 mL shake flask containing LB medium (50 mL) containing kanamycin, and cultured at 30°C, 220 rpm, and when the OD 600 of the culture medium was 0.2, 10 mM arabinose was added for induction, and the OD 600Competent cells were prepared at a concentration of 0.45. 2 μL of pTargetF-sdaB plasmid and 10 μL of LdonorΔsdaB template DNA were electroporated into E. coli MG1655ΔptsIALE-1ΔsdaA / pCas9 competent cells and plated on double-antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and incubated at 30°C. Single colonies were identified using primers S21 (SEQ ID NO:28, CGATGTATTTCCTatgATTAGC) and S22 (SEQ ID NO:29, CCTAATAGTT CTGCCAGAC), and sequencing verified the correct clone with deletions at positions 101-883 of SEQ ID NO:24. Select single colonies with the sdaB gene knocked out and correctly sequenced, add 0.2 mM isopropyl-β-D-thiogalactoside (IPTG) to induce culture, eliminate pTargetF-ptsI plasmid, and obtain recombinant E. coli MG1655ΔptsIALE-1ΔsdaAB / pCas. Prepare competent cells according to the above method for later use.

[0076] The recombinant strain E. coli MG1655ΔptsIALE-1ΔsdaAB / pCas was inoculated into antibiotic-free LB liquid medium and cultured at 37°C for 12 h. The culture was then diluted and plated onto LB agar plates to obtain the recombinant strain E. coli MG1655ΔptsIALE-1ΔsdaAB with pCas plasmid eliminated.

[0077] (3) Knockout of the tdcG gene

[0078] Using NEB's gene mutation kit ( The Site-Directed Mutagenesis Kit (catalog number E0552S) was used to design primers S9 (SEQ ID NO:30, AACAGTCCGCGTTTTAGAGCTAGAAATAGC) and S10 (SEQ ID NO:31, TCCTGCCAGTGACTAGTATTATACCTAGG) to mutate the pTargetF vector according to the kit instructions. The N20 mutation sequence in the pTargetF vector is CAGGCCAGAGAGTGACAGCC (SEQ ID NO:32), and the tdcG gene knockout sequence is shown in SEQ ID NO:33. The mutated pTargetF was named pTargetF-tdcG.

[0079]

[0080] The primers S11 (SEQ ID NO: 34, GCTTATTAACCGCGACGAGCCATATTGTGGTCGATCTGTACGGGTC GTTGTCACTGACGGAAATCGCG) and S12 (SEQ ID NO: 35, TTGTACCTGTCCGGCAACCGGATCGCAGGTCAGCCCAAGGTTATGCTCCATCGCGATTTCCGTCAGTGA) were added to the PCR mixture to obtain a combination of two primers linked by overlap PCR, Donor△tdcG, which deletes 169-1107 bases of SEQ ID NO: 33, as a template for gene editing. The sequence of Donor△tdcG is shown in SEQ ID NO: 36.

[0081] SEQ ID NO: 36: GCTTATTAACCGCGACGAGCCATATTGTGGTCGATCTGTACGGGTC GTTGTCACTGACGGAAATCGCGATGGAGCATAACCTTGGGCTGACCTGCGATCCGGTTGCCGGACAGGTACAA.

[0082] The E. coli MG1655△ptsIALE-1△sdaAB / pCas9 bacterial lawn was picked into a 500 mL shake flask containing LB medium (50 mL) with kanamycin, and cultured at 30°C, 220 rpm. When the OD 600 of the culture medium was 0.2, 10 mM arabinose was added to induce, and the OD 600When OD600 is 0.45, prepare competent cells. Take 2 μL pTargetF-sdaB plasmid and 10 μL Donor△tdcG template DNA, and electrotransform into E. coli MG1655ΔptsIΔLE-1ΔsdaAB / pCas9 competent cells, and coat on a double-antibiotic plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultivate at 30°C. Use primers S23 (SEQ ID NO: 37, GATTGGTCCCTCCAGTTC) and S24 (SEQ ID NO: 38, CACTTTATCG AGTGAAACAC) to identify single colonies, and sequence to verify correct deletion of bases 169-1107 of SEQ ID NO: 33. Select single colonies with correct sequence of the knockout tdcG gene, and add 0.2 mM isopropyl-β-D-thiogalactoside (IPTG) to induce cultivation, and eliminate the pTargetF-tdcG plasmid, to obtain recombinant bacteria E. coli MG1655ΔptsIΔLE-1ΔsdaABΔtdcG / pCas, and still prepare competent cells according to the above method.

[0083] Recombinant bacteria E. coli MG1655ΔptsIΔLE-1ΔsdaABΔtdcG / pCas are inoculated into LB liquid culture medium without antibiotics, and cultivated at 37°C for 12 h, diluted and coated on LB plates, to obtain recombinant bacteria E. coli MG1655ΔptsIΔLE-1ΔsdaABΔtdcG with the pCas plasmid eliminated.

[0084] The sdaA, sdaB and tdcG genes of E. coli MG1655 are knocked out using the same gene editing method, to obtain engineering bacteria E. coli MG1655ΔsdaABΔtdcG.

[0085] (4) The plasmid expresses serA gene, serB gene and serC gene.

[0086] The expression vector pACYC184 is purchased from NEB Company, product catalog number E4152S. Double digestion is performed using restriction enzymes Xba I and Eag I, a 3236 bp vector skeleton is recovered using a gel recovery kit, and a 1009 bp band is removed, to obtain the purified pACYC184 restriction enzyme Xba I and Eag I double digestion large fragment.

[0087] The genomic DNA of E. coli K12 MG1655 was used as a template, and primers S31 (SEQ ID NO: 39, CTTATTAATCAGATAAAATATTTGTGTCACGCTTTTACCAG) and S32 (SEQ ID NO: 40, AGTTAGCACGCCCGGACGTGCTTCAGCGATGTGCATCAGACGAC) were used for PCR amplification to obtain a 1278 bp PCR amplification product; primers S33 (SEQ ID NO: 41, GTCGTCTGATGCACATCGCTGAAGCACGTCCGGGCGTGCTAACT) and S34 (SEQ ID NO: 42, GCTACCTTGTATCCATTGCTGCAACGGTGTGGAGAAG) were used for PCR amplification to obtain a 313 bp PCR amplification product; the two PCR products were recovered and purified by a gel recovery kit, and used as templates, and primers S31 (SEQ ID NO: 39) and S34 (SEQ ID NO: 42) were used for overlap PCR amplification, and the splicing sequence is shown in SEQ ID NO: 43. Among them, 1-23 bp is a homologous sequence before the restriction endonuclease Xba I site in pACYC184, 24 bp-222 bp is the untranslated region before the start codon of serA gene, containing promoter and RBS elements; 223 bp-1455 bp is the coding sequence of serA, which is introduced by overlap PCR mutation; 1456 bp-1527 bp is the untranslated region after the stop codon of serA, containing the terminator; 1527 bp-1547 bp is the homologous sequence with serB, which is used for DNA assembly. N346A / H344A

[0088] ​

[0089] The genomic DNA of E. coli K12 MG1655 was used as a template for PCR amplification with S35 (SEQ ID NO: 44, CTTCTCCACACCGTTGCAGCAATGGATACAAGGTAGC) and S36 (SEQ ID NO: 45, GTGACACACATCGCAATGAGGTACCTCGTTAATGCTGTGC), and a 1117 bp PCR amplification product was obtained, the sequence of which is shown as SEQ ID NO: 46. Among them, 1-17 bp is the homologous sequence of the serA gene, 18 bp-83 bp is the untranslated region before the start codon of the serB gene, containing elements such as promoters and RBS; 84 bp-1052 bp is the coding sequence of serB; 1053 bp-1097 bp is the untranslated region after the stop codon of serB, containing the terminator; 1098 bp-1117 bp is the homologous sequence of serC, which is used for DNA assembly.

[0090] SEQ ID NO: 46: CTTCTCCACACCGTTGCAGCAATGGATACAAGGTAGCCTCATGCG TTATTTTCCCTGCTTCGAACGATTTTACAGGAGCCTTAatgCCTAACATTACCTGGTGCGACCTGCCTGAAGATGTCTCTTTATGGCCGGGTCTGCCTCTTTCATTAAGTGGTGATGAAGTGATGCCACTGGATTACCACGCAGGTCGTAGCGGCTGGCTGCTGTATGGTCGTGGGCTGGATAAACAACGTCTGACCCAATACCAGAGCAAACTGGGTGCGGCGATGGTGATTGTTGCCGCCTGGTGCGTGGAAGATTATCAGGTGATTCGTCTGGCAGGTTCACTCACCGCACGGGCTACACGCCTGGCCCACGAAGCGCAGCTGGATGTCGCCCCGCTGGGGAAAATCCCGCACCTGCGCACGCCGGGTTTGCTGGTGATGGATATGGACTCCACCGCCATCCAGATTGAATGTATTGATGAAATTGCCAAACTGGCCGGAACGGGCGAGATGGTGGCGGAAGTAACCGAACGGGCGATGCGCGGCGAACTCGATTTTACCGCCAGCCTGCGCAGCCGTGTGGCGACGCTGAAAGGCGCTGACGCCAATATTCTGCAACAGGTGCGTGAAAATCTGCCGCTGATGCCAGGCTTAACGCAACTGGTGCTCAAGCTGGAAACGCTGGGCTGGAAAGTGGCGATTGCCTCCGGCGGCTTTACTTTCTTTGCTGAATACCTGCGCGACAAGCTGCGCCTGACCGCCGTGGTAGCCAATGAACTGGAGATCATGGACGGTAAATTTACCGGCAATGTGATCGGCGACATCGTAGACGCGCAGTACAAAGCGAAAACTCTGACTCGCCTCGCGCAGGAGTATGAAATCCCGCTGGCGCAGACCGTGGCGATTGGCGATGGAGCCAATGACCTGCCGATGATCAAAGCGGCAGGGCTGGGGATTGCCTACCATGCCAAGCCAAAAGTGAATGAAAAGGCGGAAGTCACCATCCGTCACGCTGACCTGATGGGGGTATTCTGCATCCTCTCAGGCAGCCTGAATCAGAAGtaaTTGCTCGCCCGCCATCCTGCGGGCGGCACAGCATTAACGAGGTACCTCATTGCGATGTGTGTCAC.

[0091] The genomic DNA of E. coli K12 MG1655 was used as a template for PCR amplification using primers S37 (SEQ ID NO: 47, GCACAGCATTAACGAGGTACCTCATTGCGATGTGTGTCAC) and S38 (SEQ ID NO: 48, CTGTTGTAGAGAGTTGAGTTCGGCCGACGCGCTG), to obtain a 1307 bp PCR amplification product, the sequence of which is shown as SEQ ID NO: 49. Among them, 1-20 bp is the homologous sequence of the serB gene, 18 bp-135 bp is the untranslated region before the start codon of the serC gene, containing elements such as promoters and RBS; 136 bp-1224 bp is the coding sequence of serC; 1225 bp-1294 bp is the untranslated region after the stop codon of serC, containing the terminator; 1295 bp-1307 bp is the homologous sequence after the restriction endonuclease EagI site in pACYC184, used for DNA assembly.

[0092]

[0093] The aforementioned purified pACYC184 restriction enzyme Xba I and Eag I double enzyme digestion large fragments, serA (SEQ ID NO: 43), serB (SEQ ID NO: 46) and serC (SEQ ID NO: 49) fragments were assembled using a one-step cloning kit (brand: Jinsha Biological, catalog number: SC612). According to the kit instructions, the assembly reaction solution was transformed into DH5a competent cells, and after subculture, positive transformants were screened, and the plasmid was extracted and sequenced to verify the sequence. The plasmid pACYC184-serA * BC.

[0094] The plasmid pACYC184-serA*BC was transformed into recombinant bacteria E. coli MG1655ΔptsIALE-1ΔsdaABΔtdcG and recombinant bacteria E. coli MG1655ΔsdaABΔtdcG, respectively, to obtain tryptophan-producing engineering bacteria E. coli MG1655ΔptsIALE-1ΔsdaABΔtdcG / pACYC184-serA * BC and engineering bacteria E. coli MG1655ΔsdaABΔtdcG / pACYC184-serA * BC.

[0095] Example 4, shake flask fermentation

[0096] The engineering bacteria E. coli MG1655ΔptsIALE-1ΔsdaABΔtdcG / pACYC184-serA * BC, engineering bacteria E. coli MG1655ΔsdaABΔtdcG / pACYC184-serA * BC were streaked onto solid LB medium containing 34 mg / L chloramphenicol and incubated at 37°C for 12 h. The bacterial lawn on the plate was picked and inoculated into LB medium slant, which was incubated at 37°C for 10-12 h. The bacterial lawn on the slant was picked and inoculated into liquid LB medium, which was incubated at 37°C, 220 rpm for 12 h to obtain the seed liquid. The seed liquid was inoculated into the shake flask fermentation medium at a 3% inoculation amount and incubated at 37°C, 220 rpm.

[0097] Shake flask fermentation medium: MOPS 80 g / L, glucose 20.0 g / L, ammonium sulfate 10.0 g / L, potassium dihydrogen phosphate 2.0 g / L, magnesium sulfate heptahydrate 2.0 g / L, yeast powder 5.0 g / L, trace element mixture 5 mL / L, and the balance is water.

[0098] Trace element mixture: FeS04*7H20 10 g / L, CaCl2 1.35 g / L, ZnS04*7H20 2.25 g / L, MnS04*4H20 0.5 g / L, CuS04*5H20 1 g / L, (NH4)6Mo70 24 4H20 0.106 g / L, Na2B407*10H20 0.23 g / L, CoCl26H20 0.48 g / L, 35% HC1 10 mL / L, and the rest is water.

[0099] During the cultivation, sample was taken every 4 h, and the pH value of the reaction system was adjusted to 6.8-7.0 with ammonia water. The glucose content was detected by using a biosensor analyzer, and when the glucose content in the system was less than 5 g / L, glucose was added to make the glucose concentration in the system reach 20 g / L. After 36 h of cultivation, sample was taken, centrifuged at 12000 g for 2 min, and the supernatant was taken to detect the serine content. The detection method of serine content was as follows: high performance liquid chromatography method, which was optimized on the basis of the amino acid detection method in the reference (Amino Acids and Biological Resources, 2000, 22, 59-60). The specific method was as follows: (2, 4-dinitrofluorobenzene (FDBN) pre-column derivatization high performance liquid chromatography):

[0100] 10 μL of the supernatant was taken into a 2 mL centrifuge tube, 200 μL of 0.5 M NaHCO3 aqueous solution and 100 μL of 1% (by volume) FDBN-acetonitrile solution were added, and the mixture was heated at 60°C in a water bath in the dark for 60 min, then cooled to room temperature, then 700 μL of 0.04 moL / L KH2PO4 aqueous solution (pH = 7.2 ± 0.05, adjusted with 40 g / L KOH aqueous solution) was added and shaken, and then stood for 15 min, then filtered and the filtrate was collected. The filtrate was used for sample loading, and the injection amount was 15 μL.

[0101] The chromatographic column was C 18 The column was ZORBAX EcLipse XDB-C18, 4.6*150 mm, AgiLent, USA; the column temperature was 40°C; the ultraviolet detection wavelength was 360 nm; the mobile phase A was 0.04 moL / L KH2PO4 aqueous solution (pH = 7.2 ± 0.05, adjusted with 40 g / 100 mL KOH aqueous solution), the mobile phase B was 55% (by volume) acetonitrile aqueous solution, and the total flow rate of the mobile phase was 1 mL / min.

[0102] The elution process: the volume fraction of mobile phase A in the total flow rate of mobile phase is 86% and the volume fraction of mobile phase B in the total flow rate of mobile phase is 14% at the starting time (0 min) of elution; the elution process is divided into four stages, and the volume fractions of mobile phase A and mobile phase D in the total flow rate of mobile phase are linearly changed in each stage; the volume fraction of mobile phase A in the total flow rate of mobile phase is 88% and the volume fraction of mobile phase B in the total flow rate of mobile phase is 12% at the end of the first stage (2 min after the starting time); the volume fraction of mobile phase A in the total flow rate of mobile phase is 86% and the volume fraction of mobile phase B in the total flow rate of mobile phase is 14% at the end of the second stage (2 min after the end of the first stage); the volume fraction of mobile phase A in the total flow rate of mobile phase is 70% and the volume fraction of mobile phase B in the total flow rate of mobile phase is 30% at the end of the third stage (6 min after the end of the second stage); the volume fraction of mobile phase A in the total flow rate of mobile phase is 30% and the volume fraction of mobile phase B in the total flow rate of mobile phase is 70% at the end of the fourth stage (10 min after the end of the third stage). The standard curve was prepared by using commercially available L-serine as a standard, and the serine content of the sample was calculated, and the detection results are shown in Table 3.

[0103] Table 3 Serine production of different engineering bacteria

[0104]

[0105] From the above table, compared with the engineering bacteria E. coli MG1655ΔsdaABΔtdcG / pACYC184-serA without the improved PTS system * BC, the engineering bacteria E. coli MG1655ΔptsIALE-1ΔsdaABΔtdcG / pACYC184-serA with the improved PTS system and adaptive evolution * BC, the serine production is significantly improved.

[0106] The above-described embodiments are only used to describe the preferred modes of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope of the present application defined by the claims.

Claims

1. A strain of Escherichia coli ΔptsI ALE-1, characterized in that, The preservation number of the E. coli △ptsI ALE-1 is CGMCC No. 35527.

2. Use of the E. coli △ptsI ALE-1 in claim 1 in the preparation of a high-serine yield engineering bacterium.

3. A high serine production engineered bacterium, characterized in that, The sdaA gene, the sdaB gene and the tdcG gene of the E. coli △ptsI ALE-1 are knocked out, and the serA gene, the serB gene and the serC gene are introduced; The preservation number of the E. coli △ptsI ALE-1 is CGMCC No. 35527.

4. The high serine-producing engineered bacteria according to claim 3, characterized in that, The nucleotide sequence of the sdaA gene is shown in SEQ ID NO: 15; the nucleotide sequence of the sdaB gene is shown in SEQ ID NO: 24; the nucleotide sequence of the tdcG gene is shown in SEQ ID NO: 33; the nucleotide sequence of the serA gene is shown in SEQ ID NO: 43 from the 223rd to the 1455th base pair; the nucleotide sequence of the serB gene is shown in SEQ ID NO: 46 from the 84th to the 1052nd base pair; and the nucleotide sequence of the serC gene is shown in SEQ ID NO: 46 from the 136th to the 1224th base pair.

5. The method for constructing high serine-producing engineered bacteria according to claim 3, characterized in that, The method comprises the following steps: The sdaA gene, the sdaB gene and the tdcG gene of the E. coli △ptsI ALE-1 are knocked out, and the serA gene, the serB gene and the serC gene are introduced to obtain the high-serine yield engineering bacterium. The preservation number of the E. coli △ptsI ALE-1 is CGMCC No. 35527.

6. The construction method of claim 5, wherein, The nucleotide sequence of the sdaA gene is shown in SEQ ID NO: 15; the nucleotide sequence of the sdaB gene is shown in SEQ ID NO: 24; and the nucleotide sequence of the tdcG gene is shown in SEQ ID NO:

33.

7. The construction method of claim 5, wherein, The nucleotide sequence of the serA gene is shown in SEQ ID NO: 43 from the 223rd to the 1455th base pair; the nucleotide sequence of the serB gene is shown in SEQ ID NO: 46 from the 84th to the 1052nd base pair; and the nucleotide sequence of the serC gene is shown in SEQ ID NO: 46 from the 136th to the 1224th base pair.

8. The construction method of claim 5, wherein, The copy number of each of the serA gene, the serB gene and the serC gene is 1 copy.

9. Use of the high-serine yield engineering bacterium in claim 3 or 4 in the production of serine.

10. A method of producing serine, characterized by, The method comprises the step of producing serine by using the high-serine yield engineering bacterium in claim 3 or 4.

Citation Information

Patent Citations

  • Method of producing l-amino acid

    CN103642863A

  • Method for producing beta-alanine by mixed bacteria fermentation

    CN111411130A