Application of Brassica napus BnaALaAT1 gene in breeding plant varieties with stress resistance and high yield

Abstract

This invention discloses a rapeseed BnaALaAT1 The application of genes in breeding stress-resistant, high-yielding plant varieties, the aforementioned BnaALaAT1 The nucleotide sequence of the gene is shown in SEQ ID NO.1. This invention clones the versatile gene from rapeseed. BnaALaAT1 We constructed pure-line plants by introducing rapeseed and conducted phenotypic investigations under various conditions. The experimental results showed that... BnaALaAT1 Genetically modified rapeseed exhibits significantly superior growth compared to the wild type under both normal and various adverse conditions, fully demonstrating that this gene can enhance the plant's survival ability under various adverse conditions by regulating the plant's response mechanism to multiple stresses, providing a crucial guarantee for the stable growth of plants under diverse adverse conditions. Compared to the wild type, transgenic plants not only show a significant increase in yield, with a maximum increase of 53.7%, but also a significant increase in oil content.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant genetic engineering, and particularly relates to a Brassica napus BnaALaAT1 and application of the gene in breeding of plant varieties with stress resistance and high yield. BACKGROUND

[0002] Brassica napus is the largest oil crop in China, and domestic rapeseed oil accounts for more than 55% of the oil yield of oil crops. Stable and high yield of rapeseed is of great significance to the safe supply of edible vegetable oil.

[0003] The stress resistance (salt tolerance, cold tolerance, waterlogging tolerance, and low nitrogen tolerance) and yield (thousand-grain weight, number of pods per plant, and number of seeds per pod) of rapeseed are both typical quantitative traits controlled by multiple genes, which are dominated by independent and crossing regulatory networks and are prone to interact with the environment. In traditional breeding, enhancing stress resistance is often accompanied by the "trade-off effect" of yield reduction: on the one hand, rapeseed needs to consume a large amount of carbon and nitrogen resources to synthesize osmoregulatory substances such as proline and betaine when responding to stress, which occupies the material allocation during the reproductive growth stage; on the other hand, most stress-related genes (such as stress-responsive transcription factors) may interfere with flowering regulation, photosynthetic product transport, and other developmental pathways, resulting in reduced seed setting rate. In addition, stress resistance genes screened under laboratory conditions often show functional failure under field complex stress (such as low temperature + waterlogging, salt stress + low nitrogen), which further increases the difficulty of improving stress resistance and yield of rapeseed. For example, Chinese patent (CN106434740B) discloses the application of Brassica napus BnbHLH60 gene in improving seed weight. By overexpressing the gene in Arabidopsis, it was found that the grain length, grain width, and grain weight of the transgenic lines were significantly increased, and the increase in grain length was greater than that in grain width, and was mainly achieved by increasing the number of cells, while the number of seeds per pod was not significantly affected, which provided guarantee for the improvement of final yield. Although the patent improves the yield by overexpression of the gene, it does not mention the effect of the gene on the stress resistance of rapeseed, nor does it consider whether the trade-off between stress resistance and yield will occur. If the gene reduces the stress resistance of rapeseed while improving the yield, the yield may be unstable due to environmental stress in actual production.

[0004] In recent years, research in the field of crop molecular biology has confirmed that "multi-tasking genes" can break the "trade-off effect" between stress resistance and yield by integrating multiple physiological processes and coordinating resource allocation, which provides a new way for rapeseed improvement. Drawing on the research logic of genes such as wheat ERECTA (simultaneously improving drought resistance and seed setting rate) and rice OsDREB1C (simultaneously regulating photosynthesis, nitrogen utilization and yield), the focus in rapeseed has begun to focus on the excavation of two types of "multi-tasking genes": one is the core gene that regulates the signal pathway, which balances stress response and yield formation by simultaneously activating the defense against adversity and growth and development pathways; the other is the key gene involved in material metabolism, which not only enhances stress resistance but also promotes seed development by optimizing sugar transport, ion balance or amino acid synthesis. By using these multi-tasking genes, it is expected to breed new rapeseed varieties that can maintain high yield under adverse conditions, providing gene resources and technical support for the sustainable development of rapeseed industry. SUMMARY

[0005] The main purpose of the present application is to provide a rapeseed BnaALaAT1 The application of the gene in breeding stress-resistant and high-yield plant varieties aims to provide a gene for improving the multi-stress resistance of rapeseed varieties, improving photosynthetic efficiency, and enhancing yield and quality. Through multi-omics analysis, the target gene BnaALaAT1 After constructing the overexpression vector of the gene and performing genetic transformation, the phenotype of the transgenic lines and wild type was investigated, and it was confirmed that the gene has the properties of multi-resistance (salt tolerance, low nitrogen tolerance, cold tolerance, and flooding tolerance), high photosynthetic efficiency, high yield, and high oil content.

[0006] To achieve the above-mentioned purpose, the present application provides a rapeseed BnaALaAT1 The application of the gene in any of the following:

[0007] (1) in the application of breeding salt-tolerant plant varieties;

[0008] (2) in the application of breeding low-nitrogen-tolerant plant varieties;

[0009] (3) in the application of breeding cold-tolerant plant varieties;

[0010] (4) in the application of breeding flooding-tolerant plant varieties;

[0011] (5) in the application of promoting plant high photosynthetic efficiency;

[0012] (6) in the application of promoting plant high yield;

[0013] The nucleotide sequence of the gene is shown in SEQ ID NO. 1. BnaALaAT1

[0014] Preferably, the plant is rapeseed.

[0015] ​The application also provides a plant comprising the gene as described above. BnaALaAT1 Application of the gene in promoting high oil content of Brassica napus.

[0016] The gene cloned by the application encodes alanine transaminase (AlaAT), which is widely distributed in the plant kingdom, is one of the core pivots connecting plant carbon metabolism and nitrogen metabolism, and is crucial for the growth and development of plants and their adaptation to the environment. Alanine transaminase exists in almost all higher plants and is distributed in various tissues and organs of plants, such as leaves, roots, flowers and developing seeds. Its core biochemical function is to catalyze the reversible transamination reaction between alanine and alpha-ketoglutarate to generate pyruvate and glutamic acid. This reaction is crucial because the four substances generated by it are all core intermediates of plant metabolism: pyruvate is a key molecule of sugar metabolism, and glutamic acid is the core of nitrogen assimilation and amino acid synthesis. Therefore, AlaAT acts as a bridge to coordinate the flow of carbon skeleton and the distribution and reuse of nitrogen elements; by generating glutamic acid, AlaAT provides a nitrogen source for the synthesis of other amino acids and nitrogen-containing compounds, and is a key enzyme for the efficient use of nitrogen by plants. Through its core catalytic function, alanine transaminase is deeply involved in multiple physiological processes from seed development to overall growth, and in-depth research on its function has important significance for guiding agricultural practice (such as cultivating nitrogen-efficient crops and rational fertilization).

[0017] Preferably, the Brassica napus BnaALaAT1 The amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO. 2.

[0018] The application also provides a plant comprising the gene as described above. BnaALaAT1 The application also provides an expression vector of the gene for use in any one of the following aspects:

[0019] (1) for use in breeding salt-tolerant plant varieties;

[0020] (2) for use in breeding low-nitrogen-tolerant plant varieties;

[0021] (3) for use in breeding cold-tolerant plant varieties;

[0022] (4) for use in breeding salt-tolerant plant varieties;

[0023] (5) for use in promoting high light efficiency of plants;

[0024] (6) for use in promoting high yield of plants;

[0025] The application also provides an expression vector of the gene for use in any one of the following aspects: BnaALaAT1 The nucleotide sequence of the gene is shown as SEQ ID NO. 1.

[0026] The application also provides a host cell comprising the expression vector as described above for use in any one of the following aspects:

[0027] (1) Application in the cultivation of salt-tolerant plant varieties;

[0028] (2) Application in the cultivation of low-nitrogen tolerant plant varieties;

[0029] (3) Application in the cultivation of cold-resistant plant varieties;

[0030] (4) Application in the cultivation of waterlogged-tolerant plant varieties;

[0031] (5) Application in promoting high light efficiency in plants;

[0032] (6) Application in promoting high plant yields;

[0033] The BnaALaAT1 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0034] The present invention also proposes a method comprising the above-described components. BnaALaAT1 The application of genetically modified plant cells, tissues, or organs in any of the following:

[0035] (1) Application in the cultivation of salt-tolerant plant varieties;

[0036] (2) Application in the cultivation of low-nitrogen tolerant plant varieties;

[0037] (3) Application in the cultivation of cold-resistant plant varieties;

[0038] (4) Application in the cultivation of waterlogged-tolerant plant varieties;

[0039] (5) Application in promoting high light efficiency in plants;

[0040] (6) Application in promoting high plant yields;

[0041] The BnaALaAT1 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0042] This invention also proposes a method for specifically amplifying rapeseed as described above. BnaALaAT1 Primer pairs for the gene, the sequences of which are shown in SEQ ID NO.5 and SEQ ID NO.6, or in SEQ ID NO.7 and SEQ ID NO.8.

[0043] The present invention also proposes the application of the primer pair as described above in any of the following:

[0044] (1) Application in the cultivation of salt-tolerant plant varieties;

[0045] (2) Application in the cultivation of low-nitrogen tolerant plant varieties;

[0046] (3) Application in the cultivation of cold-resistant plant varieties;

[0047] (4) Application in the cultivation of waterlogged-tolerant plant varieties;

[0048] (5) Application in promoting high light efficiency in plants;

[0049] (6) Application in promoting high plant yield;

[0050] The sequences of the primer pairs are shown in SEQ ID NO.5 and SEQ ID NO.6, or in SEQ ID NO.7 and SEQ ID NO.8.

[0051] This invention also proposes a method for cultivating salt-tolerant or low-nitrogen-tolerant, or cold-tolerant or waterlogging-tolerant plant varieties, comprising the following steps: constructing gene-carrying... BnaALaAT1 The expression vector was introduced into Agrobacterium, and plants were transformed by Agrobacterium to obtain a gene-containing organism. BnaALaAT1 The T0 generation, obtained through three consecutive generations of screening, is a transitional generation. BnaALaAT1 The expression vector is pCAMBIA1301- BnaALaAT1 .

[0052] This invention also proposes a method for promoting high light efficiency, high yield, or high oil content in plants, comprising the following steps: constructing a gene-carrying... BnaALaAT1 The expression vector was introduced into Agrobacterium, and plants were transformed by Agrobacterium to obtain a gene-containing organism. BnaALaAT1 The T0 generation, obtained through three consecutive generations of screening, is a transitional generation. BnaALaAT1 Pure lineage.

[0053] The present invention also proposes a rapeseed as described above. BnaALaAT1 The application of genes in plant breeding, through overexpression of rapeseed as described above. BnaALaAT1 Genes were used to obtain transgenic plants with improved salt tolerance, low nitrogen tolerance, cold tolerance, and waterlogging tolerance, as well as high light efficiency and high yield.

[0054] Preferably, the plant is a plant of the genus Brassica or Arabidopsis.

[0055] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0056] (1) The present invention clones the versatile gene from rapeseed. BnaALaAT1 We constructed pure-line plants by introducing rapeseed and conducted phenotypic investigations under various conditions. The experimental results showed that... BnaALaAT1Genetically modified rapeseed exhibits significantly superior growth compared to the wild type under both normal and various adverse conditions (waterlogging, salinity, cold, and low nitrogen). This demonstrates that the gene can enhance plant survival under various adverse conditions by regulating the plant's response mechanism, providing a crucial guarantee for stable plant growth under these conditions. Compared to the wild type, transgenic plants not only show a significant increase in yield (up to 53.7%) but also a significant increase in oil content (up to 23%). This breaks through the traditional breeding bottleneck where "enhanced stress resistance is often accompanied by a decrease in yield or quality," achieving synergistic optimization of stress resistance, high yield, and high oil content. It provides a novel genetic solution for rapeseed production that balances yield and quality under adverse conditions.

[0057] (2) The multifaceted gene of the present invention BnaALaAT1 The discovery and application of this gene provides a clear functional gene target for improving crop waterlogging tolerance. By constructing expression vectors containing this gene and combining them with mature technologies such as Agrobacterium-mediated transformation, it can be stably introduced into target plants to obtain pure-line transgenic plants. The operation process is clear, controllable, and highly reproducible. The application of this gene resource not only shortens the breeding cycle of stress-resistant, high-yielding, and high-oil-content varieties, but also simultaneously improves crop stress resistance and yield traits, breaking through the limitations of traditional breeding that relies on natural variation. It provides an efficient and precise technical path for cultivating new high-yielding and high-oil-content crop varieties with strong stress resistance and wide adaptability. Attached Figure Description

[0058] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0059] Figure 1 For the wild type and BnaALaAT1 Genetically modified rapeseed lines BnaALaAT1 Image showing the results of gene relative expression level detection.

[0060] Figure 2 For the wild type and BnaALaAT1 A diagram showing the growth status of a transgenic rapeseed line during its germination period under normal conditions.

[0061] Figure 3 For the wild type ZS9 of this invention and BnaALaAT1 Statistical results of root length (a) and stem length (b) of transgenic lines during germination.

[0062] Figure 4 For the wild type ZS9 of this invention and BnaALaAT1The growth state diagram of the transgenic line under normal conditions and water culture to five leaf stage, figure (a): top view; figure (b): plan view; figure (c): leaf anatomical diagram of wild type and overexpression line at five leaf stage.

[0063] Figure 5 The wild type ZS9 and BnaALaAT1 The photosynthetic related index determination result diagram of the transgenic line under normal conditions and water culture to five leaf stage; figure (a) is the wild type ZS9 and BnaALaAT1 The net photosynthetic rate determination diagram of the transgenic line; figure (b) is the wild type ZS9 and BnaALaAT1 The transpiration rate determination diagram of the transgenic line; figure (c) is the wild type ZS9 and BnaALaAT1 The intercellular CO2 concentration determination diagram of the transgenic line; figure (d) is the wild type ZS9 and BnaALaAT1 The stomatal conductance determination diagram of the transgenic line; figure (e) is the wild type ZS9 and BnaALaAT1 The SPAD determination diagram of the transgenic line.

[0064] Figure 6 The wild type ZS9 and BnaALaAT1 The cell observation result diagram of the leaf of the transgenic line.

[0065] Figure 7 The wild type ZS9 and BnaALaAT1 The growth state diagram of the flowering stage of the transgenic line.

[0066] Figure 8 The wild type ZS9 and BnaALaAT1 The oil content determination diagram of the overexpression line and wild type.

[0067] Figure 9 The wild type ZS9 and BnaALaAT1 The fresh weight root crown ratio analysis result diagram of the transgenic line under low nitrogen condition.

[0068] Figure 10 The wild type ZS9 and BnaALaAT1 The phenotype analysis result diagram of the transgenic line under the simulation of waterlogging condition, wherein figure (a): survival rate of each line under waterlogging for 30h; figure (b): relative conductivity statistics of each line under waterlogging stress; figure (c): growth state diagram of each line under waterlogging for 30h.

[0069] Figure 11 The wild type ZS9 and BnaALaAT1 The phenotype analysis result diagram of the transgenic line under the simulation of salt damage condition.

[0070] Figure 12 The wild type ZS9 and BnaALaAT1Phenotypic analysis results of transgenic lines under low temperature: Figure (a): Germination test of transgenic materials and wild-type under low temperature stress in the dark, with wild-type ZS9 in the upper left, overexpression line AT1 in the upper right, low-temperature resistant material C18 in the lower left, and low-temperature sensitive material ZS6 in the lower right; Figure (b): Germination test of transgenic materials and wild-type under low temperature stress in soil culture.

[0071] Figure 13 For the wild type ZS9 of this invention and BnaALaAT1 Figure 1 shows the results of photosynthetic index measurement of transgenic lines at the five-leaf stage under low temperature. Figure 2 shows the net photosynthetic rate of different lines; Figure 3 shows the stomatal conductance of different lines; Figure 4 shows the intercellular CO2 concentration of different lines; and Figure 5 shows the transpiration rate of different lines.

[0072] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation

[0073] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially. Furthermore, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0074] The technical solution of the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not intended to limit the present invention.

[0075] Example 1: Rapeseed multi-talent gene BnaALaAT1 Cloning

[0076] The total RNA was extracted from ZS9 using a plant total RNA small amount extraction kit (Quangen, ER501), and the first strand of cDNA was synthesized by reverse transcription using a cDNA kit (AT311). The PCR reaction system was as follows: Green Taq Mix 10 µL, upstream primer (5’-CTGGTTTTGTGATTGGGCACC-3’, SEQ ID NO. 5) 0.5 µL, downstream primer (5’-GCTCTAACATATGCTCTCACACT-3’, SEQ ID NO. 6) 0.5 µL, cDNA 1 µL, ddH2O 8 µL, and the total volume was 20 µL.

[0077] The amplification program was as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s, 58 °C annealing for 15 s, 72 °C extension for 1 min, a total of 35 cycles; and finally 72 °C extension for 5 min. The PCR product was recovered using a gel recovery kit (Omega, D2500), and then the recovered product was connected with a pCE3 Blunt Vector carrier to obtain a recombinant plasmid pCE3 Blunt Vector- BnaALaAT1 , which was used to transform E. coli competent cells. After colonies were selected and subjected to PCR amplification, the target band was detected by agarose gel electrophoresis, and then sequencing was performed. BnaALaAT1 The nucleotide sequence of the gene is shown in SEQ ID NO. 1, and the molecular weight is 1877 bp. The amino acid sequence encoded thereby is shown in SEQ ID NO. 2.

[0078] Example 2: Brassica napus versatile gene BnaALaAT1 Construction of expression vector

[0079] According to the purpose of the fragment and the carrier pCAMBIA1301, appropriate homologous recombination primers (F: 5’-acgggggacgagctcggtaccATGCGGAGATTCGTTATTGGC-3’, SEQ ID NO. 7; R: 5’-catgtcgactctagaggatccTTAGTTGCGGAACTCATCCATG-3’, SEQ ID NO. 8) were designed. ZS9 cDNA was used as a template, and Green Taq Mix was selected for amplification reaction. The PCR product was separated and recovered by agarose gel electrophoresis method, and the BnaALaAT1 gene homologous recombination fragment was extracted.

[0080] The plant overexpression vector pCAMBIA1301-35S plasmid DNA was extracted using a plasmid extraction kit (Omega, D6943), and the extracted plasmid was double digested with Bam HI and Kpn I two endonucleases. The enzyme digestion system includedBamH I 2µL, Kpn I 2µL, 10×Fly Cut Buffer, plasmid 2µg, ddH2O to make up to a total volume of 40µL, digested at 37℃ for 2 h, and the target fragment was recovered and purified.

[0081] Next, the purified and recovered vector and target fragment were ligated using the ClonExpress II One Step Cloning Kit (Novizan, C112). The ligation system consisted of vector pCAMBIA1301-35S-NOS, target fragment 3.5 µL, 5×CE II Buffer 4 µL, Exnase II 2 µL, and ddH2O to a total volume of 20 µL. The mixture was incubated at 37°C for 30 min and then immediately transferred to ice for cooling. The resulting recombinant plasmid pCAMBIA1301- BnaALaAT1 .use BnaALaAT1 The upstream primer for the gene and the downstream sequencing primer for the vector (F: 5'–ATGCGGAGATTCGTTATTGGC–3', SEQ ID NO.3; R: 5'–gcaatgaaactgatgcattg–3', SEQ ID NO.4) were detected by electrophoresis. The ligated recombinant plasmid pCAMBIA1301- BnaALaAT1 Transform Escherichia coli DH5α competent cells, select colonies for PCR amplification, detect the target bands by agarose gel electrophoresis, and then expand the culture.

[0082] Example 3: Agrobacterium-mediated transformation and culture method in rapeseed

[0083] Will contain BnaALaAT1 The gene overexpression vector pCAMBIA1301 was transformed into competent Agrobacterium GV3101 to prepare Agrobacterium infection solution. Rapeseed inflorescences were then infected using the flower-dipping method. The infected plants were then covered with plastic film and cultured in the dark for 24 h before being transferred to a greenhouse for conventional cultivation. Once the rapeseed matured, seeds were harvested individually. The harvested rapeseed seeds were sterilized at 4℃ and then sown in 1 / 2 MS solid medium containing the antibiotic Kan (50 μg / ml) to screen for positive seedlings. These positive seedlings were then transplanted into a culture medium (vermiculite: nutrient soil in a 1:1 volume ratio). After the seedlings grew, DNA was extracted from plant leaves and used in Example 1. BnaALaAT1 PCR detection was performed using upstream and downstream primers to verify the gene, and representative positive lines AT1~AT12 were obtained. The genetic transformation experiment of this infected rapeseed was commissioned to Wuhan Boyuan Biotechnology Co., Ltd., and the genetic transformation process and positive identification were based on the company's experimental methods (https: / / plant.biorun.com / single / 20).

[0084] Example 4 Expression verification of transgenic plants

[0085] When the positive strains AT1-AT12 and wild type ZS9 reached the three-leaf stage, about 0.1 g of the last unfolded leaf was taken to extract RNA, and after reverse transcription with a unified amount, qRT-PCR test was carried out, and data calculation was carried out by using 2 –ΔΔCt The overexpression of each strain was compared with the wild type, and the results are shown in Figure 1 .

[0086] Example 5 Germination stage growth experiment

[0087] Wild type ZS9 and AT1, AT3, AT9 three strains were used to carry out germination stage growth experiment, and an appropriate amount of uniform and full seeds were dispersed and laid on the petri dish containing 1% agar medium, and placed in a light incubator at 25°C for 16h light / 8h dark for 5d, and then the growth state and root length, stem length were counted. The results are shown in Figure 2 and Figure 3 The growth rate of transgenic strains AT1 and AT3 at the germination stage was significantly higher than that of the wild type, and the stem length of AT1 was 1.79 times that of the wild type, and the root length was 1.23 times that of the wild type, the stem length of AT3 was 1.51 times that of the wild type, and the root length was 1.24 times that of the wild type, and the growth rate of AT9 was close to that of the wild type, and the stem length was 1.44 times that of the wild type, and the root length was 1.13 times that of the wild type.

[0088] Example 6 Seedling stage growth experiment

[0089] AT1 and wild type ZS9 were each taken 30 grains on wet filter paper at 25°C for 16h light / 8h dark for 7d, then transplanted to water culture (water culture nutrient solution formula refers to Table 1 normal nitrogen supply condition), and the phenotype was observed when water culture reached five-leaf stage, and the root system was placed in water, completely separated, then scanned and analyzed using WinRHIZO root scanning instrument. The phenotype is shown in Figure 4 , and the statistical results are shown in Table 2, the leaf number of transgenic strain AT1 (6.66 ± 0.33) is increased by 33.2% compared with ZS9 (5.00 ± 0.00), and its SPAD value (15.33 ± 1.01) is significantly higher than that of ZS9 (8.60 ± 0.72), with an increase of 78.3%, indicating that AT1 has stronger photosynthetic pigment accumulation ability. In terms of root system configuration, the main root length of AT1 (23.17 ± 1.67 cm) is extended by 21.8%, the total root length (855.0 ± 84.1 cm) is increased by 28.7%, and the root system complexity is significantly improved-the branch number (7989.6 ± 552.8) is increased by 16.4%, and the intersection number (1325.0 ± 155.0) is increased by 87.5%.

[0090] Table 1 Hoagland Nutrient Solution Formula (1 / 2 Concentration)

[0091]

[0092] Table 2. Phenotypic differences between wild-type ZS9 and transgenic lines at the five-leaf stage.

[0093]

[0094] In order to investigate BnaALaAT1 To investigate whether genes affect leaf photosynthetic efficiency, photosynthetic-related indicators were measured in wild-type and transgenic lines. Figure 5 A Li-6800 photosynthesis meter (equipped with an independent leaf chamber for direct measurement of physiological indicators such as net photosynthetic rate, transpiration rate, SPAD value, stomatal conductance, and intercellular CO2 concentration in rapeseed experimental materials) was used. Figure 5 The results showed that the SPAD values ​​of the overexpression line AT1 at all leaf positions were higher than those of the wild type, with the second-to-last leaf being 66% higher and the third-to-last leaf being 78% higher. The overexpression lines exhibited significantly higher net photosynthetic rate, transpiration rate, and stomatal conductance compared to the wild type. The transgenic lines showed a 20.7%-28.5% increase in net photosynthetic rate, a 19%-88% increase in transpiration rate, and a 15%-117% increase in stomatal conductance. While there was no significant difference in intercellular CO2 concentration compared to the wild type, the transgenic lines showed a 9.9% increase. These results indicate that overexpression... BnaALaAT1 It can significantly increase the chlorophyll content of rapeseed leaves, thereby improving net photosynthetic rate, stomatal conductance, transpiration rate, and intercellular CO2 concentration. Leaves were collected and fixed in FAA solution (50% ethanol, 5% acetic acid, 10% formaldehyde). They were then prepared for paraffin embedding and sectioning. Cross sections were stained with toluidine blue (1% toluidine blue and 2% borate) and observed under an Olympus BX51 microscope equipped with a CCD camera. The results are as follows: Figure 6 As shown, the transgenic lines have significantly increased leaf thickness. The palisade tissue of wild-type leaves consists of 1-2 layers of loose short cells, while the palisade tissue of transgenic lines develops into 3-4 layers of tightly arranged long columnar cells. The chloroplast enrichment area is significantly expanded, and the spongy tissue is thickened.

[0095] Example 7: Investigation of agronomic traits at maturity of different genotype lines

[0096] Each genotype line was cultivated and managed normally in an indoor growing room until maturity, and morphological indicators of each line were examined. Plant type comparisons are as follows: Figure 7As shown in Table 3, compared with the wild type (ZS9), the number of effective branches, the number of pods and the number of seeds per pod of the transgenic plants were significantly improved. Specifically, in terms of branch number, AT1 and AT3 increased by about 34.9% and 45.0% respectively compared with the wild type, and the average increase of transgenic lines AT1 and AT3 (9.00 ± 1.00 and 9.67 ± 1.15 respectively) was about 40.0% compared with the wild type ZS9 (6.67 ± 0.58); in terms of the number of pods, AT1 and AT3 increased by 44.5% and 65.4% respectively compared with the wild type, and the average increase of AT1 and AT3 (53.00 ± 7.81 and 60.67 ± 10.02 respectively) was about 55.0% compared with ZS9 (36.67 ± 4.93); in terms of the number of seeds per pod, AT1 and AT3 increased by 30.6% and 38.3% respectively compared with the wild type, and the average increase of AT1 and AT3 (14.80 ± 0.35 and 15.67 ± 1.15 respectively) was about 34.5% compared with ZS9 (11.33 ± 0.81). In terms of yield per plant, AT1 and AT3 (2.14 ± 0.23 g / plant and 2.49 ± 0.25 g / plant respectively) increased by about 42.90% compared with ZS9 (1.62 ± 0.17 g / plant). Among them, AT1 increased by 32.10% compared with ZS9, and AT3 increased by 53.70% compared with ZS9, showing a significant yield advantage. The seed oil content was determined by near-infrared spectroscopy, and the results are shown in Table 4. Figure 8 As shown in Table 4, the wild type ZS9 detected oil content of 35.13%, and the transgenic line AT1 had an oil content of 43.32%, which was 23% higher than the wild type.

[0097] Table 3 Yield-related traits of wild type and transgenic lines

[0098]

[0099] Example 8 Different nitrogen concentration treatment experiment

[0100] The wild type ZS9 and the transgenic line AT1 were selected, and 30 seeds of each were cultured on wet filter paper at 25°C for 16 h light / 8 h dark for 7 days, then transplanted for water culture. The water culture solution was prepared according to Table 1, and the water culture was counted after 22 days. The results showed that (Table 5) Figure 9 ), the root length of the overexpression material under normal and nitrogen deficiency conditions was significantly higher than that of the wild type control, with an increase of 33%-47%. The root-shoot ratio of ZS9 under normal nitrogen condition was 0.25, and that of AT1 was 0.30. Under nitrogen deficiency condition, the root-shoot ratio of ZS9 was 0.38, and that of AT1 was 0.68. Under normal conditions, the root-shoot ratio of the high expression line AT1 was 20% higher than that of the wild type, and under nitrogen deficiency conditions, it was 79% higher than that of the wild type. The results showed that the overexpression of the gene could significantly increase the root-shoot ratio of the plant. BnaALaAT1The gene can significantly promote the development of Brassica napus root, mainly promote the elongation of main root and the development of lateral root and increase the root-shoot ratio of plant.

[0101] Example 9 Identification test of waterlogging resistance

[0102] Wild type ZS9 and transgenic lines AT1, AT3 and AT9, 300 seeds of each line were evenly and uniformly scattered on the culture dish filled with moistened filter paper in advance, and placed in a light incubator at 25℃ for 16h light / 8h dark for about 2d. When the radicle was 3-5mm long, the waterlogging experiment for 30h and conductivity determination were carried out respectively (conductivity determination used DDS-307A conductivity meter, which was opened in advance, and the electrode was cleaned before conductivity and temperature calibration. The first leachate was determined for conductivity, recorded as M1; the centrifuge tube was placed in 95℃ water bath for 30min, and the leachate was determined for conductivity, recorded as M2. The relative conductivity (M) was calculated according to the following formula: M=M1 / M2). Each treatment had 25 seeds, and the experiment was repeated three times. After 30h of waterlogging, the seeds were washed with pure water for three times and placed on moistened filter paper for recovery for 5d. The survival rate was counted and the related indexes were measured. The results are shown in Figure 10 Fig. 1, from which it can be seen that the survival rates of the transgenic lines were significantly higher than that of the control. Figure 10 (a) and (c), the relative conductivity of the transgenic lines was significantly lower than that of the wild type, as shown in Figure 10 (b), which suggests that overexpression of the gene can improve the salt tolerance of Brassica napus by improving the cell stability under waterlogging stress. BnaALaAT1

[0103] Example 10 Identification test of salt resistance

[0104] A 214mM solution of 100mL was prepared, and 8mL was placed on a culture dish covered with clean filter paper. Wild type ZS9 and transgenic line AT1, 25 seeds of each line were placed on the culture dish, which was sealed with sealing film and cultured at 25℃ for 16h light / 8h dark for 5d. The radicle elongation of 2mm was considered as germination, and the germination rate was counted. The results are shown in Figure 11 Fig. 3, under the treatment of 214mM NaCl, ZS9 could not germinate normally, while the germination rate of AT1 reached 100%, which indicates that overexpression of the gene can significantly improve the salt tolerance of Brassica napus at the germination stage. BnaALaAT1

[0105] Example 11 Identification test of cold resistance

[0106] ​​Germination stage: select low temperature resistant material C18, low temperature sensitive material ZS6, wild type ZS9 and overexpression line AT1 and different strains, respectively take 25 uniform and full seeds, spread on the culture dish filled with wet filter paper in advance, place in the low temperature incubator 4℃ avoid light, germination test, radicle elongation 2mm is considered to germinate, statistics germination rate at 9am every day.

[0107] Each strain is repeated three times, 6 seeds per repeat, sowed in nutrient soil, placed in a low temperature incubator 8℃ 16h light / 4℃ 8h dark culture, two cotyledons fully expanded is considered to germinate, statistics germination rate at 9am every day.

[0108] The results are shown in Figure 12 As shown, C18 and high expression line AT1 have all germinated at 20d and the growth state of AT1 is obviously better than C18, while low temperature sensitive material ZS6 and wild type ZS9 only have a small amount of seed germination.

[0109] The photosynthetic index is determined at three leaf stage (the specific method refers to embodiment 6), the results are shown in Figure 13 As shown, the net photosynthetic rate of overexpression line is increased by 31.4%-67.2% compared with wild type; the increase amplitude of transpiration rate is 15%-76% compared with wild type, thus it can be known that overexpression BnaALaAT1 Still can maintain the advantage of net photosynthetic rate under low temperature stress.

[0110] The above is only the preferred embodiment of the present application, and does not limit the patent scope of the present application, for those skilled in the art, the present application can have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the patent protection scope of the present application.

Claims

1. Brassica napus BnaALaAT1 The application of the gene in breeding salt-tolerant Brassica napus varieties, the gene BnaALaAT1 The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, The oilseed rape BnaALaAT1 The amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO.

2.

3. A method of producing a salt-tolerant Brassica plant, comprising the steps of: a) introducing into a Brassica plant cell a nucleic acid molecule comprising a nucleotide sequence of SEQ ID NO. 1; b) growing the Brassica plant cell under conditions suitable for plant growth and development; and c) recovering the Brassica plant. BnaALaAT1 The use of the expression vector of the gene in the breeding of salt-tolerant Brassica varieties, wherein the expression vector of the gene is introduced into a Brassica plant cell. BnaALaAT1 The nucleotide sequence of the gene is shown in SEQ ID 4. Use of a host cell comprising the expression vector as claimed in claim 3 for breeding salt tolerant Brassica cultivars, said BnaALaAT1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

5. A transgenic plant cell, tissue or organ comprising the BnaALaATl gene of claim 1, wherein the nucleotide sequence of the BnaALaATl gene is set forth in SEQ ID NO.

1. BnaALaAT1 Use of a transgenic plant cell, tissue or organ comprising the BnaALaATl gene of claim 1, wherein the nucleotide sequence of the BnaALaATl gene is set forth in SEQ ID NO. 1, in breeding a salt-tolerant Brassica variety.

6. A method of breeding salt tolerant Brassica cultivars, characterized in that, comprising the steps of: Constructing a gene carrier BnaALaAT1 The expression vector was introduced into Agrobacterium, and rapeseed was transformed by Agrobacterium to obtain a gene containing the gene. BnaALaAT1 The T0 generation, obtained through three consecutive generations of screening, is a transitional generation. BnaALaAT1 The expression vector is pCAMBIA1301. BnaALaAT1 The gene BnaALaAT1 The nucleotide sequence is shown in SEQ ID NO.

1.

7. A Brassica plant as described in claim 1. BnaALaAT1 application of the gene in breeding of Brassica, characterized in that, By overexpressing the Brassica napus BnaALaAT1 gene as described in claim 1, transgenic plants are obtained that are tolerant to salt.

Images